CelltaGen
셀타젠 Genetic Genotyping

MATN4 Rabbit Polyclonal Antibody

MATN4 Rabbit Polyclonal Antibody

MATN4 Polyclonal Antibody
ABP59229-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MATN4 from Human, Mouse. This MATN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110

MATN4 Polyclonal Antibody
ABP59229-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MATN4 from Human, Mouse. This MATN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110

MATN4 Polyclonal Antibody
ABP59229-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MATN4 from Human, Mouse. This MATN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110

MATN4 Rabbit pAb
A2761-100ul 100 ul
EUR 308

MATN4 Rabbit pAb
A2761-200ul 200 ul
EUR 459

MATN4 Rabbit pAb
A2761-20ul 20 ul
EUR 183

MATN4 Rabbit pAb
A2761-50ul 50 ul
EUR 223

MATN4 Antibody
35810-100ul 100ul
EUR 252

MATN4 Antibody
24870-100ul 100ul
EUR 390

MATN4 Antibody
1-CSB-PA013523LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

MATN4 Antibody
1-CSB-PA202607
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

MATN4 Antibody
1-CSB-PA042030
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

MATN4 Conjugated Antibody
C35810 100ul
EUR 397

Anti-MATN4 antibody
STJ24506 100 µl
EUR 277
Description: This gene encodes a member of von Willebrand factor A domain-containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This family member is thought to be play a role in reorganizing and regenerating the corneal matrix in granular and lattice type I dystrophies. It may also be involved in wound healing in the dentin-pulp complex. Alternative splicing results in multiple transcript variants.

Anti-MATN4 antibody
STJ192370 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MATN4

MATN4 siRNA
20-abx923626
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MATN4 siRNA
20-abx923627
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Matrilin 4 (MATN4) Antibody
20-abx005982
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Matrilin 4 (MATN4) Antibody
20-abx317011
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Matrilin 4 (MATN4) Antibody
20-abx212006
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Matrilin 4 (MATN4) Antibody
20-abx212315
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MATN4 Antibody, HRP conjugated
1-CSB-PA013523LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MATN4 Antibody, FITC conjugated
1-CSB-PA013523LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MATN4 Antibody, Biotin conjugated
1-CSB-PA013523LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MATN4 cloning plasmid
CSB-CL013523HU1-10ug 10ug
EUR 565
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1623
  • Sequence: ATGAGAGGCCTTCTTTGCTGGCCCGTGTTGCTGCTCCTTCTTCAGCCCTGGGAAACCCAGCTCCAGTTGACAGGTCCCAGGTGTCACACTGGGCCCCTGGATCTGGTGTTCGTGATTGACAGCTCCCGCAGCGTGCGCCCTTTCGAGTTCGAGACCATGCGGCAGTTCCTCATGG
  • Show more
Description: A cloning plasmid for the MATN4 gene.

MATN4 cloning plasmid
CSB-CL013523HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1746
  • Sequence: ATGAGAGGCCTTCTTTGCTGGCCCGTGTTGCTGCTCCTTCTTCAGCCCTGGGAAACCCAGCTCCAGTTGACAGGTCCCAGGTGTCACACTGGGCCCCTGGATCTGGTGTTCGTGATTGACAGCTCCCGCAGCGTGCGCCCTTTCGAGTTCGAGACCATGCGGCAGTTCCTCATGG
  • Show more
Description: A cloning plasmid for the MATN4 gene.

Matrilin 4 (MATN4) Antibody (HRP)
20-abx317012
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Matrilin 4 (MATN4) Antibody (FITC)
20-abx317013
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Matrilin 4 (MATN4) Antibody (Biotin)
20-abx317014
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human MATN4 shRNA Plasmid
20-abx955786
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MATN4 shRNA Plasmid
20-abx971444
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MATN4 Recombinant Protein (Human)
RP041260 100 ug Ask for price

MATN4 Recombinant Protein (Human)
RP041263 100 ug Ask for price

MATN4 Recombinant Protein (Rat)
RP210965 100 ug Ask for price

MATN4 Recombinant Protein (Mouse)
RP149588 100 ug Ask for price

MATN4 Recombinant Protein (Mouse)
RP149591 100 ug Ask for price

Matn4 ORF Vector (Mouse) (pORF)
ORF049864 1.0 ug DNA
EUR 506

Matn4 ORF Vector (Mouse) (pORF)
ORF049865 1.0 ug DNA
EUR 506

MATN4 ORF Vector (Human) (pORF)
ORF013754 1.0 ug DNA
EUR 354

MATN4 ORF Vector (Human) (pORF)
ORF013755 1.0 ug DNA
EUR 95

Matn4 ORF Vector (Rat) (pORF)
ORF070323 1.0 ug DNA
EUR 506

Rat Matrilin 4 (MATN4) CLIA Kit
20-abx496521
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Matrilin- 4, Matn4 ELISA KIT
ELI-19576m 96 Tests
EUR 865

Human Matrilin- 4, MATN4 ELISA KIT
ELI-15735h 96 Tests
EUR 824

Rat Matrilin 4 (MATN4) ELISA Kit
20-abx258933
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

MATN4 sgRNA CRISPR Lentivector set (Human)
K1273401 3 x 1.0 ug
EUR 339

Matn4 sgRNA CRISPR Lentivector set (Rat)
K6374101 3 x 1.0 ug
EUR 339

Matn4 sgRNA CRISPR Lentivector set (Mouse)
K3389901 3 x 1.0 ug
EUR 339

Rat Matrilin 4 ELISA Kit (MATN4)
RK03804 96 Tests
EUR 521

Human Matrilin 4(MATN4)ELISA Kit
QY-E02132 96T
EUR 361

Rat Matrilin 4 (MATN4) ELISA Kit
SEE147Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Matrilin 4 (MATN4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Matrilin 4 (MATN4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Matrilin 4 (MATN4) ELISA Kit
SEE147Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Matrilin 4 (MATN4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Matrilin 4 (MATN4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Matrilin 4 (MATN4) ELISA Kit
SEE147Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Matrilin 4 (MATN4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Matrilin 4 (MATN4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Matrilin 4 (MATN4) ELISA Kit
SEE147Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Matrilin 4 (MATN4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Matrilin 4 (MATN4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Matrilin 4 (MATN4) ELISA Kit
4-SEE147Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Matrilin 4 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Matrilin 4 (MATN4) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat MATN4 (Matrilin 4)
ELK7801 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Matrilin 4 (MATN4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Matrilin 4 (MAT
  • Show more
Description: A sandwich ELISA kit for detection of Matrilin 4 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

MATN4 sgRNA CRISPR Lentivector (Human) (Target 1)
K1273402 1.0 ug DNA
EUR 154

MATN4 sgRNA CRISPR Lentivector (Human) (Target 2)
K1273403 1.0 ug DNA
EUR 154

MATN4 sgRNA CRISPR Lentivector (Human) (Target 3)
K1273404 1.0 ug DNA
EUR 154

Matn4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6374102 1.0 ug DNA
EUR 154

Matn4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6374103 1.0 ug DNA
EUR 154

Matn4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6374104 1.0 ug DNA
EUR 154

Matn4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3389902 1.0 ug DNA
EUR 154

Matn4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3389903 1.0 ug DNA
EUR 154

Matn4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3389904 1.0 ug DNA
EUR 154

ELISA kit for Human Matrilin-4 (MATN4)
KTE61709-48T 48T
EUR 332
  • MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrilin-4 (MATN4)
KTE61709-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrilin-4 (MATN4)
KTE61709-96T 96T
EUR 539
  • MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrilin-4 (MATN4)
KTE71111-48T 48T
EUR 332
  • MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrilin-4 (MATN4)
KTE71111-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrilin-4 (MATN4)
KTE71111-96T 96T
EUR 539
  • MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MATN4 Protein Vector (Human) (pPB-C-His)
PV055013 500 ng
EUR 481

MATN4 Protein Vector (Human) (pPB-N-His)
PV055014 500 ng
EUR 481

MATN4 Protein Vector (Human) (pPM-C-HA)
PV055015 500 ng
EUR 481

MATN4 Protein Vector (Human) (pPM-C-His)
PV055016 500 ng
EUR 481

MATN4 Protein Vector (Human) (pPB-C-His)
PV055017 500 ng
EUR 481

MATN4 Protein Vector (Human) (pPB-N-His)
PV055018 500 ng
EUR 481

MATN4 Protein Vector (Human) (pPM-C-HA)
PV055019 500 ng
EUR 481

MATN4 Rabbit Polyclonal Antibody

CelltaGen