LECT1 Rabbit Polyclonal Antibody

LECT1 Polyclonal Antibody
ABP59108-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human LECT1 protein at amino acid sequence of 150-230 Applications tips:
Description: A polyclonal antibody for detection of LECT1 from Human, Mouse, Rat. This LECT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LECT1 protein at amino acid sequence of 150-230

LECT1 Polyclonal Antibody
A59610	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

LECT1 Rabbit pAb
A6644-100ul	Abclonal	100 ul	EUR 308

LECT1 Rabbit pAb
A6644-200ul	Abclonal	200 ul	EUR 459

LECT1 Rabbit pAb
A6644-20ul	Abclonal	20 ul	EUR 183

LECT1 Rabbit pAb
A6644-50ul	Abclonal	50 ul	EUR 223

Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit
DLR-LECT1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit
DLR-LECT1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit
DLR-LECT1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) in samples from serum, plasma or other biological fluids.

Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit
DLR-LECT1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) in samples from serum, plasma or other biological fluids.

Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit
RD-LECT1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit
RD-LECT1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit
RD-LECT1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit
RD-LECT1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit
RDR-LECT1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit
RDR-LECT1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit
RDR-LECT1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit
RDR-LECT1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

LECT1 antibody
70R-6248	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal LECT1 antibody raised against the N terminal of LECT1

LECT1 antibody
39067-100ul	SAB	100ul	EUR 252

LECT1 Antibody
1-CSB-PA012854LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LECT1. Recognizes LECT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

LECT1 Polyclonal Antibody, Biotin Conjugated
A59611	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

LECT1 Polyclonal Antibody, FITC Conjugated
A59612	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

LECT1 Polyclonal Antibody, HRP Conjugated
A59613	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

LECT1 Conjugated Antibody
C39067	SAB	100ul	EUR 397

Anti-LECT1 antibody
STJ28727	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a glycosylated transmembrane protein that is cleaved to form a mature, secreted protein. The N-terminus of the precursor protein shares characteristics with other surfactant proteins and is sometimes called chondrosurfactant protein although no biological activity has yet been defined for it. The C-terminus of the precursor protein contains a 25 kDa mature protein called leukocyte cell-derived chemotaxin-1 or chondromodulin-1. The mature protein promotes chondrocyte growth and inhibits angiogenesis. This gene is expressed in the avascular zone of prehypertrophic cartilage and its expression decreases during chondrocyte hypertrophy and vascular invasion. The mature protein likely plays a role in endochondral bone development by permitting cartilaginous anlagen to be vascularized and replaced by bone. It may be involved also in the broad control of tissue vascularization during development. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-LECT1 antibody
STJ192522	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to LECT1

Lect1/ Rat Lect1 ELISA Kit
ELI-31649r	Lifescience Market	96 Tests	EUR 886

LECT1 siRNA
20-abx902950	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LECT1 siRNA
20-abx922409	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LECT1 siRNA
20-abx922410	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-LECT1
YF-PA17401	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to LECT1

anti-LECT1
YF-PA17402	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to LECT1

anti-LECT1
YF-PA17403	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to LECT1

anti-LECT1
YF-PA27495	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to LECT1

LECT1 Antibody, HRP conjugated
1-CSB-PA012854LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LECT1. Recognizes LECT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LECT1 Antibody, FITC conjugated
1-CSB-PA012854LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LECT1. Recognizes LECT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LECT1 Antibody, Biotin conjugated
1-CSB-PA012854LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LECT1. Recognizes LECT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LECT1 cloning plasmid
CSB-CL012854HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1002 Sequence: atgacagagaactccgacaaagttcccattgccctggtgggacctgatgacgtggaattctgcagccccccggcgtacgctacgctgacggtgaagccctccagccccgcgcggctgctcaaggtgggagccgtggtcctcatttcgggagctgtgctgctgctctttggggcca Show more
Description: A cloning plasmid for the LECT1 gene.

LECT1 Blocking Peptide
33R-1259	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LONP2 antibody, catalog no. 70R-10129

Rat LECT1 shRNA Plasmid
20-abx986590	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LECT1 ELISA KIT|Human
EF005201	Lifescience Market	96 Tests	EUR 689

Human LECT1 shRNA Plasmid
20-abx957559	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LECT1 protein (His tag)
80R-3656	Fitzgerald	100 ug	EUR 327
Description: Purified recombinant LECT1 protein (His tag)

LECT1 protein (His tag)
80R-3669	Fitzgerald	100 ug	EUR 435
Description: Purified recombinant LECT1 protein (His tag)

Mouse LECT1 shRNA Plasmid
20-abx971301	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LECT1 Recombinant Protein (Human)
RP017662	ABM	100 ug	Ask for price

LECT1 Recombinant Protein (Rat)
RP207971	ABM	100 ug	Ask for price

LECT1 Recombinant Protein (Mouse)
RP147197	ABM	100 ug	Ask for price

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse)
4-PAC563Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LECT1 (Lys134~Val334) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1)

Rabbit Leukocyte cell- derived chemotaxin 1, LECT1 ELISA KIT
ELI-14444Ra	Lifescience Market	96 Tests	EUR 928

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), APC
4-PAC563Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LECT1 (Lys134~Val334) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with APC.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAC563Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LECT1 (Lys134~Val334) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with Biotin.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), Cy3
4-PAC563Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LECT1 (Lys134~Val334) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with Cy3.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), FITC
4-PAC563Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LECT1 (Lys134~Val334) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with FITC.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), HRP
4-PAC563Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LECT1 (Lys134~Val334) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with HRP.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), PE
4-PAC563Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LECT1 (Lys134~Val334) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with PE.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody
20-abx128612	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody
20-abx005093	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody
20-abx173346	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody
20-abx177346	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody
20-abx177347	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody
20-abx320741	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody
20-abx304341	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

LECT1 ORF Vector (Human) (pORF)
ORF005888	ABM	1.0 ug DNA	EUR 95

Lect1 ORF Vector (Rat) (pORF)
ORF069325	ABM	1.0 ug DNA	EUR 506

Lect1 ORF Vector (Mouse) (pORF)
ORF049067	ABM	1.0 ug DNA	EUR 506

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAC563Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LECT1 (Lys134~Val334) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with APC-Cy7.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody (HRP)
20-abx304342	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody (FITC)
20-abx304343	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody (Biotin)
20-abx304344	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

LECT1 sgRNA CRISPR Lentivector set (Human)
K1206701	ABM	3 x 1.0 ug	EUR 339

Lect1 sgRNA CRISPR Lentivector set (Mouse)
K3812201	ABM	3 x 1.0 ug	EUR 339

Lect1 sgRNA CRISPR Lentivector set (Rat)
K7031101	ABM	3 x 1.0 ug	EUR 339

Human Leukocyte cell-derived chemotaxin 1 (LECT1)
1-CSB-EP012854HU1	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 29.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Leukocyte cell-derived chemotaxin 1(LECT1),partial expressed in E.coli

LECT1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1206702	ABM	1.0 ug DNA	EUR 154

LECT1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1206703	ABM	1.0 ug DNA	EUR 154

LECT1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1206704	ABM	1.0 ug DNA	EUR 154

Lect1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3812202	ABM	1.0 ug DNA	EUR 154

Lect1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3812203	ABM	1.0 ug DNA	EUR 154

Lect1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3812204	ABM	1.0 ug DNA	EUR 154

Lect1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7031102	ABM	1.0 ug DNA	EUR 154

Lect1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7031103	ABM	1.0 ug DNA	EUR 154

Lect1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7031104	ABM	1.0 ug DNA	EUR 154

Recombinant Leukocyte Cell Derived Chemotaxin 1 (LECT1)
4-RPC563Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O75829 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.8kDa Isoelectric Point: 9
Description: Recombinant Human Leukocyte Cell Derived Chemotaxin 1 expressed in: E.coli

LECT1 Protein Vector (Human) (pPB-C-His)
PV023549	ABM	500 ng	EUR 329

LECT1 Protein Vector (Human) (pPB-N-His)
PV023550	ABM	500 ng	EUR 329

LECT1 Protein Vector (Human) (pPM-C-HA)
PV023551	ABM	500 ng	EUR 329

LECT1 Protein Vector (Human) (pPM-C-His)
PV023552	ABM	500 ng	EUR 329

LECT1 Protein Vector (Rat) (pPB-C-His)
PV277298	ABM	500 ng	EUR 603

LECT1 Protein Vector (Rat) (pPB-N-His)
PV277299	ABM	500 ng	EUR 603

LECT1 Protein Vector (Rat) (pPM-C-HA)
PV277300	ABM	500 ng	EUR 603

LECT1 Protein Vector (Rat) (pPM-C-His)
PV277301	ABM	500 ng	EUR 603

LECT1 Protein Vector (Mouse) (pPB-C-His)
PV196266	ABM	500 ng	EUR 603

LECT1 Protein Vector (Mouse) (pPB-N-His)
PV196267	ABM	500 ng	EUR 603

LECT1 Protein Vector (Mouse) (pPM-C-HA)
PV196268	ABM	500 ng	EUR 603

LECT1 Protein Vector (Mouse) (pPM-C-His)
PV196269	ABM	500 ng	EUR 603

Lect1 3'UTR Luciferase Stable Cell Line
TU207006	ABM	1.0 ml	Ask for price

Lect1 3'UTR GFP Stable Cell Line
TU160986	ABM	1.0 ml	Ask for price

LECT1 3'UTR Luciferase Stable Cell Line
TU012371	ABM	1.0 ml	EUR 1394

LECT1 Rabbit Polyclonal Antibody