셀타젠 Genetic Genotyping

LY96 Rabbit Polyclonal Antibody

LY96 Polyclonal Antibody

ES11009-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LY96 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Lymphocyte Antigen 96 (LY96) ELISA Kit

DLR-LY96-Hu-48T 48T
EUR 463
  • Should the Human Lymphocyte Antigen 96 (LY96) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lymphocyte Antigen 96 (LY96) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Lymphocyte Antigen 96 (LY96) ELISA Kit

DLR-LY96-Hu-96T 96T
EUR 599
  • Should the Human Lymphocyte Antigen 96 (LY96) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lymphocyte Antigen 96 (LY96) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Lymphocyte Antigen 96 (LY96) ELISA Kit

RDR-LY96-Hu-48Tests 48 Tests
EUR 481

Human Lymphocyte Antigen 96 (LY96) ELISA Kit

RDR-LY96-Hu-96Tests 96 Tests
EUR 665

Human Lymphocyte Antigen 96 (LY96) ELISA Kit

RD-LY96-Hu-48Tests 48 Tests
EUR 460

Human Lymphocyte Antigen 96 (LY96) ELISA Kit

RD-LY96-Hu-96Tests 96 Tests
EUR 636

LY96 Rabbit pAb

A1866-100ul 100 ul
EUR 308

LY96 Rabbit pAb

A1866-200ul 200 ul
EUR 459

LY96 Rabbit pAb

A1866-20ul 20 ul
EUR 183

LY96 Rabbit pAb

A1866-50ul 50 ul
EUR 223

LY96 antibody

70R-18335 50 ul
EUR 435
Description: Rabbit polyclonal LY96 antibody

LY96 antibody

70R-10270 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal LY96 antibody

LY96 Antibody

32480-100ul 100ul
EUR 252

LY96 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100

LY96 Antibody

DF6669 200ul
EUR 304
Description: LY96 Antibody detects endogenous levels of total LY96.

LY96 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LY96 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

LY96 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LY96 Antibody

ABD6669 100 ug
EUR 438

Polyclonal LY96 Antibody (C-term)

APR17258G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LY96 (C-term). This antibody is tested and proven to work in the following applications:

LY96 Polyclonal Antibody, Biotin Conjugated

A59695 100 µg
EUR 570.55
Description: reagents widely cited

LY96 Polyclonal Antibody, FITC Conjugated

A59696 100 µg
EUR 570.55
Description: Ask the seller for details

LY96 Polyclonal Antibody, HRP Conjugated

A59697 100 µg
EUR 570.55
Description: The best epigenetics products

LY96 Conjugated Antibody

C32480 100ul
EUR 397

anti- LY96 antibody

FNab04900 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:50-1:200
  • Immunogen: lymphocyte antigen 96
  • Uniprot ID: Q9Y6Y9
  • Gene ID: 23643
  • Research Area: Signal Transduction, Metabolism, Cancer, Immunology
Description: Antibody raised against LY96

Anti-LY96 antibody

PAab04900 100 ug
EUR 412

Anti-LY96 antibody

STJ24433 100 µl
EUR 277
Description: This gene encodes a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS), thus providing a link between the receptor and LPS signaling. Studies of the mouse ortholog suggest that this gene may be involved in endotoxin neutralization. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-LY96 antibody

STJ192167 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LY96

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LY96 (Gln19~Asn160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lymphocyte Antigen 96 (LY96)

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LY96 (Thr16~Asn160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lymphocyte Antigen 96 (LY96)

LY96 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LY96 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LY96 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LY96 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LY96 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY96. Recognizes LY96 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LY96 (Gln19~Asn160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lymphocyte Antigen 96 (LY96). This antibody is labeled with APC.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LY96 (Gln19~Asn160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lymphocyte Antigen 96 (LY96). This antibody is labeled with Biotin.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LY96 (Gln19~Asn160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lymphocyte Antigen 96 (LY96). This antibody is labeled with Cy3.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LY96 (Gln19~Asn160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lymphocyte Antigen 96 (LY96). This antibody is labeled with FITC.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LY96 (Gln19~Asn160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lymphocyte Antigen 96 (LY96). This antibody is labeled with HRP.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LY96 (Gln19~Asn160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lymphocyte Antigen 96 (LY96). This antibody is labeled with PE.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LY96 (Thr16~Asn160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lymphocyte Antigen 96 (LY96). This antibody is labeled with APC.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LY96 (Thr16~Asn160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lymphocyte Antigen 96 (LY96). This antibody is labeled with Biotin.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LY96 (Thr16~Asn160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lymphocyte Antigen 96 (LY96). This antibody is labeled with Cy3.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LY96 (Thr16~Asn160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lymphocyte Antigen 96 (LY96). This antibody is labeled with FITC.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LY96 (Thr16~Asn160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lymphocyte Antigen 96 (LY96). This antibody is labeled with HRP.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LY96 (Thr16~Asn160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lymphocyte Antigen 96 (LY96). This antibody is labeled with PE.

LY96 Blocking Peptide

33R-6768 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LY96 antibody, catalog no. 70R-10270

LY96 Blocking Peptide

DF6669-BP 1mg
EUR 195

LY96 cloning plasmid

CSB-CL013254HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 483
  • Sequence: atgttaccatttctgtttttttccaccctgttttcttccatatttactgaagctcagaagcagtattgggtctgcaactcatccgatgcaagtatttcatacacctactgtgataaaatgcaatacccaatttcaattaatgttaacccctgtatagaattgaaaggatccaaagg
  • Show more
Description: A cloning plasmid for the LY96 gene.

pcDNA3.1-LY96 Plasmid

PVTB00381-2a 2 ug
EUR 356

Lymphocyte Antigen 96 (LY96) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lymphocyte Antigen 96 (LY96) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lymphocyte Antigen 96 (LY96) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lymphocyte Antigen 96 (LY96) Antibody

abx029509-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody

abx029509-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody

abx234900-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Lymphocyte Antigen 96 (LY96) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LY96 (Gln19~Asn160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lymphocyte Antigen 96 (LY96). This antibody is labeled with APC-Cy7.

Lymphocyte Antigen 96 (LY96) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LY96 (Thr16~Asn160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lymphocyte Antigen 96 (LY96). This antibody is labeled with APC-Cy7.

Lymphocyte Antigen 96 (LY96) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Lymphocyte Antigen 96 (LY96) Antibody (Biotin)

  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Lymphocyte Antigen 96 (LY96) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lymphocyte Antigen 96 (LY96) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


EF010760 96 Tests
EUR 689

Human LY96 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LY96 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LY96 Recombinant Protein (Human)

RP018451 100 ug Ask for price

LY96 Recombinant Protein (Mouse)

RP148730 100 ug Ask for price

LY96 Recombinant Protein (Mouse)

RP148733 100 ug Ask for price

LY96 Recombinant Protein (Rat)

RP210383 100 ug Ask for price

Human Lymphocyte antigen 96 (LY96)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 46.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Lymphocyte antigen 96(LY96),partial expressed in E.coli

Mouse Lymphocyte antigen 96 (Ly96)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 32.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Lymphocyte antigen 96(Ly96) expressed in E.coli

Mouse Lymphocyte antigen 96 (Ly96)

  • EUR 293.00
  • EUR 963.00
  • EUR 409.00
  • EUR 717.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 20.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Lymphocyte antigen 96(Ly96) expressed in Mammalian cell

Ly96 ORF Vector (Rat) (pORF)

ORF070129 1.0 ug DNA
EUR 506

LY96 ORF Vector (Human) (pORF)

ORF006151 1.0 ug DNA
EUR 95

Ly96 ORF Vector (Mouse) (pORF)

ORF049578 1.0 ug DNA
EUR 506

Ly96 ORF Vector (Mouse) (pORF)

ORF049579 1.0 ug DNA
EUR 506

Recombinant Lymphocyte Antigen 96 (LY96)

  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Y6Y9
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.6kDa
  • Isoelectric Point: 8.8
Description: Recombinant Human Lymphocyte Antigen 96 expressed in: E.coli

Recombinant Lymphocyte Antigen 96 (LY96)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9JHF9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.2kDa
  • Isoelectric Point: 6.4
Description: Recombinant Mouse Lymphocyte Antigen 96 expressed in: E.coli

LY96 ELISA Kit (Human) (OKAN05795)

OKAN05795 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS), thus providing a link between the receptor and LPS signaling. Studies of the mouse ortholog suggest that this gene may be involved in endotoxin neutralization. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.062 ng/mL

LY96 ELISA Kit (Human) (OKCD00545)

OKCD00545 96 Wells
EUR 831
Description: Description of target: Binds bacterial lipopolysaccharide (LPS) (PubMed:17803912, PubMed:17569869). Cooperates with TLR4 in the innate immune response to bacterial lipopolysaccharide (LPS), and with TLR2 in the response to cell wall components from Gram-positive and Gram-negative bacteria (PubMed:11160242, PubMed:11593030). Enhances TLR4-dependent activation of NF-kappa-B (PubMed:10359581). Cells expressing both LY96 and TLR4, but not TLR4 alone, respond to LPS (PubMed:10359581).5 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like receptor 4."_x005F_x005F_x000D_Shimazu R., Akashi S., Ogata H., Nagai Y., Fukudome K., Miyake K., Kimoto M._x005F_x005F_x000D_J. Exp. Med. 189:1777-1782(1999) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), VARIANT GLY-56, FUNCTION, INTERACTION WITH TLR4, SUBCELLULAR LOCATION.Ref.8"MD-2 enables Toll-like receptor 2 (TLR2)-mediated responses to lipopolysaccharide and enhances TLR2-mediated responses to Gram-positive and Gram-negative bacteria and their cell wall components."_x005F_x005F_x000D_Dziarski R., Wang Q., Miyake K., Kirschning C.J., Gupta D._x005F_x005F_x000D_J. Immunol. 166:1938-1944(2001) [PubMed] [Europe PMC] [Abstract]Cited for: INTERACTION WITH TLR2 AND TLR4, FUNCTION.Ref.9"Secreted MD-2 is a large polymeric protein that efficiently confers lipopolysaccharide sensitivity to Toll-like receptor 4."_x005F_x005F_x000D_Visintin A., Mazzoni A., Spitzer J.A., Segal D.M._x005F_x005F_x000D_Proc. Natl. Acad. Sci. U.S.A. 98:12156-12161(2001) [PubMed] [Europe PMC] [Abstract]Cited for: DISULFIDE BONDS, GLYCOSYLATION, SUBCELLULAR LOCATION, FUNCTION, INTERACTION WITH TLR4.Ref.11"Crystal structure of the TLR4-MD-2 complex with bound endotoxin antagonist Eritoran."_x005F_x005F_x000D_Kim H.M., Park B.S., Kim J.-I., Kim S.E., Lee J., Oh S.C., Enkhbayar P., Matsushima N., Lee H., Yoo O.J., Lee J.-O._x005F_x005F_x000D_Cell 130:906-917(2007) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.7 ANGSTROMS) OF 19-158 IN COMPLEX WITH TLR4 AND LIPOPOLYSACCHARIDE ANALOG, SUBUNIT.Ref.12"Crystal structures of human MD-2 and its complex with antiendotoxic lipid IVa."_x005F_x005F_x000D_Ohto U., Fukase K., Miyake K., Satow Y._x005F_x005F_x000D_Science 316:1632-1634(2007) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.0 ANGSTROMS) OF 17-160 IN COMPLEX WITH LIPID IV-A, DISULFIDE BONDS, GLYCOSYLATION AT ASN-26 AND ASN-114. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.062 ng/mL

LY96 ELISA Kit (Human) (OKCA01342)

OKCA01342 96 Wells
EUR 846
Description: Description of target: Binds bacterial lipopolysaccharide (LPS). Cooperates with TLR4 in the innate immune response to bacterial lipopolysaccharide (LPS), and with TLR2 in the response to cell wall components from Gram-positive and Gram-negative bacteria. Enhances TLR4-dependent activation of NF-kappa-B. Cells expressing both LY96 and TLR4, but not TLR4 alone, respond to LPS.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 31.25 pg/mL

LY96 ELISA Kit (Mouse) (OKCA01713)

OKCA01713 96 Wells
EUR 846
Description: Description of target: Binds bacterial lipopolysaccharide (LPS) (PubMed:22532668). Cooperates with TLR4 in the innate immune response to bacterial lipopolysaccharide (LPS), and with TLR2 in the response to cell wall components from Gram-positive and Gram-negative bacteria. Enhances TLR4-dependent activation of NF-kappa-B. Cells expressing both LY96 and TLR4, but not TLR4 alone, respond to LPS (PubMed:10725698).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.039 ng/mL

LY96 ELISA Kit (Human) (OKDD00383)

OKDD00383 96 Wells
EUR 857
Description: Description of target: This gene encodes a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS), thus providing a link between the receptor and LPS signaling. Studies of the mouse ortholog suggest that this gene may be involved in endotoxin neutralization. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.06 ng/mL

Human Lymphocyte Antigen 96 (LY96) Protein

  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Lymphocyte Antigen 96 (LY96) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ly96 sgRNA CRISPR Lentivector set (Rat)

K6749501 3 x 1.0 ug
EUR 339

Ly96 sgRNA CRISPR Lentivector set (Mouse)

K4440001 3 x 1.0 ug
EUR 339

LY96 sgRNA CRISPR Lentivector set (Human)

K1246301 3 x 1.0 ug
EUR 339

Human Lymphocyte antigen 96(LY96) ELISA kit

CSB-EL013254HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Lymphocyte antigen 96 (LY96) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Lymphocyte antigen 96(LY96) ELISA kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Lymphocyte antigen 96(LY96) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Lymphocyte antigen 96(LY96) ELISA kit

CSB-EL013254MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Lymphocyte antigen 96 (LY96) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Lymphocyte antigen 96(LY96) ELISA kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Lymphocyte antigen 96(LY96) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

LY96 Rabbit Polyclonal Antibody