LECT1 Rabbit Polyclonal Antibody
LECT1 Polyclonal Antibody |
ABP59108-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LECT1 protein at amino acid sequence of 150-230
- Applications tips:
|
Description: A polyclonal antibody for detection of LECT1 from Human, Mouse, Rat. This LECT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LECT1 protein at amino acid sequence of 150-230 |
LECT1 Polyclonal Antibody |
A59610 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
LECT1 Rabbit pAb |
A6644-100ul |
Abclonal |
100 ul |
EUR 308 |
LECT1 Rabbit pAb |
A6644-200ul |
Abclonal |
200 ul |
EUR 459 |
LECT1 Rabbit pAb |
A6644-20ul |
Abclonal |
20 ul |
EUR 183 |
LECT1 Rabbit pAb |
A6644-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit |
DLR-LECT1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit |
DLR-LECT1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit |
DLR-LECT1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) in samples from serum, plasma or other biological fluids. |
Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit |
DLR-LECT1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) in samples from serum, plasma or other biological fluids. |
Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit |
RD-LECT1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit |
RD-LECT1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit |
RD-LECT1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit |
RD-LECT1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit |
RDR-LECT1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit |
RDR-LECT1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit |
RDR-LECT1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit |
RDR-LECT1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
LECT1 antibody |
70R-6248 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal LECT1 antibody raised against the N terminal of LECT1 |
LECT1 antibody |
39067-100ul |
SAB |
100ul |
EUR 252 |
LECT1 Antibody |
1-CSB-PA012854LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LECT1. Recognizes LECT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
LECT1 Polyclonal Antibody, Biotin Conjugated |
A59611 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
LECT1 Polyclonal Antibody, FITC Conjugated |
A59612 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
LECT1 Polyclonal Antibody, HRP Conjugated |
A59613 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
LECT1 Conjugated Antibody |
C39067 |
SAB |
100ul |
EUR 397 |
Anti-LECT1 antibody |
STJ28727 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a glycosylated transmembrane protein that is cleaved to form a mature, secreted protein. The N-terminus of the precursor protein shares characteristics with other surfactant proteins and is sometimes called chondrosurfactant protein although no biological activity has yet been defined for it. The C-terminus of the precursor protein contains a 25 kDa mature protein called leukocyte cell-derived chemotaxin-1 or chondromodulin-1. The mature protein promotes chondrocyte growth and inhibits angiogenesis. This gene is expressed in the avascular zone of prehypertrophic cartilage and its expression decreases during chondrocyte hypertrophy and vascular invasion. The mature protein likely plays a role in endochondral bone development by permitting cartilaginous anlagen to be vascularized and replaced by bone. It may be involved also in the broad control of tissue vascularization during development. Alternative splicing results in multiple transcript variants encoding different isoforms. |
Anti-LECT1 antibody |
STJ192522 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to LECT1 |
LECT1 siRNA |
20-abx902950 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LECT1 siRNA |
20-abx922409 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LECT1 siRNA |
20-abx922410 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-LECT1 |
YF-PA17401 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to LECT1 |
anti-LECT1 |
YF-PA17402 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to LECT1 |
anti-LECT1 |
YF-PA17403 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to LECT1 |
anti-LECT1 |
YF-PA27495 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to LECT1 |
LECT1 Antibody, HRP conjugated |
1-CSB-PA012854LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LECT1. Recognizes LECT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
LECT1 Antibody, FITC conjugated |
1-CSB-PA012854LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LECT1. Recognizes LECT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
LECT1 Antibody, Biotin conjugated |
1-CSB-PA012854LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LECT1. Recognizes LECT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
LECT1 cloning plasmid |
CSB-CL012854HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1002
- Sequence: atgacagagaactccgacaaagttcccattgccctggtgggacctgatgacgtggaattctgcagccccccggcgtacgctacgctgacggtgaagccctccagccccgcgcggctgctcaaggtgggagccgtggtcctcatttcgggagctgtgctgctgctctttggggcca
- Show more
|
Description: A cloning plasmid for the LECT1 gene. |
LECT1 Blocking Peptide |
33R-1259 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LONP2 antibody, catalog no. 70R-10129 |
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse) |
4-PAC563Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LECT1 (Lys134~Val334)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) |
Rat LECT1 shRNA Plasmid |
20-abx986590 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human LECT1 shRNA Plasmid |
20-abx957559 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LECT1 protein (His tag) |
80R-3656 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified recombinant LECT1 protein (His tag) |
LECT1 protein (His tag) |
80R-3669 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Purified recombinant LECT1 protein (His tag) |
Mouse LECT1 shRNA Plasmid |
20-abx971301 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LECT1 Recombinant Protein (Human) |
RP017662 |
ABM |
100 ug |
Ask for price |
LECT1 Recombinant Protein (Rat) |
RP207971 |
ABM |
100 ug |
Ask for price |
LECT1 Recombinant Protein (Mouse) |
RP147197 |
ABM |
100 ug |
Ask for price |
Rabbit Leukocyte cell- derived chemotaxin 1, LECT1 ELISA KIT |
ELI-14444Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), APC |
4-PAC563Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LECT1 (Lys134~Val334)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with APC. |
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAC563Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LECT1 (Lys134~Val334)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with Biotin. |
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAC563Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LECT1 (Lys134~Val334)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with Cy3. |
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), FITC |
4-PAC563Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LECT1 (Lys134~Val334)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with FITC. |
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), HRP |
4-PAC563Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LECT1 (Lys134~Val334)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with HRP. |
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), PE |
4-PAC563Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LECT1 (Lys134~Val334)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with PE. |
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody |
20-abx128612 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody |
20-abx005093 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody |
20-abx173346 |
Abbexa |
|
|
|
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody |
20-abx177346 |
Abbexa |
|
|
|
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody |
20-abx177347 |
Abbexa |
|
|
|
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody |
20-abx320741 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody |
20-abx304341 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
LECT1 ORF Vector (Human) (pORF) |
ORF005888 |
ABM |
1.0 ug DNA |
EUR 95 |
Lect1 ORF Vector (Rat) (pORF) |
ORF069325 |
ABM |
1.0 ug DNA |
EUR 506 |
Lect1 ORF Vector (Mouse) (pORF) |
ORF049067 |
ABM |
1.0 ug DNA |
EUR 506 |
LECT1 ELISA Kit (Human) (OKCD00761) |
OKCD00761 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Bifunctional growth regulator that stimulates the growth of cultured chondrocytes in the presence of basic fibroblast growth factor (FGF) but inhibits the growth of cultured vascular endothelial cells. May contribute to the rapid growth of cartilage and vascular invasion prior to the replacement of cartilage by bone during endochondral bone development. Inhibits in vitro tube formation and mobilization of endothelial cells. Plays a role as antiangiogenic factor in cardiac valves to suppress neovascularization.1 Publication
<p>Manually curated information for which there is published experimental evidence.</p>
<p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.9"Chondromodulin-I maintains cardiac valvular function by preventing angiogenesis."_x005F_x005F_x000D_Yoshioka M., Yuasa S., Matsumura K., Kimura K., Shiomi T., Kimura N., Shukunami C., Okada Y., Mukai M., Shin H., Yozu R., Sata M., Ogawa S., Hiraki Y., Fukuda K._x005F_x005F_x000D_Nat. Med. 12:1151-1159(2006) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, TISSUE SPECIFICITY. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.8 pg/mL |
Lect1 ELISA Kit (Mouse) (OKCD01683) |
OKCD01683 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Bifunctional growth regulator that stimulates the growth of cultured chondrocytes in the presence of basic fibroblast growth factor (FGF) but inhibits the growth of cultured vascular endothelial cells. May contribute to the rapid growth of cartilage and vascular invasion prior to the replacement of cartilage by bone during endochondral bone development. Inhibits in vitro tube formation and mobilization of endothelial cells. Plays a role as antiangiogenic factor in cardiac valves to suppress neovascularization.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 11.3 pg/mL |
LECT1 ELISA Kit (Human) (OKDD00374) |
OKDD00374 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes a glycosylated transmembrane protein that is cleaved to form a mature, secreted protein. The N-terminus of the precursor protein shares characteristics with other surfactant proteins and is sometimes called chondrosurfactant protein although no biological activity has yet been defined for it. The C-terminus of the precursor protein contains a 25 kDa mature protein called leukocyte cell-derived chemotaxin-1 or chondromodulin-1. The mature protein promotes chondrocyte growth and inhibits angiogenesis. This gene is expressed in the avascular zone of prehypertrophic cartilage and its expression decreases during chondrocyte hypertrophy and vascular invasion. The mature protein likely plays a role in endochondral bone development by permitting cartilaginous anlagen to be vascularized and replaced by bone. It may be involved also in the broad control of tissue vascularization during development. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.051 ng/mL |
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAC563Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LECT1 (Lys134~Val334)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with APC-Cy7. |
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody (HRP) |
20-abx304342 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody (FITC) |
20-abx304343 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody (Biotin) |
20-abx304344 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
LECT1 sgRNA CRISPR Lentivector set (Human) |
K1206701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lect1 sgRNA CRISPR Lentivector set (Mouse) |
K3812201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lect1 sgRNA CRISPR Lentivector set (Rat) |
K7031101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Leukocyte cell-derived chemotaxin 1 (LECT1) |
1-CSB-EP012854HU1 |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 29.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Leukocyte cell-derived chemotaxin 1(LECT1),partial expressed in E.coli |
LECT1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1206702 |
ABM |
1.0 ug DNA |
EUR 154 |
LECT1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1206703 |
ABM |
1.0 ug DNA |
EUR 154 |
LECT1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1206704 |
ABM |
1.0 ug DNA |
EUR 154 |
Lect1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3812202 |
ABM |
1.0 ug DNA |
EUR 154 |
Lect1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3812203 |
ABM |
1.0 ug DNA |
EUR 154 |
Lect1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3812204 |
ABM |
1.0 ug DNA |
EUR 154 |
Lect1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7031102 |
ABM |
1.0 ug DNA |
EUR 154 |
Lect1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7031103 |
ABM |
1.0 ug DNA |
EUR 154 |
Lect1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7031104 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Leukocyte Cell Derived Chemotaxin 1 (LECT1) |
4-RPC563Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O75829
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 26.8kDa
- Isoelectric Point: 9
|
Description: Recombinant Human Leukocyte Cell Derived Chemotaxin 1 expressed in: E.coli |
LECT1 Protein Vector (Human) (pPB-C-His) |
PV023549 |
ABM |
500 ng |
EUR 329 |
LECT1 Protein Vector (Human) (pPB-N-His) |
PV023550 |
ABM |
500 ng |
EUR 329 |
LECT1 Protein Vector (Human) (pPM-C-HA) |
PV023551 |
ABM |
500 ng |
EUR 329 |
LECT1 Protein Vector (Human) (pPM-C-His) |
PV023552 |
ABM |
500 ng |
EUR 329 |
LECT1 Protein Vector (Rat) (pPB-C-His) |
PV277298 |
ABM |
500 ng |
EUR 603 |
LECT1 Protein Vector (Rat) (pPB-N-His) |
PV277299 |
ABM |
500 ng |
EUR 603 |
LECT1 Protein Vector (Rat) (pPM-C-HA) |
PV277300 |
ABM |
500 ng |
EUR 603 |
LECT1 Protein Vector (Rat) (pPM-C-His) |
PV277301 |
ABM |
500 ng |
EUR 603 |
LECT1 Protein Vector (Mouse) (pPB-C-His) |
PV196266 |
ABM |
500 ng |
EUR 603 |
LECT1 Protein Vector (Mouse) (pPB-N-His) |
PV196267 |
ABM |
500 ng |
EUR 603 |
LECT1 Protein Vector (Mouse) (pPM-C-HA) |
PV196268 |
ABM |
500 ng |
EUR 603 |
LECT1 Protein Vector (Mouse) (pPM-C-His) |
PV196269 |
ABM |
500 ng |
EUR 603 |
LECT1 Rabbit Polyclonal Antibody