CelltaGen
셀타젠 Genetic Genotyping

LRRN1 Rabbit Polyclonal Antibody

LRRN1 Polyclonal Antibody

ABP59150-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LRRN1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LRRN1 from Human, Mouse, Rat. This LRRN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRRN1 protein

LRRN1 Polyclonal Antibody

ES11012-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LRRN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LRRN1 Polyclonal Antibody

ES11012-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LRRN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LRRN1 Antibody

44900-100ul 100ul
EUR 252

LRRN1 Antibody

44900-50ul 50ul
EUR 187

LRRN1 Antibody

1-CSB-PA747638LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LRRN1. Recognizes LRRN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LRRN1 Antibody

DF2702 200ul
EUR 304
Description: LRRN1 antibody detects endogenous levels of total LRRN1.

LRRN1 Antibody

ABD2702 100 ug
EUR 438

LRRN1 Polyclonal Antibody, HRP Conjugated

A50998 100 µg
EUR 570.55
Description: The best epigenetics products

LRRN1 Polyclonal Antibody, FITC Conjugated

A50999 100 µg
EUR 570.55
Description: kits suitable for this type of research

LRRN1 Polyclonal Antibody, Biotin Conjugated

A51000 100 µg
EUR 570.55
Description: fast delivery possible

Lrrn1/ Rat Lrrn1 ELISA Kit

ELI-37345r 96 Tests
EUR 886

LRRN1 Conjugated Antibody

C44900 100ul
EUR 397

Anti-LRRN1 antibody

STJ192170 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LRRN1

LRRN1 siRNA

20-abx903058
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LRRN1 siRNA

20-abx923011
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LRRN1 siRNA

20-abx923012
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LRRN1 Antibody, HRP conjugated

1-CSB-PA747638LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LRRN1. Recognizes LRRN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LRRN1 Antibody, FITC conjugated

1-CSB-PA747638LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LRRN1. Recognizes LRRN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LRRN1 Antibody, Biotin conjugated

1-CSB-PA747638LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LRRN1. Recognizes LRRN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LRRN1 Blocking Peptide

DF2702-BP 1mg
EUR 195

LRRN1 cloning plasmid

CSB-CL747638HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2151
  • Sequence: atggctaggatgagctttgttatagcagcttgccaattggtgctgggcctactaatgacttcattaaccgagtcttccatacagaatagtgagtgtccacaactttgcgtatgtgaaattcgtccctggtttaccccacagtcaacttacagagaagccaccactgttgattgca
  • Show more
Description: A cloning plasmid for the LRRN1 gene.

Anti-LRRN1 (3D11)

YF-MA20572 100 ug
EUR 363
Description: Mouse monoclonal to LRRN1

LRRN1 ELISA KIT|Human

EF005195 96 Tests
EUR 689

Rat LRRN1 shRNA Plasmid

20-abx990964
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LRRN1 shRNA Plasmid

20-abx961595
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LRRN1 shRNA Plasmid

20-abx971358
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LRRN1 Recombinant Protein (Human)

RP018319 100 ug Ask for price

LRRN1 Recombinant Protein (Mouse)

RP148427 100 ug Ask for price

LRRN1 Recombinant Protein (Rat)

RP210143 100 ug Ask for price

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human)

4-PAL681Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRN1 (Ser418~Ala631)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1)

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), APC

4-PAL681Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRN1 (Ser418~Ala631)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with APC.

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), Biotinylated

4-PAL681Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRN1 (Ser418~Ala631)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with Biotin.

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), Cy3

4-PAL681Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRN1 (Ser418~Ala631)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with Cy3.

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), FITC

4-PAL681Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRN1 (Ser418~Ala631)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with FITC.

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), HRP

4-PAL681Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRN1 (Ser418~Ala631)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with HRP.

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), PE

4-PAL681Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRN1 (Ser418~Ala631)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with PE.

Lrrn1 ORF Vector (Rat) (pORF)

ORF070049 1.0 ug DNA
EUR 506

LRRN1 ORF Vector (Human) (pORF)

ORF006107 1.0 ug DNA
EUR 95

Lrrn1 ORF Vector (Mouse) (pORF)

ORF049477 1.0 ug DNA
EUR 506

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), APC-Cy7

4-PAL681Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRN1 (Ser418~Ala631)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with APC-Cy7.

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Antibody

20-abx128122
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Leucine-Rich Repeat Neuronal Protein 1 (LRRN1) Antibody

20-abx147588
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leucine-Rich Repeat Neuronal Protein 1 (LRRN1) Antibody

20-abx301442
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lrrn1 sgRNA CRISPR Lentivector set (Rat)

K7510401 3 x 1.0 ug
EUR 339

Lrrn1 sgRNA CRISPR Lentivector set (Mouse)

K3696101 3 x 1.0 ug
EUR 339

LRRN1 sgRNA CRISPR Lentivector set (Human)

K1239001 3 x 1.0 ug
EUR 339

Leucine-Rich Repeat Neuronal Protein 1 (LRRN1) Antibody (HRP)

20-abx307892
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leucine-Rich Repeat Neuronal Protein 1 (LRRN1) Antibody (FITC)

20-abx307893
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leucine-Rich Repeat Neuronal Protein 1 (LRRN1) Antibody (Biotin)

20-abx307894
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lrrn1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7510402 1.0 ug DNA
EUR 154

Lrrn1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7510403 1.0 ug DNA
EUR 154

Lrrn1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7510404 1.0 ug DNA
EUR 154

Lrrn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3696102 1.0 ug DNA
EUR 154

Lrrn1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3696103 1.0 ug DNA
EUR 154

Lrrn1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3696104 1.0 ug DNA
EUR 154

LRRN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1239002 1.0 ug DNA
EUR 154

LRRN1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1239003 1.0 ug DNA
EUR 154

LRRN1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1239004 1.0 ug DNA
EUR 154

LRRN1 Protein Vector (Human) (pPB-C-His)

PV024425 500 ng
EUR 329

LRRN1 Protein Vector (Human) (pPB-N-His)

PV024426 500 ng
EUR 329

LRRN1 Protein Vector (Human) (pPM-C-HA)

PV024427 500 ng
EUR 329

LRRN1 Protein Vector (Human) (pPM-C-His)

PV024428 500 ng
EUR 329

LRRN1 Protein Vector (Rat) (pPB-C-His)

PV280194 500 ng
EUR 1166

LRRN1 Protein Vector (Rat) (pPB-N-His)

PV280195 500 ng
EUR 1166

LRRN1 Protein Vector (Rat) (pPM-C-HA)

PV280196 500 ng
EUR 1166

LRRN1 Protein Vector (Rat) (pPM-C-His)

PV280197 500 ng
EUR 1166

LRRN1 Protein Vector (Mouse) (pPB-C-His)

PV197906 500 ng
EUR 1065

LRRN1 Protein Vector (Mouse) (pPB-N-His)

PV197907 500 ng
EUR 1065

LRRN1 Protein Vector (Mouse) (pPM-C-HA)

PV197908 500 ng
EUR 1065

LRRN1 Protein Vector (Mouse) (pPM-C-His)

PV197909 500 ng
EUR 1065

Lrrn1 3'UTR Luciferase Stable Cell Line

TU112657 1.0 ml Ask for price

Lrrn1 3'UTR GFP Stable Cell Line

TU162657 1.0 ml Ask for price

Lrrn1 3'UTR Luciferase Stable Cell Line

TU212615 1.0 ml Ask for price

Lrrn1 3'UTR GFP Stable Cell Line

TU262615 1.0 ml Ask for price

LRRN1 3'UTR GFP Stable Cell Line

TU062707 1.0 ml
EUR 1394

LRRN1 3'UTR Luciferase Stable Cell Line

TU012707 1.0 ml
EUR 1394

Human Leucine-rich repeat neuronal protein 1 (LRRN1)

1-CSB-EP747638HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 84.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Leucine-rich repeat neuronal protein 1(LRRN1) ,partial expressed in E.coli

LRRN1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV686269 1.0 ug DNA
EUR 1355

LRRN1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV686273 1.0 ug DNA
EUR 1355

LRRN1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV686274 1.0 ug DNA
EUR 1355

LRRN1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV792037 1.0 ug DNA
EUR 316

LRRN1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV792038 1.0 ug DNA
EUR 316

Recombinant Leucine Rich Repeat Neuronal Protein 1 (LRRN1)

4-RPL681Hu01
  • EUR 481.70
  • EUR 232.00
  • EUR 1531.36
  • EUR 577.12
  • EUR 1054.24
  • EUR 385.00
  • EUR 3678.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6UXK5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 53.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Leucine Rich Repeat Neuronal Protein 1 expressed in: E.coli

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LRRN1 Rabbit Polyclonal Antibody