
셀타젠 Genetic Genotyping

LECT1 Rabbit Polyclonal Antibody

LECT1 Rabbit Polyclonal Antibody

LECT1 Polyclonal Antibody

ES11364-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LECT1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LECT1 Polyclonal Antibody

ES11364-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LECT1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LECT1 Rabbit pAb

A6644-100ul 100 ul
EUR 308

LECT1 Rabbit pAb

A6644-200ul 200 ul
EUR 459

LECT1 Rabbit pAb

A6644-20ul 20 ul
EUR 183

LECT1 Rabbit pAb

A6644-50ul 50 ul
EUR 223

Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit

DLR-LECT1-Hu-48T 48T
EUR 517
  • Should the Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit

DLR-LECT1-Hu-96T 96T
EUR 673
  • Should the Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit

DLR-LECT1-Mu-48T 48T
EUR 527
  • Should the Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) in samples from serum, plasma or other biological fluids.

Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit

DLR-LECT1-Mu-96T 96T
EUR 688
  • Should the Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) in samples from serum, plasma or other biological fluids.

Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit

RDR-LECT1-Hu-48Tests 48 Tests
EUR 544

Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit

RDR-LECT1-Hu-96Tests 96 Tests
EUR 756

Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit

RDR-LECT1-Mu-48Tests 48 Tests
EUR 557

Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit

RDR-LECT1-Mu-96Tests 96 Tests
EUR 774

Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit

RD-LECT1-Hu-48Tests 48 Tests
EUR 521

Human Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit

RD-LECT1-Hu-96Tests 96 Tests
EUR 723

Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit

RD-LECT1-Mu-48Tests 48 Tests
EUR 533

Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1) ELISA Kit

RD-LECT1-Mu-96Tests 96 Tests
EUR 740

LECT1 antibody

39067-100ul 100ul
EUR 252

LECT1 antibody

70R-6248 50 ug
EUR 467
Description: Rabbit polyclonal LECT1 antibody raised against the N terminal of LECT1

LECT1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LECT1. Recognizes LECT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

LECT1 Polyclonal Antibody, Biotin Conjugated

A59611 100 µg
EUR 570.55
Description: kits suitable for this type of research

LECT1 Polyclonal Antibody, FITC Conjugated

A59612 100 µg
EUR 570.55
Description: fast delivery possible

LECT1 Polyclonal Antibody, HRP Conjugated

A59613 100 µg
EUR 570.55
Description: reagents widely cited

LECT1 Conjugated Antibody

C39067 100ul
EUR 397

Anti-LECT1 antibody

STJ28727 100 µl
EUR 277
Description: This gene encodes a glycosylated transmembrane protein that is cleaved to form a mature, secreted protein. The N-terminus of the precursor protein shares characteristics with other surfactant proteins and is sometimes called chondrosurfactant protein although no biological activity has yet been defined for it. The C-terminus of the precursor protein contains a 25 kDa mature protein called leukocyte cell-derived chemotaxin-1 or chondromodulin-1. The mature protein promotes chondrocyte growth and inhibits angiogenesis. This gene is expressed in the avascular zone of prehypertrophic cartilage and its expression decreases during chondrocyte hypertrophy and vascular invasion. The mature protein likely plays a role in endochondral bone development by permitting cartilaginous anlagen to be vascularized and replaced by bone. It may be involved also in the broad control of tissue vascularization during development. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-LECT1 antibody

STJ192522 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LECT1

Lect1/ Rat Lect1 ELISA Kit

ELI-31649r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA17401 50 ul
EUR 363
Description: Mouse polyclonal to LECT1


YF-PA17402 100 ul
EUR 403
Description: Rabbit polyclonal to LECT1


YF-PA17403 100 ug
EUR 403
Description: Rabbit polyclonal to LECT1


YF-PA27495 50 ug
EUR 363
Description: Mouse polyclonal to LECT1

LECT1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LECT1. Recognizes LECT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LECT1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LECT1. Recognizes LECT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LECT1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LECT1. Recognizes LECT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LECT1 Blocking Peptide

33R-1259 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LONP2 antibody, catalog no. 70R-10129

LECT1 cloning plasmid

CSB-CL012854HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1002
  • Sequence: atgacagagaactccgacaaagttcccattgccctggtgggacctgatgacgtggaattctgcagccccccggcgtacgctacgctgacggtgaagccctccagccccgcgcggctgctcaaggtgggagccgtggtcctcatttcgggagctgtgctgctgctctttggggcca
  • Show more
Description: A cloning plasmid for the LECT1 gene.

LECT1 protein (His tag)

80R-3656 100 ug
EUR 327
Description: Purified recombinant LECT1 protein (His tag)

LECT1 protein (His tag)

80R-3669 100 ug
EUR 435
Description: Purified recombinant LECT1 protein (His tag)


EF005201 96 Tests
EUR 689

Rat LECT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LECT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LECT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LECT1 Recombinant Protein (Human)

RP017662 100 ug Ask for price

LECT1 Recombinant Protein (Rat)

RP207971 100 ug Ask for price

LECT1 Recombinant Protein (Mouse)

RP147197 100 ug Ask for price

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LECT1 (Lys134~Val334)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1)

Rabbit Leukocyte cell- derived chemotaxin 1, LECT1 ELISA KIT

ELI-14444Ra 96 Tests
EUR 928

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LECT1 (Lys134~Val334)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with APC.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LECT1 (Lys134~Val334)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with Biotin.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LECT1 (Lys134~Val334)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with Cy3.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LECT1 (Lys134~Val334)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with FITC.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LECT1 (Lys134~Val334)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with HRP.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LECT1 (Lys134~Val334)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with PE.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lect1 ORF Vector (Rat) (pORF)

ORF069325 1.0 ug DNA
EUR 506

LECT1 ORF Vector (Human) (pORF)

ORF005888 1.0 ug DNA
EUR 95

Lect1 ORF Vector (Mouse) (pORF)

ORF049067 1.0 ug DNA
EUR 506

LECT1 ELISA Kit (Human) (OKCD00761)

OKCD00761 96 Wells
EUR 831
Description: Description of target: Bifunctional growth regulator that stimulates the growth of cultured chondrocytes in the presence of basic fibroblast growth factor (FGF) but inhibits the growth of cultured vascular endothelial cells. May contribute to the rapid growth of cartilage and vascular invasion prior to the replacement of cartilage by bone during endochondral bone development. Inhibits in vitro tube formation and mobilization of endothelial cells. Plays a role as antiangiogenic factor in cardiac valves to suppress neovascularization.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.9"Chondromodulin-I maintains cardiac valvular function by preventing angiogenesis."_x005F_x005F_x000D_Yoshioka M., Yuasa S., Matsumura K., Kimura K., Shiomi T., Kimura N., Shukunami C., Okada Y., Mukai M., Shin H., Yozu R., Sata M., Ogawa S., Hiraki Y., Fukuda K._x005F_x005F_x000D_Nat. Med. 12:1151-1159(2006) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, TISSUE SPECIFICITY. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.8 pg/mL

Lect1 ELISA Kit (Mouse) (OKCD01683)

OKCD01683 96 Wells
EUR 857
Description: Description of target: Bifunctional growth regulator that stimulates the growth of cultured chondrocytes in the presence of basic fibroblast growth factor (FGF) but inhibits the growth of cultured vascular endothelial cells. May contribute to the rapid growth of cartilage and vascular invasion prior to the replacement of cartilage by bone during endochondral bone development. Inhibits in vitro tube formation and mobilization of endothelial cells. Plays a role as antiangiogenic factor in cardiac valves to suppress neovascularization.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 11.3 pg/mL

LECT1 ELISA Kit (Human) (OKDD00374)

OKDD00374 96 Wells
EUR 975
Description: Description of target: This gene encodes a glycosylated transmembrane protein that is cleaved to form a mature, secreted protein. The N-terminus of the precursor protein shares characteristics with other surfactant proteins and is sometimes called chondrosurfactant protein although no biological activity has yet been defined for it. The C-terminus of the precursor protein contains a 25 kDa mature protein called leukocyte cell-derived chemotaxin-1 or chondromodulin-1. The mature protein promotes chondrocyte growth and inhibits angiogenesis. This gene is expressed in the avascular zone of prehypertrophic cartilage and its expression decreases during chondrocyte hypertrophy and vascular invasion. The mature protein likely plays a role in endochondral bone development by permitting cartilaginous anlagen to be vascularized and replaced by bone. It may be involved also in the broad control of tissue vascularization during development. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.051 ng/mL

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LECT1 (Lys134~Val334)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Cell Derived Chemotaxin 1 (LECT1). This antibody is labeled with APC-Cy7.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leukocyte Cell Derived Chemotaxin 1 (LECT1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lect1 sgRNA CRISPR Lentivector set (Rat)

K7031101 3 x 1.0 ug
EUR 339

Lect1 sgRNA CRISPR Lentivector set (Mouse)

K3812201 3 x 1.0 ug
EUR 339

LECT1 sgRNA CRISPR Lentivector set (Human)

K1206701 3 x 1.0 ug
EUR 339

Human Leukocyte cell-derived chemotaxin 1 (LECT1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 29.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Leukocyte cell-derived chemotaxin 1(LECT1),partial expressed in E.coli

Lect1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7031102 1.0 ug DNA
EUR 154

Lect1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7031103 1.0 ug DNA
EUR 154

Lect1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7031104 1.0 ug DNA
EUR 154

Lect1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3812202 1.0 ug DNA
EUR 154

Lect1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3812203 1.0 ug DNA
EUR 154

Lect1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3812204 1.0 ug DNA
EUR 154

LECT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1206702 1.0 ug DNA
EUR 154

LECT1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1206703 1.0 ug DNA
EUR 154

LECT1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1206704 1.0 ug DNA
EUR 154

LECT1 Protein Vector (Human) (pPB-C-His)

PV023549 500 ng
EUR 329

LECT1 Protein Vector (Human) (pPB-N-His)

PV023550 500 ng
EUR 329

LECT1 Protein Vector (Human) (pPM-C-HA)

PV023551 500 ng
EUR 329

LECT1 Protein Vector (Human) (pPM-C-His)

PV023552 500 ng
EUR 329

LECT1 Protein Vector (Rat) (pPB-C-His)

PV277298 500 ng
EUR 603

LECT1 Protein Vector (Rat) (pPB-N-His)

PV277299 500 ng
EUR 603

LECT1 Protein Vector (Rat) (pPM-C-HA)

PV277300 500 ng
EUR 603

LECT1 Protein Vector (Rat) (pPM-C-His)

PV277301 500 ng
EUR 603

LECT1 Protein Vector (Mouse) (pPB-C-His)

PV196266 500 ng
EUR 603

LECT1 Protein Vector (Mouse) (pPB-N-His)

PV196267 500 ng
EUR 603

LECT1 Protein Vector (Mouse) (pPM-C-HA)

PV196268 500 ng
EUR 603

LECT1 Protein Vector (Mouse) (pPM-C-His)

PV196269 500 ng
EUR 603

Recombinant Leukocyte Cell Derived Chemotaxin 1 (LECT1)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O75829
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.8kDa
  • Isoelectric Point: 9
Description: Recombinant Human Leukocyte Cell Derived Chemotaxin 1 expressed in: E.coli

LECT1 Rabbit Polyclonal Antibody