CelltaGen
셀타젠 Genetic Genotyping

LDB3 Rabbit Polyclonal Antibody

LDB3 Polyclonal Antibody

ABP59101-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90
  • Applications tips:
Description: A polyclonal antibody for detection of LDB3 from Human, Mouse. This LDB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90

LDB3 Polyclonal Antibody

ABP59101-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90
  • Applications tips:
Description: A polyclonal antibody for detection of LDB3 from Human, Mouse. This LDB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LDB3 protein at amino acid sequence of 41-90

LDB3 Polyclonal Antibody

30932-100ul 100ul
EUR 252

LDB3 Polyclonal Antibody

30932-50ul 50ul
EUR 187

LDB3 Rabbit pAb

A7462-100ul 100 ul
EUR 308

LDB3 Rabbit pAb

A7462-200ul 200 ul
EUR 459

LDB3 Rabbit pAb

A7462-20ul 20 ul
EUR 183

LDB3 Rabbit pAb

A7462-50ul 50 ul
EUR 223

Polyclonal LDB3 Antibody (Center)

APR17180G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LDB3 (Center). This antibody is tested and proven to work in the following applications:

LDB3 Polyclonal Conjugated Antibody

C30932 100ul
EUR 397

LDB3 antibody

70R-18235 50 ul
EUR 435
Description: Rabbit polyclonal LDB3 antibody

LDB3 antibody

70R-1141 100 ug
EUR 377
Description: Rabbit polyclonal LDB3 antibody raised against the N terminal of LDB3

LDB3 Antibody

DF12652 200ul
EUR 304
Description: LDB3 Antibody detects endogenous levels of LDB3.

LDB3 Antibody

1-CSB-PA012831ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LDB3. Recognizes LDB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

LDB3 Antibody

1-CSB-PA012831ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LDB3. Recognizes LDB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LDB3 Antibody

1-CSB-PA012831GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LDB3. Recognizes LDB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal LDB3 Antibody (N-term)

APR17183G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LDB3 (N-term). This antibody is tested and proven to work in the following applications:

anti- LDB3 antibody

FNab04734 100µg
EUR 548.75
  • Immunogen: LIM domain binding 3
  • Uniprot ID: O75112
  • Gene ID: 11155
  • Research Area: Developmental biology
Description: Antibody raised against LDB3

Anti-LDB3 antibody

PAab04734 100 ug
EUR 386

Anti-LDB3 antibody

STJ29598 100 µl
EUR 277
Description: This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains.

Anti-LDB3 antibody

STJ192577 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LDB3

LDB3 siRNA

20-abx922381
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LDB3 siRNA

20-abx922382
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-LDB3

YF-PA17478 50 ul
EUR 363
Description: Mouse polyclonal to LDB3

anti-LDB3

YF-PA27498 50 ug
EUR 363
Description: Mouse polyclonal to LDB3

Polyclonal Goat Anti-ZASP/ CYPHER / LDB3 Antibody

APR16432G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ZASP/ CYPHER / LDB3 . This antibody is tested and proven to work in the following applications:

LDB3 cloning plasmid

CSB-CL012831HU-10ug 10ug
EUR 348
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 852
  • Sequence: atgtcttacagtgtgaccctgactgggcccgggccctggggcttccgtctgcaggggggcaaggacttcaacatgcccctcactatctcccggatcacaccaggcagcaaggcagcccagtcccagctcagccagggtgacctcgtggtggccattgacggcgtcaacacagacac
  • Show more
Description: A cloning plasmid for the LDB3 gene.

LDB3 Blocking Peptide

33R-7412 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LDB3 antibody, catalog no. 70R-1141

LDB3 Blocking Peptide

DF12652-BP 1mg
EUR 195

Anti-LDB3 (2C1)

YF-MA17645 100 ug
EUR 363
Description: Mouse monoclonal to LDB3

Anti-LDB3 (3C8)

YF-MA17646 50 ug
EUR 363
Description: Mouse monoclonal to LDB3

Anti-LDB3 (3C8)

YF-MA17647 200 ul
EUR 363
Description: Mouse monoclonal to LDB3

Anti-ZASP/ CYPHER / LDB3 antibody

STJ70772 100 µg
EUR 359

Mouse LDB3 shRNA Plasmid

20-abx973653
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LDB3 ELISA KIT|Human

EF010647 96 Tests
EUR 689

Human LDB3 shRNA Plasmid

20-abx957636
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LDB3 Recombinant Protein (Human)

RP017632 100 ug Ask for price

LDB3 Recombinant Protein (Mouse)

RP147128 100 ug Ask for price

LDB3 Recombinant Protein (Mouse)

RP147131 100 ug Ask for price

LDB3 Recombinant Protein (Mouse)

RP147134 100 ug Ask for price

LDB3 Recombinant Protein (Mouse)

RP147137 100 ug Ask for price

LDB3 Recombinant Protein (Mouse)

RP147140 100 ug Ask for price

LDB3 Recombinant Protein (Mouse)

RP147143 100 ug Ask for price

LDB3 Recombinant Protein (Mouse)

RP147146 100 ug Ask for price

Monoclonal LDB3 Antibody (monoclonal) (M06), Clone: 3C8

APR17181G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human LDB3 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 3C8. This antibody is applicable in WB and IF, E

Monoclonal LDB3 Antibody (monoclonal) (M06A), Clone: 3C8

APR17182G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human LDB3 (monoclonal) (M06A). The antibodies are raised in Mouse and are from clone 3C8. This antibody is applicable in WB, E

LIM Domain Binding Protein 3 (LDB3) Antibody

20-abx113506
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

LIM Domain Binding Protein 3 (LDB3) Antibody

20-abx006969
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

LIM Domain Binding Protein 3 (LDB3) Antibody

abx029225-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

LIM Domain Binding Protein 3 (LDB3) Antibody

abx029225-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

LIM Domain Binding Protein 3 (LDB3) Antibody

20-abx321285
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

LIM Domain Binding Protein 3 (LDB3) Antibody

20-abx322065
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

LIM Domain Binding Protein 3 (LDB3) Antibody

abx234734-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

LIM Domain Binding Protein 3 (LDB3) Antibody

20-abx225266
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

LDB3 ORF Vector (Human) (pORF)

ORF005878 1.0 ug DNA
EUR 95

Ldb3 ORF Vector (Mouse) (pORF)

ORF049044 1.0 ug DNA
EUR 506

Ldb3 ORF Vector (Mouse) (pORF)

ORF049045 1.0 ug DNA
EUR 506

Ldb3 ORF Vector (Mouse) (pORF)

ORF049046 1.0 ug DNA
EUR 506

Ldb3 ORF Vector (Mouse) (pORF)

ORF049047 1.0 ug DNA
EUR 506

Ldb3 ORF Vector (Mouse) (pORF)

ORF049048 1.0 ug DNA
EUR 506

Ldb3 ORF Vector (Mouse) (pORF)

ORF049049 1.0 ug DNA
EUR 506

Ldb3 ORF Vector (Mouse) (pORF)

ORF049050 1.0 ug DNA
EUR 506

Ldb3 sgRNA CRISPR Lentivector set (Mouse)

K4355301 3 x 1.0 ug
EUR 339

LDB3 sgRNA CRISPR Lentivector set (Human)

K1204401 3 x 1.0 ug
EUR 339

Ldb3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4355302 1.0 ug DNA
EUR 154

Ldb3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4355303 1.0 ug DNA
EUR 154

Ldb3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4355304 1.0 ug DNA
EUR 154

Human LIM domain-binding protein 3 (LDB3)

1-CSB-EP012831HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 58 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human LIM domain-binding protein 3(LDB3) expressed in E.coli

LDB3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1204402 1.0 ug DNA
EUR 154

LDB3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1204403 1.0 ug DNA
EUR 154

LDB3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1204404 1.0 ug DNA
EUR 154

LDB3 Protein Vector (Human) (pPB-C-His)

PV023509 500 ng
EUR 329

LDB3 Protein Vector (Human) (pPB-N-His)

PV023510 500 ng
EUR 329

LDB3 Protein Vector (Human) (pPM-C-HA)

PV023511 500 ng
EUR 329

LDB3 Protein Vector (Human) (pPM-C-His)

PV023512 500 ng
EUR 329

LDB3 Protein Vector (Mouse) (pPB-C-His)

PV196174 500 ng
EUR 1065

LDB3 Protein Vector (Mouse) (pPB-N-His)

PV196175 500 ng
EUR 1065

LDB3 Protein Vector (Mouse) (pPM-C-HA)

PV196176 500 ng
EUR 1065

LDB3 Protein Vector (Mouse) (pPM-C-His)

PV196177 500 ng
EUR 1065

LDB3 Protein Vector (Mouse) (pPB-C-His)

PV196178 500 ng
EUR 603

LDB3 Protein Vector (Mouse) (pPB-N-His)

PV196179 500 ng
EUR 603

LDB3 Protein Vector (Mouse) (pPM-C-HA)

PV196180 500 ng
EUR 603

LDB3 Protein Vector (Mouse) (pPM-C-His)

PV196181 500 ng
EUR 603

LDB3 Protein Vector (Mouse) (pPB-C-His)

PV196182 500 ng
EUR 1065

LDB3 Protein Vector (Mouse) (pPB-N-His)

PV196183 500 ng
EUR 1065

LDB3 Protein Vector (Mouse) (pPM-C-HA)

PV196184 500 ng
EUR 1065

LDB3 Protein Vector (Mouse) (pPM-C-His)

PV196185 500 ng
EUR 1065

LDB3 Protein Vector (Mouse) (pPB-C-His)

PV196186 500 ng
EUR 603

LDB3 Protein Vector (Mouse) (pPB-N-His)

PV196187 500 ng
EUR 603

LDB3 Protein Vector (Mouse) (pPM-C-HA)

PV196188 500 ng
EUR 603

LDB3 Protein Vector (Mouse) (pPM-C-His)

PV196189 500 ng
EUR 603

LDB3 Protein Vector (Mouse) (pPB-C-His)

PV196190 500 ng
EUR 1065

LDB3 Protein Vector (Mouse) (pPB-N-His)

PV196191 500 ng
EUR 1065

LDB3 Protein Vector (Mouse) (pPM-C-HA)

PV196192 500 ng
EUR 1065

LDB3 Protein Vector (Mouse) (pPM-C-His)

PV196193 500 ng
EUR 1065

LDB3 Protein Vector (Mouse) (pPB-C-His)

PV196194 500 ng
EUR 603

LDB3 Protein Vector (Mouse) (pPB-N-His)

PV196195 500 ng
EUR 603

LDB3 Protein Vector (Mouse) (pPM-C-HA)

PV196196 500 ng
EUR 603

LDB3 Protein Vector (Mouse) (pPM-C-His)

PV196197 500 ng
EUR 603

LDB3 Protein Vector (Mouse) (pPB-C-His)

PV196198 500 ng
EUR 603

LDB3 Protein Vector (Mouse) (pPB-N-His)

PV196199 500 ng
EUR 603

LDB3 Protein Vector (Mouse) (pPM-C-HA)

PV196200 500 ng
EUR 603

LDB3 Protein Vector (Mouse) (pPM-C-His)

PV196201 500 ng
EUR 603

Ldb3 3'UTR GFP Stable Cell Line

TU160972 1.0 ml Ask for price

LDB3 3'UTR Luciferase Stable Cell Line

TU012348 1.0 ml
EUR 4617

Ldb3 3'UTR Luciferase Stable Cell Line

TU110972 1.0 ml Ask for price

LDB3 3'UTR GFP Stable Cell Line

TU062348 1.0 ml
EUR 4617

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

LDB3 Rabbit Polyclonal Antibody