LRRN1 Rabbit Polyclonal Antibody
LRRN1 Polyclonal Antibody |
ABP59150-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human LRRN1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of LRRN1 from Human, Mouse, Rat. This LRRN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRRN1 protein |
LRRN1 Polyclonal Antibody |
ABP59150-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LRRN1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of LRRN1 from Human, Mouse, Rat. This LRRN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRRN1 protein |
LRRN1 Polyclonal Antibody |
A50997 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
LRRN1 Antibody |
44900-100ul |
SAB |
100ul |
EUR 252 |
LRRN1 Antibody |
44900-50ul |
SAB |
50ul |
EUR 187 |
LRRN1 Antibody |
DF2702 |
Affbiotech |
200ul |
EUR 304 |
Description: LRRN1 antibody detects endogenous levels of total LRRN1. |
LRRN1 Antibody |
1-CSB-PA747638LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LRRN1. Recognizes LRRN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
LRRN1 Polyclonal Antibody, HRP Conjugated |
A50998 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
LRRN1 Polyclonal Antibody, FITC Conjugated |
A50999 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
LRRN1 Polyclonal Antibody, Biotin Conjugated |
A51000 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
LRRN1 Conjugated Antibody |
C44900 |
SAB |
100ul |
EUR 397 |
Anti-LRRN1 antibody |
STJ192170 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to LRRN1 |
LRRN1 siRNA |
20-abx903058 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LRRN1 siRNA |
20-abx923011 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LRRN1 siRNA |
20-abx923012 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LRRN1 Antibody, HRP conjugated |
1-CSB-PA747638LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LRRN1. Recognizes LRRN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
LRRN1 Antibody, FITC conjugated |
1-CSB-PA747638LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LRRN1. Recognizes LRRN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
LRRN1 Antibody, Biotin conjugated |
1-CSB-PA747638LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LRRN1. Recognizes LRRN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
LRRN1 Blocking Peptide |
DF2702-BP |
Affbiotech |
1mg |
EUR 195 |
LRRN1 cloning plasmid |
CSB-CL747638HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2151
- Sequence: atggctaggatgagctttgttatagcagcttgccaattggtgctgggcctactaatgacttcattaaccgagtcttccatacagaatagtgagtgtccacaactttgcgtatgtgaaattcgtccctggtttaccccacagtcaacttacagagaagccaccactgttgattgca
- Show more
|
Description: A cloning plasmid for the LRRN1 gene. |
Anti-LRRN1 (3D11) |
YF-MA20572 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to LRRN1 |
Mouse LRRN1 shRNA Plasmid |
20-abx971358 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat LRRN1 shRNA Plasmid |
20-abx990964 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human LRRN1 shRNA Plasmid |
20-abx961595 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LRRN1 Recombinant Protein (Human) |
RP018319 |
ABM |
100 ug |
Ask for price |
LRRN1 Recombinant Protein (Rat) |
RP210143 |
ABM |
100 ug |
Ask for price |
LRRN1 Recombinant Protein (Mouse) |
RP148427 |
ABM |
100 ug |
Ask for price |
Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human) |
4-PAL681Hu01 |
Cloud-Clone |
-
EUR 261.00
-
EUR 2734.00
-
EUR 676.00
-
EUR 330.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRN1 (Ser418~Ala631)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1) |
Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), APC |
4-PAL681Hu01-APC |
Cloud-Clone |
-
EUR 367.00
-
EUR 3581.00
-
EUR 989.00
-
EUR 470.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRN1 (Ser418~Ala631)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with APC. |
Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), Biotinylated |
4-PAL681Hu01-Biotin |
Cloud-Clone |
-
EUR 327.00
-
EUR 2684.00
-
EUR 783.00
-
EUR 403.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRN1 (Ser418~Ala631)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with Biotin. |
Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), Cy3 |
4-PAL681Hu01-Cy3 |
Cloud-Clone |
-
EUR 447.00
-
EUR 4733.00
-
EUR 1277.00
-
EUR 585.00
-
EUR 263.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRN1 (Ser418~Ala631)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with Cy3. |
Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), FITC |
4-PAL681Hu01-FITC |
Cloud-Clone |
-
EUR 313.00
-
EUR 2884.00
-
EUR 811.00
-
EUR 396.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRN1 (Ser418~Ala631)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with FITC. |
Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), HRP |
4-PAL681Hu01-HRP |
Cloud-Clone |
-
EUR 334.00
-
EUR 3120.00
-
EUR 873.00
-
EUR 424.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRN1 (Ser418~Ala631)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with HRP. |
Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), PE |
4-PAL681Hu01-PE |
Cloud-Clone |
-
EUR 313.00
-
EUR 2884.00
-
EUR 811.00
-
EUR 396.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRN1 (Ser418~Ala631)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with PE. |
LRRN1 ORF Vector (Human) (pORF) |
ORF006107 |
ABM |
1.0 ug DNA |
EUR 95 |
Lrrn1 ORF Vector (Mouse) (pORF) |
ORF049477 |
ABM |
1.0 ug DNA |
EUR 506 |
Lrrn1 ORF Vector (Rat) (pORF) |
ORF070049 |
ABM |
1.0 ug DNA |
EUR 506 |
Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAL681Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 614.00
-
EUR 7042.00
-
EUR 1858.00
-
EUR 821.00
-
EUR 337.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRN1 (Ser418~Ala631)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Neuronal Protein 1 (LRRN1). This antibody is labeled with APC-Cy7. |
Leucine Rich Repeat Neuronal Protein 1 (LRRN1) Antibody |
20-abx128122 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Leucine-Rich Repeat Neuronal Protein 1 (LRRN1) Antibody |
20-abx147588 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Leucine-Rich Repeat Neuronal Protein 1 (LRRN1) Antibody |
20-abx301442 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
LRRN1 sgRNA CRISPR Lentivector set (Human) |
K1239001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lrrn1 sgRNA CRISPR Lentivector set (Mouse) |
K3696101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lrrn1 sgRNA CRISPR Lentivector set (Rat) |
K7510401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Leucine-Rich Repeat Neuronal Protein 1 (LRRN1) Antibody (HRP) |
20-abx307892 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Leucine-Rich Repeat Neuronal Protein 1 (LRRN1) Antibody (FITC) |
20-abx307893 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Leucine-Rich Repeat Neuronal Protein 1 (LRRN1) Antibody (Biotin) |
20-abx307894 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
LRRN1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1239002 |
ABM |
1.0 ug DNA |
EUR 154 |
LRRN1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1239003 |
ABM |
1.0 ug DNA |
EUR 154 |
LRRN1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1239004 |
ABM |
1.0 ug DNA |
EUR 154 |
Lrrn1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3696102 |
ABM |
1.0 ug DNA |
EUR 154 |
Lrrn1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3696103 |
ABM |
1.0 ug DNA |
EUR 154 |
Lrrn1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3696104 |
ABM |
1.0 ug DNA |
EUR 154 |
Lrrn1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7510402 |
ABM |
1.0 ug DNA |
EUR 154 |
Lrrn1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7510403 |
ABM |
1.0 ug DNA |
EUR 154 |
Lrrn1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7510404 |
ABM |
1.0 ug DNA |
EUR 154 |
LRRN1 Protein Vector (Human) (pPB-C-His) |
PV024425 |
ABM |
500 ng |
EUR 329 |
LRRN1 Protein Vector (Human) (pPB-N-His) |
PV024426 |
ABM |
500 ng |
EUR 329 |
LRRN1 Protein Vector (Human) (pPM-C-HA) |
PV024427 |
ABM |
500 ng |
EUR 329 |
LRRN1 Protein Vector (Human) (pPM-C-His) |
PV024428 |
ABM |
500 ng |
EUR 329 |
LRRN1 Protein Vector (Rat) (pPB-C-His) |
PV280194 |
ABM |
500 ng |
EUR 1166 |
LRRN1 Protein Vector (Rat) (pPB-N-His) |
PV280195 |
ABM |
500 ng |
EUR 1166 |
LRRN1 Protein Vector (Rat) (pPM-C-HA) |
PV280196 |
ABM |
500 ng |
EUR 1166 |
LRRN1 Protein Vector (Rat) (pPM-C-His) |
PV280197 |
ABM |
500 ng |
EUR 1166 |
LRRN1 Protein Vector (Mouse) (pPB-C-His) |
PV197906 |
ABM |
500 ng |
EUR 1065 |
LRRN1 Protein Vector (Mouse) (pPB-N-His) |
PV197907 |
ABM |
500 ng |
EUR 1065 |
LRRN1 Protein Vector (Mouse) (pPM-C-HA) |
PV197908 |
ABM |
500 ng |
EUR 1065 |
LRRN1 Protein Vector (Mouse) (pPM-C-His) |
PV197909 |
ABM |
500 ng |
EUR 1065 |
Lrrn1 3'UTR GFP Stable Cell Line |
TU162657 |
ABM |
1.0 ml |
Ask for price |
Lrrn1 3'UTR Luciferase Stable Cell Line |
TU212615 |
ABM |
1.0 ml |
Ask for price |
LRRN1 3'UTR Luciferase Stable Cell Line |
TU012707 |
ABM |
1.0 ml |
EUR 1394 |
Lrrn1 3'UTR Luciferase Stable Cell Line |
TU112657 |
ABM |
1.0 ml |
Ask for price |
LRRN1 3'UTR GFP Stable Cell Line |
TU062707 |
ABM |
1.0 ml |
EUR 1394 |
Lrrn1 3'UTR GFP Stable Cell Line |
TU262615 |
ABM |
1.0 ml |
Ask for price |
Human Leucine-rich repeat neuronal protein 1 (LRRN1) |
1-CSB-EP747638HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 84.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Leucine-rich repeat neuronal protein 1(LRRN1) ,partial expressed in E.coli |
LRRN1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV686269 |
ABM |
1.0 ug DNA |
EUR 1355 |
LRRN1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV686273 |
ABM |
1.0 ug DNA |
EUR 1355 |
LRRN1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV686274 |
ABM |
1.0 ug DNA |
EUR 1355 |
LRRN1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV792037 |
ABM |
1.0 ug DNA |
EUR 316 |
LRRN1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV792038 |
ABM |
1.0 ug DNA |
EUR 316 |
Recombinant Leucine Rich Repeat Neuronal Protein 1 (LRRN1) |
4-RPL681Hu01 |
Cloud-Clone |
-
EUR 481.70
-
EUR 232.00
-
EUR 1531.36
-
EUR 577.12
-
EUR 1054.24
-
EUR 385.00
-
EUR 3678.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q6UXK5
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 53.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Leucine Rich Repeat Neuronal Protein 1 expressed in: E.coli |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
LRRN1 Rabbit Polyclonal Antibody