LAX1 Rabbit Polyclonal Antibody
LAX1 Polyclonal Antibody |
ABP59097-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of LAX1 from Human, Mouse, Rat. This LAX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110 |
LAX1 Polyclonal Antibody |
27649-100ul |
SAB |
100ul |
EUR 252 |
LAX1 Polyclonal Antibody |
27649-50ul |
SAB |
50ul |
EUR 187 |
LAX1 Rabbit pAb |
A12218-100ul |
Abclonal |
100 ul |
EUR 308 |
LAX1 Rabbit pAb |
A12218-200ul |
Abclonal |
200 ul |
EUR 459 |
LAX1 Rabbit pAb |
A12218-20ul |
Abclonal |
20 ul |
EUR 183 |
LAX1 Rabbit pAb |
A12218-50ul |
Abclonal |
50 ul |
EUR 223 |
LAX1 Polyclonal Conjugated Antibody |
C27649 |
SAB |
100ul |
EUR 397 |
LAX1 antibody |
70R-6590 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal LAX1 antibody raised against the middle region of LAX1 |
LAX1 antibody |
70R-9683 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal LAX1 antibody |
LAX1 antibody |
70R-18223 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal LAX1 antibody |
LAX1 Antibody |
1-CSB-PA012771GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
LAX1 Antibody |
1-CSB-PA811614LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
Polyclonal LAX1 Antibody (internal region) |
APR17176G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LAX1 (internal region). This antibody is tested and proven to work in the following applications: |
anti- LAX1 antibody |
FNab04710 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: lymphocyte transmembrane adaptor 1
- Uniprot ID: Q8IWV1
- Gene ID: 54900
- Research Area: Signal Transduction
|
Description: Antibody raised against LAX1 |
Anti-LAX1 antibody |
STJ192443 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to LAX1 |
LAX1 siRNA |
20-abx902939 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LAX1 siRNA |
20-abx922300 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LAX1 siRNA |
20-abx922301 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-LAX1 |
YF-PA19440 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to LAX1 |
LAX1 Antibody, HRP conjugated |
1-CSB-PA811614LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
LAX1 Antibody, FITC conjugated |
1-CSB-PA811614LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
LAX1 Antibody, Biotin conjugated |
1-CSB-PA811614LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
LAX1 Blocking Peptide |
33R-4955 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LAX1 antibody, catalog no. 70R-6590 |
LAX1 Blocking Peptide |
33R-1089 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCTD11 antibody, catalog no. 70R-1493 |
LAX1 cloning plasmid |
CSB-CL811614HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 969
- Sequence: atgcccttgctgactttgccacaaaccagacaaagagccaaaaatatttatgacatcttgccttggcgacaggaagacctggggagacatgagtcgaggagtatgcgcattttcagtactgagagcctcctctccagaaattctgagagcccggagcatgtgccctcccaagcagg
- Show more
|
Description: A cloning plasmid for the LAX1 gene. |
Rat LAX1 shRNA Plasmid |
20-abx990851 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human LAX1 shRNA Plasmid |
20-abx960308 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse LAX1 shRNA Plasmid |
20-abx982472 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LAX1 Recombinant Protein (Human) |
RP017578 |
ABM |
100 ug |
Ask for price |
LAX1 Recombinant Protein (Rat) |
RP207857 |
ABM |
100 ug |
Ask for price |
LAX1 Recombinant Protein (Mouse) |
RP146936 |
ABM |
100 ug |
Ask for price |
LAX1 Recombinant Protein (Mouse) |
RP146939 |
ABM |
100 ug |
Ask for price |
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody |
20-abx126081 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody |
20-abx113547 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody |
abx030461-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody |
abx030461-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody |
20-abx318746 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody |
abx432919-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody |
abx234710-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody (HRP) |
20-abx316368 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody (FITC) |
20-abx316369 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody (Biotin) |
20-abx316370 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
LAX1 ORF Vector (Human) (pORF) |
ORF005860 |
ABM |
1.0 ug DNA |
EUR 95 |
Lax1 ORF Vector (Rat) (pORF) |
ORF069287 |
ABM |
1.0 ug DNA |
EUR 506 |
Lax1 ORF Vector (Mouse) (pORF) |
ORF048980 |
ABM |
1.0 ug DNA |
EUR 506 |
Lax1 ORF Vector (Mouse) (pORF) |
ORF048981 |
ABM |
1.0 ug DNA |
EUR 506 |
LAX1 sgRNA CRISPR Lentivector set (Human) |
K1198401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lax1 sgRNA CRISPR Lentivector set (Mouse) |
K3218401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lax1 sgRNA CRISPR Lentivector set (Rat) |
K7491701 |
ABM |
3 x 1.0 ug |
EUR 339 |
LAX1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1198402 |
ABM |
1.0 ug DNA |
EUR 154 |
LAX1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1198403 |
ABM |
1.0 ug DNA |
EUR 154 |
LAX1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1198404 |
ABM |
1.0 ug DNA |
EUR 154 |
Lax1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3218402 |
ABM |
1.0 ug DNA |
EUR 154 |
Lax1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3218403 |
ABM |
1.0 ug DNA |
EUR 154 |
Lax1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3218404 |
ABM |
1.0 ug DNA |
EUR 154 |
Lax1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7491702 |
ABM |
1.0 ug DNA |
EUR 154 |
Lax1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7491703 |
ABM |
1.0 ug DNA |
EUR 154 |
Lax1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7491704 |
ABM |
1.0 ug DNA |
EUR 154 |
LAX1 Protein Vector (Human) (pPB-C-His) |
PV023437 |
ABM |
500 ng |
EUR 329 |
LAX1 Protein Vector (Human) (pPB-N-His) |
PV023438 |
ABM |
500 ng |
EUR 329 |
LAX1 Protein Vector (Human) (pPM-C-HA) |
PV023439 |
ABM |
500 ng |
EUR 329 |
LAX1 Protein Vector (Human) (pPM-C-His) |
PV023440 |
ABM |
500 ng |
EUR 329 |
LAX1 Protein Vector (Rat) (pPB-C-His) |
PV277146 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Rat) (pPB-N-His) |
PV277147 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Rat) (pPM-C-HA) |
PV277148 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Rat) (pPM-C-His) |
PV277149 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Mouse) (pPB-C-His) |
PV195918 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Mouse) (pPB-N-His) |
PV195919 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Mouse) (pPM-C-HA) |
PV195920 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Mouse) (pPM-C-His) |
PV195921 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Mouse) (pPB-C-His) |
PV195922 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Mouse) (pPB-N-His) |
PV195923 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Mouse) (pPM-C-HA) |
PV195924 |
ABM |
500 ng |
EUR 603 |
LAX1 Protein Vector (Mouse) (pPM-C-His) |
PV195925 |
ABM |
500 ng |
EUR 603 |
Lax1 3'UTR Luciferase Stable Cell Line |
TU206959 |
ABM |
1.0 ml |
Ask for price |
Lax1 3'UTR GFP Stable Cell Line |
TU160921 |
ABM |
1.0 ml |
Ask for price |
LAX1 3'UTR Luciferase Stable Cell Line |
TU012289 |
ABM |
1.0 ml |
EUR 1521 |
Lax1 3'UTR Luciferase Stable Cell Line |
TU110921 |
ABM |
1.0 ml |
Ask for price |
LAX1 3'UTR GFP Stable Cell Line |
TU062289 |
ABM |
1.0 ml |
EUR 1521 |
Lax1 3'UTR GFP Stable Cell Line |
TU256959 |
ABM |
1.0 ml |
Ask for price |
Human Lymphocyte transmembrane adapter 1, LAX1 ELISA KIT |
ELI-19284h |
Lifescience Market |
96 Tests |
EUR 824 |
Bovine Lymphocyte transmembrane adapter 1, LAX1 ELISA KIT |
ELI-21100b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Lymphocyte transmembrane adapter 1, Lax1 ELISA KIT |
ELI-37755m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Lymphocyte transmembrane adapter 1 (LAX1) ELISA Kit |
abx388235-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
LAX1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV679417 |
ABM |
1.0 ug DNA |
EUR 682 |
LAX1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV679421 |
ABM |
1.0 ug DNA |
EUR 682 |
LAX1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV679422 |
ABM |
1.0 ug DNA |
EUR 682 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
LAX1 Rabbit Polyclonal Antibody