MATN4 Rabbit Polyclonal Antibody
MATN4 Polyclonal Antibody |
ABP59229-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of MATN4 from Human, Mouse. This MATN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN4 protein at amino acid sequence of 30-110 |
MATN4 Polyclonal Antibody |
ES11212-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MATN4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MATN4 Polyclonal Antibody |
ES11212-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MATN4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MATN4 Rabbit pAb |
A2761-100ul |
Abclonal |
100 ul |
EUR 308 |
MATN4 Rabbit pAb |
A2761-200ul |
Abclonal |
200 ul |
EUR 459 |
MATN4 Rabbit pAb |
A2761-20ul |
Abclonal |
20 ul |
EUR 183 |
MATN4 Rabbit pAb |
A2761-50ul |
Abclonal |
50 ul |
EUR 223 |
MATN4 Antibody |
24870-100ul |
SAB |
100ul |
EUR 390 |
MATN4 Antibody |
35810-100ul |
SAB |
100ul |
EUR 252 |
MATN4 Antibody |
1-CSB-PA042030 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000 |
MATN4 Antibody |
1-CSB-PA202607 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
MATN4 Antibody |
1-CSB-PA013523LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
MATN4 Conjugated Antibody |
C35810 |
SAB |
100ul |
EUR 397 |
Anti-MATN4 antibody |
STJ24506 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of von Willebrand factor A domain-containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This family member is thought to be play a role in reorganizing and regenerating the corneal matrix in granular and lattice type I dystrophies. It may also be involved in wound healing in the dentin-pulp complex. Alternative splicing results in multiple transcript variants. |
Anti-MATN4 antibody |
STJ192370 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MATN4 |
MATN4 siRNA |
20-abx923626 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MATN4 siRNA |
20-abx923627 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrilin 4 (MATN4) Antibody |
20-abx005982 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Matrilin 4 (MATN4) Antibody |
20-abx212006 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrilin 4 (MATN4) Antibody |
20-abx212315 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MATN4 Antibody, HRP conjugated |
1-CSB-PA013523LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MATN4 Antibody, FITC conjugated |
1-CSB-PA013523LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MATN4 Antibody, Biotin conjugated |
1-CSB-PA013523LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MATN4. Recognizes MATN4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Matrilin 4 (MATN4) Antibody |
20-abx317011 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MATN4 cloning plasmid |
CSB-CL013523HU1-10ug |
Cusabio |
10ug |
EUR 565 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1623
- Sequence: ATGAGAGGCCTTCTTTGCTGGCCCGTGTTGCTGCTCCTTCTTCAGCCCTGGGAAACCCAGCTCCAGTTGACAGGTCCCAGGTGTCACACTGGGCCCCTGGATCTGGTGTTCGTGATTGACAGCTCCCGCAGCGTGCGCCCTTTCGAGTTCGAGACCATGCGGCAGTTCCTCATGG
- Show more
|
Description: A cloning plasmid for the MATN4 gene. |
MATN4 cloning plasmid |
CSB-CL013523HU2-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1746
- Sequence: ATGAGAGGCCTTCTTTGCTGGCCCGTGTTGCTGCTCCTTCTTCAGCCCTGGGAAACCCAGCTCCAGTTGACAGGTCCCAGGTGTCACACTGGGCCCCTGGATCTGGTGTTCGTGATTGACAGCTCCCGCAGCGTGCGCCCTTTCGAGTTCGAGACCATGCGGCAGTTCCTCATGG
- Show more
|
Description: A cloning plasmid for the MATN4 gene. |
Matrilin 4 (MATN4) Antibody (HRP) |
20-abx317012 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Matrilin 4 (MATN4) Antibody (FITC) |
20-abx317013 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Matrilin 4 (MATN4) Antibody (Biotin) |
20-abx317014 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human MATN4 shRNA Plasmid |
20-abx955786 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse MATN4 shRNA Plasmid |
20-abx971444 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MATN4 Recombinant Protein (Human) |
RP041260 |
ABM |
100 ug |
Ask for price |
MATN4 Recombinant Protein (Human) |
RP041263 |
ABM |
100 ug |
Ask for price |
MATN4 Recombinant Protein (Mouse) |
RP149588 |
ABM |
100 ug |
Ask for price |
MATN4 Recombinant Protein (Mouse) |
RP149591 |
ABM |
100 ug |
Ask for price |
MATN4 Recombinant Protein (Rat) |
RP210965 |
ABM |
100 ug |
Ask for price |
Matn4 ORF Vector (Rat) (pORF) |
ORF070323 |
ABM |
1.0 ug DNA |
EUR 506 |
MATN4 ORF Vector (Human) (pORF) |
ORF013754 |
ABM |
1.0 ug DNA |
EUR 354 |
MATN4 ORF Vector (Human) (pORF) |
ORF013755 |
ABM |
1.0 ug DNA |
EUR 95 |
Matn4 ORF Vector (Mouse) (pORF) |
ORF049864 |
ABM |
1.0 ug DNA |
EUR 506 |
Matn4 ORF Vector (Mouse) (pORF) |
ORF049865 |
ABM |
1.0 ug DNA |
EUR 506 |
Matn4 ELISA Kit (Mouse) (OKBB01397) |
OKBB01397 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Matrilin-4 is a 73 kDa secreted glycoprotein that is a member of the matrilin family of the von Willebrand Factor-A (vWA) domain-containing superfamily. This gene is mapped to 2 H3; 2 85.16 cM. Matrilins are modular extracellular matrix proteins that serve as adaptors and linkers for other matrix proteins. Matrilin-4, like Matrilin‑2, has a broad distribution in both cartilage and in loose connective tissue such as dermis, lung and kidney, while Matrilins 1 and 3 are limited to cartilage. Matrilin-4 is present in nervous tissue and is abundant in the brain. Mature mouse Matrilin-4 shares 98%, 90%, 89% and 66% amino acid (aa) identity with rat, human, canine and chicken Matrilin-4, respectively. The 624 aa mouse Matrilin-4 contains a 22 aa signal sequence, two potential glycosylation sites, and four cysteine-rich EGF-like domains placed between two vWA domains. A short isoform lacks the N-terminal vWA domain (aa 28‑217). A C-terminal alpha -helix/coiled-coil region (aa 590‑623) by which multimers are formed is often proteolytically removed so that Matrilin-4 is found as a mixture of monomers with homo- or hetero- dimers and trimers. Matrilin-4 forms multimers with Matrilins 1 and 2 but not with Matrilin-3. The N-terminal vWA domains of Matrilins associate with collagen IV microfibrils via the proteoglycans biglycan and decorin, linking the fibrils with other matrix constituents aggrecan and collagen II. Matrilins also show calcium-dependent binding to the cartilage oligomeric matrix protein (COMP); this interaction is of high affinity for oligomeric Matrilin-4 and somewhat lower affinity for monomeric Matrilin-4. Functions and distributions of Matrilins overlap enough so that knockouts of Matrilins 1, 2 and 3 lack obvious phenotypes.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml |
Matn4 ELISA Kit (Rat) (OKBB01398) |
OKBB01398 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Matrilin-4 is a 73 kDa secreted glycoprotein that is a member of the matrilin family of the von Willebrand Factor-A (vWA) domain-containing superfamily. This gene is mapped to 3q42. Matrilins are modular extracellular matrix proteins that serve as adaptors and linkers for other matrix proteins. Matrilin-4, like Matrilin‑2, has a broad distribution in both cartilage and in loose connective tissue such as dermis, lung and kidney, while Matrilins 1 and 3 are limited to cartilage. Matrilin-4 is present in nervous tissue and is abundant in the brain. Mature mouse Matrilin-4 shares 98%, 90%, 89% and 66% amino acid (aa) identity with rat, human, canine and chicken Matrilin-4, respectively. The 624 aa mouse Matrilin-4 contains a 22 aa signal sequence, two potential glycosylation sites, and four cysteine-rich EGF-like domains placed between two vWA domains. A short isoform lacks the N-terminal vWA domain (aa 28‑217). A C-terminal alpha -helix/coiled-coil region (aa 590‑623) by which multimers are formed is often proteolytically removed so that Matrilin-4 is found as a mixture of monomers with homo- or hetero- dimers and trimers. Matrilin-4 forms multimers with Matrilins 1 and 2 but not with Matrilin-3. The N-terminal vWA domains of Matrilins associate with collagen IV microfibrils via the proteoglycans biglycan and decorin, linking the fibrils with other matrix constituents aggrecan and collagen II. Matrilins also show calcium-dependent binding to the cartilage oligomeric matrix protein (COMP); this interaction is of high affinity for oligomeric Matrilin-4 and somewhat lower affinity for monomeric Matrilin-4. Functions and distributions of Matrilins overlap enough so that knockouts of Matrilins 1, 2 and 3 lack obvious phenotypes.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml |
Rat Matrilin 4 (MATN4) ELISA Kit |
20-abx258933 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Matrilin 4 (MATN4) CLIA Kit |
20-abx496521 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Matn4 sgRNA CRISPR Lentivector set (Rat) |
K6374101 |
ABM |
3 x 1.0 ug |
EUR 339 |
MATN4 sgRNA CRISPR Lentivector set (Human) |
K1273401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Matn4 sgRNA CRISPR Lentivector set (Mouse) |
K3389901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rat Matrilin 4 (MATN4) ELISA Kit |
SEE147Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Matrilin 4 (MATN4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Matrilin 4 (MATN4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Rat Matrilin 4 (MATN4) ELISA Kit |
SEE147Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Matrilin 4 (MATN4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Matrilin 4 (MATN4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Rat Matrilin 4 (MATN4) ELISA Kit |
SEE147Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Matrilin 4 (MATN4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Matrilin 4 (MATN4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Rat Matrilin 4 (MATN4) ELISA Kit |
SEE147Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Matrilin 4 (MATN4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Matrilin 4 (MATN4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Rat Matrilin 4 (MATN4) ELISA Kit |
4-SEE147Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Matrilin 4 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Matrilin 4 (MATN4) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Matrilin 4 ELISA Kit (MATN4) |
RK03804 |
Abclonal |
96 Tests |
EUR 521 |
ELISA kit for Rat MATN4 (Matrilin 4) |
ELK7801 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Matrilin 4 (MATN4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Matrilin 4 (MAT
- Show more
|
Description: A sandwich ELISA kit for detection of Matrilin 4 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Matn4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6374102 |
ABM |
1.0 ug DNA |
EUR 154 |
Matn4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6374103 |
ABM |
1.0 ug DNA |
EUR 154 |
Matn4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6374104 |
ABM |
1.0 ug DNA |
EUR 154 |
MATN4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1273402 |
ABM |
1.0 ug DNA |
EUR 154 |
MATN4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1273403 |
ABM |
1.0 ug DNA |
EUR 154 |
MATN4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1273404 |
ABM |
1.0 ug DNA |
EUR 154 |
Matn4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3389902 |
ABM |
1.0 ug DNA |
EUR 154 |
Matn4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3389903 |
ABM |
1.0 ug DNA |
EUR 154 |
Matn4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3389904 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Mouse Matrilin-4 (MATN4) |
KTE71111-48T |
Abbkine |
48T |
EUR 332 |
- MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrilin-4 (MATN4) |
KTE71111-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrilin-4 (MATN4) |
KTE71111-96T |
Abbkine |
96T |
EUR 539 |
- MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrilin-4 (MATN4) |
KTE61709-48T |
Abbkine |
48T |
EUR 332 |
- MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrilin-4 (MATN4) |
KTE61709-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrilin-4 (MATN4) |
KTE61709-96T |
Abbkine |
96T |
EUR 539 |
- MATN4 encodes a member of von Willebrand factor A domain containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. The specific functi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrilin-4 (MATN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
MATN4 Protein Vector (Rat) (pPB-C-His) |
PV281290 |
ABM |
500 ng |
EUR 603 |
MATN4 Protein Vector (Rat) (pPB-N-His) |
PV281291 |
ABM |
500 ng |
EUR 603 |
MATN4 Protein Vector (Rat) (pPM-C-HA) |
PV281292 |
ABM |
500 ng |
EUR 603 |
MATN4 Protein Vector (Rat) (pPM-C-His) |
PV281293 |
ABM |
500 ng |
EUR 603 |
MATN4 Protein Vector (Mouse) (pPB-C-His) |
PV199454 |
ABM |
500 ng |
EUR 1065 |
MATN4 Rabbit Polyclonal Antibody