LDB3 Rabbit Polyclonal Antibody
LDB3 Polyclonal Antibody |
ABP59101-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90
- Applications tips:
|
Description: A polyclonal antibody for detection of LDB3 from Human, Mouse. This LDB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90 |
LDB3 Polyclonal Antibody |
ABP59101-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90
- Applications tips:
|
Description: A polyclonal antibody for detection of LDB3 from Human, Mouse. This LDB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90 |
LDB3 Polyclonal Antibody |
30932-100ul |
SAB |
100ul |
EUR 252 |
LDB3 Polyclonal Antibody |
30932-50ul |
SAB |
50ul |
EUR 187 |
LDB3 Rabbit pAb |
A7462-100ul |
Abclonal |
100 ul |
EUR 308 |
LDB3 Rabbit pAb |
A7462-200ul |
Abclonal |
200 ul |
EUR 459 |
LDB3 Rabbit pAb |
A7462-20ul |
Abclonal |
20 ul |
EUR 183 |
LDB3 Rabbit pAb |
A7462-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal LDB3 Antibody (Center) |
APR17180G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LDB3 (Center). This antibody is tested and proven to work in the following applications: |
LDB3 Polyclonal Conjugated Antibody |
C30932 |
SAB |
100ul |
EUR 397 |
LDB3 antibody |
70R-18235 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal LDB3 antibody |
LDB3 antibody |
70R-1141 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal LDB3 antibody raised against the N terminal of LDB3 |
LDB3 Antibody |
DF12652 |
Affbiotech |
200ul |
EUR 304 |
Description: LDB3 Antibody detects endogenous levels of LDB3. |
LDB3 Antibody |
1-CSB-PA012831ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against LDB3. Recognizes LDB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
LDB3 Antibody |
1-CSB-PA012831ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against LDB3. Recognizes LDB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
LDB3 Antibody |
1-CSB-PA012831GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against LDB3. Recognizes LDB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Polyclonal LDB3 Antibody (N-term) |
APR17183G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LDB3 (N-term). This antibody is tested and proven to work in the following applications: |
anti- LDB3 antibody |
FNab04734 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: LIM domain binding 3
- Uniprot ID: O75112
- Gene ID: 11155
- Research Area: Developmental biology
|
Description: Antibody raised against LDB3 |
Anti-LDB3 antibody |
STJ29598 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. |
Anti-LDB3 antibody |
STJ192577 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to LDB3 |
LDB3 siRNA |
20-abx922381 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LDB3 siRNA |
20-abx922382 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-LDB3 |
YF-PA17478 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to LDB3 |
anti-LDB3 |
YF-PA27498 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to LDB3 |
Polyclonal Goat Anti-ZASP/ CYPHER / LDB3 Antibody |
APR16432G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ZASP/ CYPHER / LDB3 . This antibody is tested and proven to work in the following applications: |
LDB3 cloning plasmid |
CSB-CL012831HU-10ug |
Cusabio |
10ug |
EUR 348 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 852
- Sequence: atgtcttacagtgtgaccctgactgggcccgggccctggggcttccgtctgcaggggggcaaggacttcaacatgcccctcactatctcccggatcacaccaggcagcaaggcagcccagtcccagctcagccagggtgacctcgtggtggccattgacggcgtcaacacagacac
- Show more
|
Description: A cloning plasmid for the LDB3 gene. |
LDB3 Blocking Peptide |
33R-7412 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LDB3 antibody, catalog no. 70R-1141 |
LDB3 Blocking Peptide |
DF12652-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-LDB3 (2C1) |
YF-MA17645 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to LDB3 |
Anti-LDB3 (3C8) |
YF-MA17646 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to LDB3 |
Anti-LDB3 (3C8) |
YF-MA17647 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to LDB3 |
Mouse LDB3 shRNA Plasmid |
20-abx973653 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human LDB3 shRNA Plasmid |
20-abx957636 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LDB3 Recombinant Protein (Human) |
RP017632 |
ABM |
100 ug |
Ask for price |
LDB3 Recombinant Protein (Mouse) |
RP147128 |
ABM |
100 ug |
Ask for price |
LDB3 Recombinant Protein (Mouse) |
RP147131 |
ABM |
100 ug |
Ask for price |
LDB3 Recombinant Protein (Mouse) |
RP147134 |
ABM |
100 ug |
Ask for price |
LDB3 Recombinant Protein (Mouse) |
RP147137 |
ABM |
100 ug |
Ask for price |
LDB3 Recombinant Protein (Mouse) |
RP147140 |
ABM |
100 ug |
Ask for price |
LDB3 Recombinant Protein (Mouse) |
RP147143 |
ABM |
100 ug |
Ask for price |
LDB3 Recombinant Protein (Mouse) |
RP147146 |
ABM |
100 ug |
Ask for price |
Monoclonal LDB3 Antibody (monoclonal) (M06), Clone: 3C8 |
APR17181G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human LDB3 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 3C8. This antibody is applicable in WB and IF, E |
Monoclonal LDB3 Antibody (monoclonal) (M06A), Clone: 3C8 |
APR17182G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human LDB3 (monoclonal) (M06A). The antibodies are raised in Mouse and are from clone 3C8. This antibody is applicable in WB, E |
LIM Domain Binding Protein 3 (LDB3) Antibody |
20-abx113506 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LIM Domain Binding Protein 3 (LDB3) Antibody |
20-abx006969 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
LIM Domain Binding Protein 3 (LDB3) Antibody |
abx029225-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
LIM Domain Binding Protein 3 (LDB3) Antibody |
abx029225-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
LIM Domain Binding Protein 3 (LDB3) Antibody |
20-abx321285 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LIM Domain Binding Protein 3 (LDB3) Antibody |
20-abx322065 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LIM Domain Binding Protein 3 (LDB3) Antibody |
abx234734-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
LIM Domain Binding Protein 3 (LDB3) Antibody |
20-abx225266 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
LDB3 ORF Vector (Human) (pORF) |
ORF005878 |
ABM |
1.0 ug DNA |
EUR 95 |
Ldb3 ORF Vector (Mouse) (pORF) |
ORF049044 |
ABM |
1.0 ug DNA |
EUR 506 |
Ldb3 ORF Vector (Mouse) (pORF) |
ORF049045 |
ABM |
1.0 ug DNA |
EUR 506 |
Ldb3 ORF Vector (Mouse) (pORF) |
ORF049046 |
ABM |
1.0 ug DNA |
EUR 506 |
Ldb3 ORF Vector (Mouse) (pORF) |
ORF049047 |
ABM |
1.0 ug DNA |
EUR 506 |
Ldb3 ORF Vector (Mouse) (pORF) |
ORF049048 |
ABM |
1.0 ug DNA |
EUR 506 |
Ldb3 ORF Vector (Mouse) (pORF) |
ORF049049 |
ABM |
1.0 ug DNA |
EUR 506 |
Ldb3 ORF Vector (Mouse) (pORF) |
ORF049050 |
ABM |
1.0 ug DNA |
EUR 506 |
Ldb3 sgRNA CRISPR Lentivector set (Mouse) |
K4355301 |
ABM |
3 x 1.0 ug |
EUR 339 |
LDB3 sgRNA CRISPR Lentivector set (Human) |
K1204401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ldb3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4355302 |
ABM |
1.0 ug DNA |
EUR 154 |
Ldb3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4355303 |
ABM |
1.0 ug DNA |
EUR 154 |
Ldb3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4355304 |
ABM |
1.0 ug DNA |
EUR 154 |
Human LIM domain-binding protein 3 (LDB3) |
1-CSB-EP012831HU |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 58 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human LIM domain-binding protein 3(LDB3) expressed in E.coli |
LDB3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1204402 |
ABM |
1.0 ug DNA |
EUR 154 |
LDB3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1204403 |
ABM |
1.0 ug DNA |
EUR 154 |
LDB3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1204404 |
ABM |
1.0 ug DNA |
EUR 154 |
LDB3 Protein Vector (Human) (pPB-C-His) |
PV023509 |
ABM |
500 ng |
EUR 329 |
LDB3 Protein Vector (Human) (pPB-N-His) |
PV023510 |
ABM |
500 ng |
EUR 329 |
LDB3 Protein Vector (Human) (pPM-C-HA) |
PV023511 |
ABM |
500 ng |
EUR 329 |
LDB3 Protein Vector (Human) (pPM-C-His) |
PV023512 |
ABM |
500 ng |
EUR 329 |
LDB3 Protein Vector (Mouse) (pPB-C-His) |
PV196174 |
ABM |
500 ng |
EUR 1065 |
LDB3 Protein Vector (Mouse) (pPB-N-His) |
PV196175 |
ABM |
500 ng |
EUR 1065 |
LDB3 Protein Vector (Mouse) (pPM-C-HA) |
PV196176 |
ABM |
500 ng |
EUR 1065 |
LDB3 Protein Vector (Mouse) (pPM-C-His) |
PV196177 |
ABM |
500 ng |
EUR 1065 |
LDB3 Protein Vector (Mouse) (pPB-C-His) |
PV196178 |
ABM |
500 ng |
EUR 603 |
LDB3 Protein Vector (Mouse) (pPB-N-His) |
PV196179 |
ABM |
500 ng |
EUR 603 |
LDB3 Protein Vector (Mouse) (pPM-C-HA) |
PV196180 |
ABM |
500 ng |
EUR 603 |
LDB3 Protein Vector (Mouse) (pPM-C-His) |
PV196181 |
ABM |
500 ng |
EUR 603 |
LDB3 Protein Vector (Mouse) (pPB-C-His) |
PV196182 |
ABM |
500 ng |
EUR 1065 |
LDB3 Protein Vector (Mouse) (pPB-N-His) |
PV196183 |
ABM |
500 ng |
EUR 1065 |
LDB3 Protein Vector (Mouse) (pPM-C-HA) |
PV196184 |
ABM |
500 ng |
EUR 1065 |
LDB3 Protein Vector (Mouse) (pPM-C-His) |
PV196185 |
ABM |
500 ng |
EUR 1065 |
LDB3 Protein Vector (Mouse) (pPB-C-His) |
PV196186 |
ABM |
500 ng |
EUR 603 |
LDB3 Protein Vector (Mouse) (pPB-N-His) |
PV196187 |
ABM |
500 ng |
EUR 603 |
LDB3 Protein Vector (Mouse) (pPM-C-HA) |
PV196188 |
ABM |
500 ng |
EUR 603 |
LDB3 Protein Vector (Mouse) (pPM-C-His) |
PV196189 |
ABM |
500 ng |
EUR 603 |
LDB3 Protein Vector (Mouse) (pPB-C-His) |
PV196190 |
ABM |
500 ng |
EUR 1065 |
LDB3 Protein Vector (Mouse) (pPB-N-His) |
PV196191 |
ABM |
500 ng |
EUR 1065 |
LDB3 Protein Vector (Mouse) (pPM-C-HA) |
PV196192 |
ABM |
500 ng |
EUR 1065 |
LDB3 Protein Vector (Mouse) (pPM-C-His) |
PV196193 |
ABM |
500 ng |
EUR 1065 |
LDB3 Protein Vector (Mouse) (pPB-C-His) |
PV196194 |
ABM |
500 ng |
EUR 603 |
LDB3 Protein Vector (Mouse) (pPB-N-His) |
PV196195 |
ABM |
500 ng |
EUR 603 |
LDB3 Protein Vector (Mouse) (pPM-C-HA) |
PV196196 |
ABM |
500 ng |
EUR 603 |
LDB3 Protein Vector (Mouse) (pPM-C-His) |
PV196197 |
ABM |
500 ng |
EUR 603 |
LDB3 Protein Vector (Mouse) (pPB-C-His) |
PV196198 |
ABM |
500 ng |
EUR 603 |
LDB3 Protein Vector (Mouse) (pPB-N-His) |
PV196199 |
ABM |
500 ng |
EUR 603 |
LDB3 Protein Vector (Mouse) (pPM-C-HA) |
PV196200 |
ABM |
500 ng |
EUR 603 |
LDB3 Protein Vector (Mouse) (pPM-C-His) |
PV196201 |
ABM |
500 ng |
EUR 603 |
Ldb3 3'UTR GFP Stable Cell Line |
TU160972 |
ABM |
1.0 ml |
Ask for price |
LDB3 3'UTR Luciferase Stable Cell Line |
TU012348 |
ABM |
1.0 ml |
EUR 4617 |
Ldb3 3'UTR Luciferase Stable Cell Line |
TU110972 |
ABM |
1.0 ml |
Ask for price |
LDB3 3'UTR GFP Stable Cell Line |
TU062348 |
ABM |
1.0 ml |
EUR 4617 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
LDB3 Rabbit Polyclonal Antibody