
셀타젠 Genetic Genotyping

LAX1 Rabbit Polyclonal Antibody

LAX1 Rabbit Polyclonal Antibody

LAX1 Polyclonal Antibody

ABP59097-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LAX1 from Human, Mouse, Rat. This LAX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110

LAX1 Polyclonal Antibody

27649-100ul 100ul
EUR 252

LAX1 Polyclonal Antibody

27649-50ul 50ul
EUR 187

LAX1 Rabbit pAb

A12218-100ul 100 ul
EUR 308

LAX1 Rabbit pAb

A12218-200ul 200 ul
EUR 459

LAX1 Rabbit pAb

A12218-20ul 20 ul
EUR 183

LAX1 Rabbit pAb

A12218-50ul 50 ul
EUR 223

LAX1 Polyclonal Conjugated Antibody

C27649 100ul
EUR 397

LAX1 antibody

70R-6590 50 ug
EUR 467
Description: Rabbit polyclonal LAX1 antibody raised against the middle region of LAX1

LAX1 antibody

70R-9683 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal LAX1 antibody

LAX1 antibody

70R-18223 50 ul
EUR 435
Description: Rabbit polyclonal LAX1 antibody

LAX1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

LAX1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

Polyclonal LAX1 Antibody (internal region)

APR17176G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LAX1 (internal region). This antibody is tested and proven to work in the following applications:

Lax1/ Rat Lax1 ELISA Kit

ELI-14389r 96 Tests
EUR 886

anti- LAX1 antibody

FNab04710 100µg
EUR 505.25
  • Immunogen: lymphocyte transmembrane adaptor 1
  • Uniprot ID: Q8IWV1
  • Gene ID: 54900
  • Research Area: Signal Transduction
Description: Antibody raised against LAX1

Anti-LAX1 antibody

PAab04710 100 ug
EUR 355

Anti-LAX1 antibody

STJ72071 100 µg
EUR 260

Anti-LAX1 antibody

STJ114109 100 µl
EUR 277

Anti-LAX1 antibody

STJ192443 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LAX1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19440 50 ug
EUR 363
Description: Mouse polyclonal to LAX1

LAX1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LAX1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LAX1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LAX1 Blocking Peptide

33R-4955 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LAX1 antibody, catalog no. 70R-6590

LAX1 Blocking Peptide

33R-1089 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCTD11 antibody, catalog no. 70R-1493

LAX1 cloning plasmid

CSB-CL811614HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 969
  • Sequence: atgcccttgctgactttgccacaaaccagacaaagagccaaaaatatttatgacatcttgccttggcgacaggaagacctggggagacatgagtcgaggagtatgcgcattttcagtactgagagcctcctctccagaaattctgagagcccggagcatgtgccctcccaagcagg
  • Show more
Description: A cloning plasmid for the LAX1 gene.


EF010631 96 Tests
EUR 689

Rat LAX1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LAX1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LAX1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LAX1 Recombinant Protein (Human)

RP017578 100 ug Ask for price

LAX1 Recombinant Protein (Rat)

RP207857 100 ug Ask for price

LAX1 Recombinant Protein (Mouse)

RP146936 100 ug Ask for price

LAX1 Recombinant Protein (Mouse)

RP146939 100 ug Ask for price

Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody

abx030461-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody

abx030461-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody

abx432919-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody

abx234710-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lymphocyte Transmembrane Adapter 1 (LAX1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

LAX1 ORF Vector (Human) (pORF)

ORF005860 1.0 ug DNA
EUR 95

Lax1 ORF Vector (Rat) (pORF)

ORF069287 1.0 ug DNA
EUR 506

Lax1 ORF Vector (Mouse) (pORF)

ORF048980 1.0 ug DNA
EUR 506

Lax1 ORF Vector (Mouse) (pORF)

ORF048981 1.0 ug DNA
EUR 506

LAX1 sgRNA CRISPR Lentivector set (Human)

K1198401 3 x 1.0 ug
EUR 339

Lax1 sgRNA CRISPR Lentivector set (Mouse)

K3218401 3 x 1.0 ug
EUR 339

Lax1 sgRNA CRISPR Lentivector set (Rat)

K7491701 3 x 1.0 ug
EUR 339

LAX1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1198402 1.0 ug DNA
EUR 154

LAX1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1198403 1.0 ug DNA
EUR 154

LAX1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1198404 1.0 ug DNA
EUR 154

Lax1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3218402 1.0 ug DNA
EUR 154

Lax1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3218403 1.0 ug DNA
EUR 154

Lax1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3218404 1.0 ug DNA
EUR 154

Lax1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7491702 1.0 ug DNA
EUR 154

Lax1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7491703 1.0 ug DNA
EUR 154

Lax1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7491704 1.0 ug DNA
EUR 154

LAX1 Protein Vector (Human) (pPB-C-His)

PV023437 500 ng
EUR 329

LAX1 Protein Vector (Human) (pPB-N-His)

PV023438 500 ng
EUR 329

LAX1 Protein Vector (Human) (pPM-C-HA)

PV023439 500 ng
EUR 329

LAX1 Protein Vector (Human) (pPM-C-His)

PV023440 500 ng
EUR 329

LAX1 Protein Vector (Rat) (pPB-C-His)

PV277146 500 ng
EUR 603

LAX1 Protein Vector (Rat) (pPB-N-His)

PV277147 500 ng
EUR 603

LAX1 Protein Vector (Rat) (pPM-C-HA)

PV277148 500 ng
EUR 603

LAX1 Protein Vector (Rat) (pPM-C-His)

PV277149 500 ng
EUR 603

LAX1 Protein Vector (Mouse) (pPB-C-His)

PV195918 500 ng
EUR 603

LAX1 Protein Vector (Mouse) (pPB-N-His)

PV195919 500 ng
EUR 603

LAX1 Protein Vector (Mouse) (pPM-C-HA)

PV195920 500 ng
EUR 603

LAX1 Protein Vector (Mouse) (pPM-C-His)

PV195921 500 ng
EUR 603

LAX1 Protein Vector (Mouse) (pPB-C-His)

PV195922 500 ng
EUR 603

LAX1 Protein Vector (Mouse) (pPB-N-His)

PV195923 500 ng
EUR 603

LAX1 Protein Vector (Mouse) (pPM-C-HA)

PV195924 500 ng
EUR 603

LAX1 Protein Vector (Mouse) (pPM-C-His)

PV195925 500 ng
EUR 603

Lax1 3'UTR Luciferase Stable Cell Line

TU206959 1.0 ml Ask for price

Lax1 3'UTR GFP Stable Cell Line

TU160921 1.0 ml Ask for price

LAX1 3'UTR Luciferase Stable Cell Line

TU012289 1.0 ml
EUR 1521

Lax1 3'UTR Luciferase Stable Cell Line

TU110921 1.0 ml Ask for price

LAX1 3'UTR GFP Stable Cell Line

TU062289 1.0 ml
EUR 1521

Lax1 3'UTR GFP Stable Cell Line

TU256959 1.0 ml Ask for price

Human Lymphocyte transmembrane adapter 1, LAX1 ELISA KIT

ELI-19284h 96 Tests
EUR 824

Bovine Lymphocyte transmembrane adapter 1, LAX1 ELISA KIT

ELI-21100b 96 Tests
EUR 928

Mouse Lymphocyte transmembrane adapter 1, Lax1 ELISA KIT

ELI-37755m 96 Tests
EUR 865

Human Lymphocyte transmembrane adapter 1 (LAX1) ELISA Kit

abx388235-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

LAX1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV679417 1.0 ug DNA
EUR 682

LAX1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV679421 1.0 ug DNA
EUR 682

LAX1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV679422 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

LAX1 Rabbit Polyclonal Antibody