CelltaGen
셀타젠 Genetic Genotyping

LRRN1 Rabbit Polyclonal Antibody

LRRN1 Polyclonal Antibody

ABP59150-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LRRN1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LRRN1 from Human, Mouse, Rat. This LRRN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRRN1 protein

LRRN1 Polyclonal Antibody

ABP59150-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LRRN1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LRRN1 from Human, Mouse, Rat. This LRRN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRRN1 protein

LRRN1 Polyclonal Antibody

A50997 100 µg
EUR 570.55
Description: Ask the seller for details

LRRN1 Antibody

ABD2702 100 ug
EUR 438

LRRN1 Antibody

44900-100ul 100ul
EUR 252

LRRN1 Antibody

44900-50ul 50ul
EUR 187

LRRN1 Antibody

DF2702 200ul
EUR 304
Description: LRRN1 antibody detects endogenous levels of total LRRN1.

LRRN1 Antibody

1-CSB-PA747638LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LRRN1. Recognizes LRRN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LRRN1 Polyclonal Antibody, HRP Conjugated

A50998 100 µg
EUR 570.55
Description: The best epigenetics products

LRRN1 Polyclonal Antibody, FITC Conjugated

A50999 100 µg
EUR 570.55
Description: kits suitable for this type of research

LRRN1 Polyclonal Antibody, Biotin Conjugated

A51000 100 µg
EUR 570.55
Description: fast delivery possible

Lrrn1/ Rat Lrrn1 ELISA Kit

ELI-37345r 96 Tests
EUR 886

LRRN1 Conjugated Antibody

C44900 100ul
EUR 397

Anti-LRRN1 antibody

STJ192170 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LRRN1

LRRN1 siRNA

20-abx903058
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LRRN1 siRNA

20-abx923011
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LRRN1 siRNA

20-abx923012
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LRRN1 Antibody, HRP conjugated

1-CSB-PA747638LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LRRN1. Recognizes LRRN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LRRN1 Antibody, FITC conjugated

1-CSB-PA747638LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LRRN1. Recognizes LRRN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LRRN1 Antibody, Biotin conjugated

1-CSB-PA747638LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LRRN1. Recognizes LRRN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LRRN1 Blocking Peptide

DF2702-BP 1mg
EUR 195

LRRN1 cloning plasmid

CSB-CL747638HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2151
  • Sequence: atggctaggatgagctttgttatagcagcttgccaattggtgctgggcctactaatgacttcattaaccgagtcttccatacagaatagtgagtgtccacaactttgcgtatgtgaaattcgtccctggtttaccccacagtcaacttacagagaagccaccactgttgattgca
  • Show more
Description: A cloning plasmid for the LRRN1 gene.

Anti-LRRN1 (3D11)

YF-MA20572 100 ug
EUR 363
Description: Mouse monoclonal to LRRN1

LRRN1 ELISA KIT|Human

EF005195 96 Tests
EUR 689

Mouse LRRN1 shRNA Plasmid

20-abx971358
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat LRRN1 shRNA Plasmid

20-abx990964
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LRRN1 shRNA Plasmid

20-abx961595
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LRRN1 Recombinant Protein (Human)

RP018319 100 ug Ask for price

LRRN1 Recombinant Protein (Rat)

RP210143 100 ug Ask for price

LRRN1 Recombinant Protein (Mouse)

RP148427 100 ug Ask for price

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human)

4-PAL681Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRN1 (Ser418~Ala631)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1)

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), APC

4-PAL681Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRN1 (Ser418~Ala631)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with APC.

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), Biotinylated

4-PAL681Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRN1 (Ser418~Ala631)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with Biotin.

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), Cy3

4-PAL681Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRN1 (Ser418~Ala631)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with Cy3.

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), FITC

4-PAL681Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRN1 (Ser418~Ala631)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with FITC.

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), HRP

4-PAL681Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRN1 (Ser418~Ala631)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with HRP.

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), PE

4-PAL681Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRN1 (Ser418~Ala631)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with PE.

LRRN1 ORF Vector (Human) (pORF)

ORF006107 1.0 ug DNA
EUR 95

Lrrn1 ORF Vector (Mouse) (pORF)

ORF049477 1.0 ug DNA
EUR 506

Lrrn1 ORF Vector (Rat) (pORF)

ORF070049 1.0 ug DNA
EUR 506

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), APC-Cy7

4-PAL681Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRN1 (Ser418~Ala631)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with APC-Cy7.

Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Antibody

20-abx128122
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Leucine-Rich Repeat Neuronal Protein 1 (LRRN1) Antibody

20-abx147588
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leucine-Rich Repeat Neuronal Protein 1 (LRRN1) Antibody

20-abx301442
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

LRRN1 sgRNA CRISPR Lentivector set (Human)

K1239001 3 x 1.0 ug
EUR 339

Lrrn1 sgRNA CRISPR Lentivector set (Mouse)

K3696101 3 x 1.0 ug
EUR 339

Lrrn1 sgRNA CRISPR Lentivector set (Rat)

K7510401 3 x 1.0 ug
EUR 339

Leucine-Rich Repeat Neuronal Protein 1 (LRRN1) Antibody (HRP)

20-abx307892
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leucine-Rich Repeat Neuronal Protein 1 (LRRN1) Antibody (FITC)

20-abx307893
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leucine-Rich Repeat Neuronal Protein 1 (LRRN1) Antibody (Biotin)

20-abx307894
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

LRRN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1239002 1.0 ug DNA
EUR 154

LRRN1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1239003 1.0 ug DNA
EUR 154

LRRN1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1239004 1.0 ug DNA
EUR 154

Lrrn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3696102 1.0 ug DNA
EUR 154

Lrrn1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3696103 1.0 ug DNA
EUR 154

Lrrn1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3696104 1.0 ug DNA
EUR 154

Lrrn1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7510402 1.0 ug DNA
EUR 154

Lrrn1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7510403 1.0 ug DNA
EUR 154

Lrrn1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7510404 1.0 ug DNA
EUR 154

LRRN1 Protein Vector (Human) (pPB-C-His)

PV024425 500 ng
EUR 329

LRRN1 Protein Vector (Human) (pPB-N-His)

PV024426 500 ng
EUR 329

LRRN1 Protein Vector (Human) (pPM-C-HA)

PV024427 500 ng
EUR 329

LRRN1 Protein Vector (Human) (pPM-C-His)

PV024428 500 ng
EUR 329

LRRN1 Protein Vector (Rat) (pPB-C-His)

PV280194 500 ng
EUR 1166

LRRN1 Protein Vector (Rat) (pPB-N-His)

PV280195 500 ng
EUR 1166

LRRN1 Protein Vector (Rat) (pPM-C-HA)

PV280196 500 ng
EUR 1166

LRRN1 Protein Vector (Rat) (pPM-C-His)

PV280197 500 ng
EUR 1166

LRRN1 Protein Vector (Mouse) (pPB-C-His)

PV197906 500 ng
EUR 1065

LRRN1 Protein Vector (Mouse) (pPB-N-His)

PV197907 500 ng
EUR 1065

LRRN1 Protein Vector (Mouse) (pPM-C-HA)

PV197908 500 ng
EUR 1065

LRRN1 Protein Vector (Mouse) (pPM-C-His)

PV197909 500 ng
EUR 1065

Lrrn1 3'UTR GFP Stable Cell Line

TU162657 1.0 ml Ask for price

Lrrn1 3'UTR Luciferase Stable Cell Line

TU212615 1.0 ml Ask for price

LRRN1 3'UTR Luciferase Stable Cell Line

TU012707 1.0 ml
EUR 1394

Lrrn1 3'UTR Luciferase Stable Cell Line

TU112657 1.0 ml Ask for price

LRRN1 3'UTR GFP Stable Cell Line

TU062707 1.0 ml
EUR 1394

Lrrn1 3'UTR GFP Stable Cell Line

TU262615 1.0 ml Ask for price

Human Leucine-rich repeat neuronal protein 1 (LRRN1)

1-CSB-EP747638HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 84.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Leucine-rich repeat neuronal protein 1(LRRN1) ,partial expressed in E.coli

LRRN1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV686269 1.0 ug DNA
EUR 1355

LRRN1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV686273 1.0 ug DNA
EUR 1355

LRRN1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV686274 1.0 ug DNA
EUR 1355

LRRN1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV792037 1.0 ug DNA
EUR 316

LRRN1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV792038 1.0 ug DNA
EUR 316

Recombinant Leucine Rich Repeat Neuronal Protein 1 (LRRN1)

4-RPL681Hu01
  • EUR 481.70
  • EUR 232.00
  • EUR 1531.36
  • EUR 577.12
  • EUR 1054.24
  • EUR 385.00
  • EUR 3678.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6UXK5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 53.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Leucine Rich Repeat Neuronal Protein 1 expressed in: E.coli

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

LRRN1 Rabbit Polyclonal Antibody