셀타젠 Genetic Genotyping

KLK5 Rabbit Polyclonal Antibody

KLK5 Polyclonal Antibody

ABP59064-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human KLK5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KLK5 from Human. This KLK5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK5 protein

KLK5 Polyclonal Antibody

ABP59064-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human KLK5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KLK5 from Human. This KLK5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK5 protein

KLK5 Polyclonal Antibody

ES11097-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against KLK5 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

KLK5 Polyclonal Antibody

ES11097-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KLK5 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Kallikrein 5 (KLK5) ELISA Kit

DLR-KLK5-Hu-48T 48T
EUR 479
  • Should the Human Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 5 (KLK5) in samples from serum, plasma, saliva, tissue homogenates or other biological fluids.

Human Kallikrein 5 (KLK5) ELISA Kit

DLR-KLK5-Hu-96T 96T
EUR 621
  • Should the Human Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 5 (KLK5) in samples from serum, plasma, saliva, tissue homogenates or other biological fluids.

Mouse Kallikrein 5 (KLK5) ELISA Kit

DLR-KLK5-Mu-48T 48T
EUR 489
  • Should the Mouse Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Kallikrein 5 (KLK5) ELISA Kit

DLR-KLK5-Mu-96T 96T
EUR 635
  • Should the Mouse Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Kallikrein 5 (KLK5) ELISA Kit

RDR-KLK5-Hu-48Tests 48 Tests
EUR 500

Human Kallikrein 5 (KLK5) ELISA Kit

RDR-KLK5-Hu-96Tests 96 Tests
EUR 692

Mouse Kallikrein 5 (KLK5) ELISA Kit

RDR-KLK5-Mu-48Tests 48 Tests
EUR 511

Mouse Kallikrein 5 (KLK5) ELISA Kit

RDR-KLK5-Mu-96Tests 96 Tests
EUR 709

Human Kallikrein 5 (KLK5) ELISA Kit

RD-KLK5-Hu-48Tests 48 Tests
EUR 478

Human Kallikrein 5 (KLK5) ELISA Kit

RD-KLK5-Hu-96Tests 96 Tests
EUR 662

Mouse Kallikrein 5 (KLK5) ELISA Kit

RD-KLK5-Mu-48Tests 48 Tests
EUR 489

Mouse Kallikrein 5 (KLK5) ELISA Kit

RD-KLK5-Mu-96Tests 96 Tests
EUR 677

KLK5 Rabbit pAb

A10917-100ul 100 ul
EUR 308

KLK5 Rabbit pAb

A10917-200ul 200 ul
EUR 459

KLK5 Rabbit pAb

A10917-20ul 20 ul Ask for price

KLK5 Rabbit pAb

A10917-50ul 50 ul Ask for price

KLK5 Rabbit pAb

A2991-100ul 100 ul
EUR 308

KLK5 Rabbit pAb

A2991-200ul 200 ul
EUR 459

KLK5 Rabbit pAb

A2991-20ul 20 ul
EUR 183

KLK5 Rabbit pAb

A2991-50ul 50 ul
EUR 223

KLK5 Rabbit pAb

A14863-100ul 100 ul
EUR 308

KLK5 Rabbit pAb

A14863-200ul 200 ul
EUR 459

KLK5 Rabbit pAb

A14863-20ul 20 ul
EUR 183

KLK5 Rabbit pAb

A14863-50ul 50 ul
EUR 223

KLK5 antibody

70R-18162 50 ul
EUR 435
Description: Rabbit polyclonal KLK5 antibody

KLK5 antibody

70R-14167 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal KLK5 antibody

KLK5 Antibody

36941-100ul 100ul
EUR 252

KLK5 antibody

38528-100ul 100ul
EUR 252

KLK5 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

KLK5 Antibody

DF7137 200ul
EUR 304
Description: KLK5 Antibody detects endogenous levels of total KLK5.

KLK5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

KLK5 antibody

70R-6355 50 ug
EUR 467
Description: Rabbit polyclonal KLK5 antibody raised against the N terminal of KLK5

KLK5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

KLK5 Antibody

ABD7137 100 ug
EUR 438

Polyclonal Goat Anti-KLK5 Antibody

APG00182G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-KLK5 . This antibody is tested and proven to work in the following applications:

Kallikrein 5 (KLK5) polyclonal antibody

ABP-PAB-10238 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

KLK5 Polyclonal Antibody, HRP Conjugated

A51430 100 µg
EUR 570.55
Description: reagents widely cited

KLK5 Polyclonal Antibody, FITC Conjugated

A51431 100 µg
EUR 570.55
Description: Ask the seller for details

KLK5 Polyclonal Antibody, Biotin Conjugated

A51432 100 µg
EUR 570.55
Description: The best epigenetics products

Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5)

KLK5 Conjugated Antibody

C36941 100ul
EUR 397

KLK5 Conjugated Antibody

C38528 100ul
EUR 397

Anti-KLK5 antibody

STJ24335 100 µl
EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein.

Anti-KLK5 antibody

STJ112813 100 µl
EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein.

Anti-KLK5 antibody

STJ117063 100 µl
EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein.

Anti-KLK5 antibody

STJ71121 100 µg
EUR 359

Anti-KLK5 antibody

STJ192255 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KLK5

Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), APC

  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with APC.

Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with Biotin.

Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), Cy3

  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with Cy3.

Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), FITC

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with FITC.

Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), HRP

  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with HRP.

Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), PE

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with PE.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KLK5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KLK5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KLK5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Kallikrein 5 (KLK5) Antibody

  • EUR 1107.00
  • EUR 537.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kallikrein 5 (KLK5) Antibody

  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kallikrein 5 (KLK5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 5 (KLK5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody

abx145910-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kallikrein 5 (KLK5) Antibody

abx032799-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody

abx032799-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody

abx234459-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Kallikrein 5 (KLK5) Antibody

abx432899-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Kallikrein 5 (KLK5) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with APC-Cy7.

KLK5 Blocking Peptide

33R-1662 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KLK5 antibody, catalog no. 70R-6355

KLK5 cloning plasmid

CSB-CL897100HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 882
  • Sequence: atggctacagcaagacccccctggatgtgggtgctctgtgctctgatcacagccttgcttctgggggtcacagagcatgttctcgccaacaatgatgtttcctgtgaccacccctctaacaccgtgccctctgggagcaaccaggacctgggagctggggccggggaagacgcccg
  • Show more
Description: A cloning plasmid for the KLK5 gene.

KLK5 Blocking Peptide

DF7137-BP 1mg
EUR 195

Kallikrein 5 (KLK5) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Kallikrein 5/KLK5 Antibody

PA1630 100ug/vial
EUR 334

Human KLK5 ELISA Kit

55R-1762 1 kit
EUR 651
Description: ELISA Kit for detection of KLK5 in the research laboratory

KLK5 protein (His tag)

80R-2369 20 ug
EUR 349
Description: Purified recombinant Human KLK5 protein (His tag)

Human KLK5 ELISA Kit

ELA-E1163h 96 Tests
EUR 824


EF010935 96 Tests
EUR 689

Human KLK5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KLK5 ELISA Kit

LF-EK50922 1×96T
EUR 648

Kallikrein 5/KLK5/KLKL2

MO15028 500 ug
EUR 513

Kallikrein 5/KLK5/KLKL2

RA19046 100 ug
EUR 344

Recombinant Kallikrein 5 (KLK5)

  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P15945
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.0kDa
  • Isoelectric Point: 6
Description: Recombinant Mouse Kallikrein 5 expressed in: E.coli

KLK5 Recombinant Protein (Human)

RP017254 100 ug Ask for price

KLK5 Recombinant Protein (Mouse)

RP146141 100 ug Ask for price

Mouse Kallikrein 5 (KLK5) Protein

  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human KLK5 PicoKine ELISA Kit

EK0817 96 wells
EUR 456
Description: For quantitative detection of human KLK5 in cell culture supernates, serum, plasma(heparin , EDTA), human milk and saliva.

Human Kallikrein 5 (KLK5) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

KLK5 ORF Vector (Human) (pORF)

ORF005752 1.0 ug DNA
EUR 95

Klk5 ORF Vector (Mouse) (pORF)

ORF048715 1.0 ug DNA
EUR 506

KLK5 ELISA Kit (Human) (OKBB00333)

OKBB00333 96 Tests
EUR 544
Description: Description of target: Kallikrein gene 5 (KLK5, also known as KLK-L2), located on chromosome 19q13.4, is one of the newly identified members of the kallikrein gene family, which is a subgroup of the serine protease enzyme family. In normal human tissues, KLK5 is highly expressed in skin, mammary gland and testis. KLK5 has been suggested to regulate cell shedding (desquamation) in conjunction with KLK7 and KLK14, given its ability to degrade proteins which form the extracellular component of cell junctions in the stratum corneum. It is proposed that KLK5 regulates this process since it is able to self-activate in addition to activating KLK7 and KLK14.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 10 pg/ml

KLK5 ELISA Kit (Human) (OKCD06351)

OKCD06351 96 Wells
EUR 609
Description: Description of target: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 12.5pg/mL

Mouse Kallikrein 5 (KLK5) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 5 (KLK5) ELISA Kit

  • EUR 5640.00
  • EUR 3009.00
  • EUR 707.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 5 (KLK5) ELISA Kit

abx251464-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human KLK5/ Kallikrein-5 ELISA Kit

E1390Hu 1 Kit
EUR 537

Human KLK5(Kallikrein-5) ELISA Kit

EH0213 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9Y337
  • Alias: KLK5/Kallikrein-like protein 2(KLK-L2)/Stratum corneum tryptic enzyme
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Kallikrein- 5, KLK5 ELISA KIT

ELI-03824h 96 Tests
EUR 824

Human Kallikrein-5(KLK5) ELISA kit

CSB-EL012456HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Kallikrein-5 (KLK5) in samples from serum, plasma, cell culture supernates, tissue homogenates, saliva. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Kallikrein-5(KLK5) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Kallikrein-5(KLK5) in samples from serum, plasma, cell culture supernates, tissue homogenates, saliva. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Kallikrein 5 (KLK5) ELISA Kit

abx576328-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Kallikrein 5 (KLK5) CLIA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Kallikrein 5 (KLK5) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Klk5 sgRNA CRISPR Lentivector set (Mouse)

K3032901 3 x 1.0 ug
EUR 339

KLK5 sgRNA CRISPR Lentivector set (Human)

K1159901 3 x 1.0 ug
EUR 339

KLK5 Kallikrein-5 Human Recombinant Protein

PROTQ9Y337 Regular: 10ug
EUR 317
Description: KLK5 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 252 amino acids (67-293) and having a molecular mass of 27.8kDa.;KLK5 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Kallikrein 5 (KLK5) ELISA Kit

SEA451Hu-10x96wellstestplate 10x96-wells test plate
EUR 3409.41
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 5 (KLK5) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Kallikrein 5 (KLK5) ELISA Kit

SEA451Hu-1x48wellstestplate 1x48-wells test plate
EUR 368.42
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 5 (KLK5) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Kallikrein 5 (KLK5) ELISA Kit

SEA451Hu-1x96wellstestplate 1x96-wells test plate
EUR 483.46
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 5 (KLK5) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Kallikrein 5 (KLK5) ELISA Kit

SEA451Hu-5x96wellstestplate 5x96-wells test plate
EUR 1875.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 5 (KLK5) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Kallikrein 5 (KLK5) ELISA Kit

  • EUR 3460.00
  • EUR 1826.00
  • EUR 484.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kallikrein 5 elisa. Alternative names of the recognized antigen: KLK-L2
  • KLKL2
  • SCTE
  • Kallikrein-Related Peptidase 5
  • Kallikrein-like protein 2
  • Stratum corneum tryptic enzyme
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kallikrein 5 (KLK5) in samples from serum, plasma, saliva, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Kallikrein 5 (KLK5) ELISA Kit

SEA451Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Kallikrein 5 (KLK5) ELISA Kit

SEA451Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Kallikrein 5 (KLK5) ELISA Kit

SEA451Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Kallikrein 5 (KLK5) ELISA Kit

SEA451Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Kallikrein 5 (KLK5) ELISA Kit

  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kallikrein 5 elisa. Alternative names of the recognized antigen: KLK-L2
  • KLKL2
  • SCTE
  • Kallikrein-Related Peptidase 5
  • Kallikrein-like protein 2
  • Stratum corneum tryptic enzyme
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Kallikrein 5 ELISA Kit (KLK5)

RK02973 96 Tests
EUR 521

Mouse Kallikrein-5(KLK5) ELISA kit

QY-E21646 96T
EUR 361

ELISA kit for Mouse KLK5 (Kallikrein 5)

ELK2371 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 5 (KLK5). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 5 (
  • Show more
Description: A sandwich ELISA kit for detection of Kallikrein 5 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human KLK5 (Kallikrein 5)

ELK1203 1 plate of 96 wells
EUR 372
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 5 (KLK5). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 5 (
  • Show more
Description: A sandwich ELISA kit for detection of Kallikrein 5 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Recombinant Human Kallikrein 5/KLK5 (C-6His)

C415-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Recombinant Human Kallikrein 5/KLK5 (C-6His)

C415-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Recombinant Human Kallikrein 5/KLK5 (C-6His)

C415-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Recombinant Human Kallikrein 5/KLK5 (C-6His)

C415-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Klk5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3032902 1.0 ug DNA
EUR 154

Klk5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3032903 1.0 ug DNA
EUR 154

Klk5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3032904 1.0 ug DNA
EUR 154

KLK5 sgRNA CRISPR Lentivector (Human) (Target 1)

K1159902 1.0 ug DNA
EUR 154

KLK5 sgRNA CRISPR Lentivector (Human) (Target 2)

K1159903 1.0 ug DNA
EUR 154

KLK5 sgRNA CRISPR Lentivector (Human) (Target 3)

K1159904 1.0 ug DNA
EUR 154

ELISA kit for Human Kallikrein-5 (KLK5)

KTE61896-48T 48T
EUR 332
  • KLK5 belongs to the kallikrein subgroup of serine proteases, which have diverse physiologic functions in many tissues. For background information on kallikreins.Using a positional candidate approach to identify additional KLK genes on 19q13.3-q13.4,
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-5 (KLK5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kallikrein-5 (KLK5)

KTE61896-5platesof96wells 5 plates of 96 wells
EUR 2115
  • KLK5 belongs to the kallikrein subgroup of serine proteases, which have diverse physiologic functions in many tissues. For background information on kallikreins.Using a positional candidate approach to identify additional KLK genes on 19q13.3-q13.4,
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-5 (KLK5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kallikrein-5 (KLK5)

KTE61896-96T 96T
EUR 539
  • KLK5 belongs to the kallikrein subgroup of serine proteases, which have diverse physiologic functions in many tissues. For background information on kallikreins.Using a positional candidate approach to identify additional KLK genes on 19q13.3-q13.4,
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-5 (KLK5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

KLK5 Protein Vector (Human) (pPB-C-His)

PV023005 500 ng
EUR 329

KLK5 Protein Vector (Human) (pPB-N-His)

PV023006 500 ng
EUR 329

KLK5 Protein Vector (Human) (pPM-C-HA)

PV023007 500 ng
EUR 329

KLK5 Protein Vector (Human) (pPM-C-His)

PV023008 500 ng
EUR 329

KLK5 Protein Vector (Mouse) (pPB-C-His)

PV194858 500 ng
EUR 603

KLK5 Protein Vector (Mouse) (pPB-N-His)

PV194859 500 ng
EUR 603

KLK5 Protein Vector (Mouse) (pPM-C-HA)

PV194860 500 ng
EUR 603

KLK5 Protein Vector (Mouse) (pPM-C-His)

PV194861 500 ng
EUR 603

Recombinant Human KLK5 Protein, His, E.coli-100ug

QP12507-HIS-100ug 100ug
EUR 1261

Recombinant Human KLK5 Protein, His, E.coli-1mg

QP12507-HIS-1mg 1mg
EUR 5251

Recombinant Human KLK5 Protein, His, E.coli-10ug

QP12507-HIS-EC-10ug 10ug
EUR 201

Recombinant Human KLK5 Protein, His, E.coli-2ug

QP12507-HIS-EC-2ug 2ug
EUR 155

Recombinant Human KLK5 Protein, His, Insect-10ug

QP12507-HIS-INSECT-10ug 10ug
EUR 201

Recombinant Human KLK5 Protein, His, Insect-2ug

QP12507-HIS-INSECT-2ug 2ug
EUR 155

Klk5 3'UTR Luciferase Stable Cell Line

TU110683 1.0 ml Ask for price

Klk5 3'UTR GFP Stable Cell Line

TU160683 1.0 ml Ask for price

Klk5 3'UTR Luciferase Stable Cell Line

TU206799 1.0 ml Ask for price

Klk5 3'UTR GFP Stable Cell Line

TU256799 1.0 ml Ask for price

KLK5 3'UTR GFP Stable Cell Line

TU061891 1.0 ml
EUR 1394

KLK5 3'UTR Luciferase Stable Cell Line

TU011891 1.0 ml
EUR 1394

KLK5 ELISA Kit (Human) : 96 Wells (OKEH02813)

OKEH02813 96 Wells
EUR 544
Description: Description of target: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

KLK5 Rabbit Polyclonal Antibody