MEP1A Rabbit Polyclonal Antibody

MEP1A Polyclonal Antibody
ES11358-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEP1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MEP1A Polyclonal Antibody
ABP59261-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human MEP1A protein at amino acid sequence of 110-190 Applications tips:
Description: A polyclonal antibody for detection of MEP1A from Human, Mouse, Rat. This MEP1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MEP1A protein at amino acid sequence of 110-190

MEP1A Polyclonal Antibody
ABP59261-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human MEP1A protein at amino acid sequence of 110-190 Applications tips:
Description: A polyclonal antibody for detection of MEP1A from Human, Mouse, Rat. This MEP1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MEP1A protein at amino acid sequence of 110-190

MEP1A Polyclonal Antibody
ABP59261-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MEP1A protein at amino acid sequence of 110-190 Applications tips:
Description: A polyclonal antibody for detection of MEP1A from Human, Mouse, Rat. This MEP1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MEP1A protein at amino acid sequence of 110-190

Human Meprin A Alpha (MEP1a) ELISA Kit
DLR-MEP1a-Hu-48T	DL Develop	48T	EUR 479
Should the Human Meprin A Alpha (MEP1a) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Meprin A Alpha (MEP1a) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Meprin A Alpha (MEP1a) ELISA Kit
DLR-MEP1a-Hu-96T	DL Develop	96T	EUR 621
Should the Human Meprin A Alpha (MEP1a) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Meprin A Alpha (MEP1a) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Meprin A Alpha (MEP1a) ELISA Kit
RD-MEP1a-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Meprin A Alpha (MEP1a) ELISA Kit
RD-MEP1a-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Human Meprin A Alpha (MEP1a) ELISA Kit
RDR-MEP1a-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Meprin A Alpha (MEP1a) ELISA Kit
RDR-MEP1a-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

MEP1A Rabbit pAb
A8133-100ul	Abclonal	100 ul	EUR 308

MEP1A Rabbit pAb
A8133-200ul	Abclonal	200 ul	EUR 459

MEP1A Rabbit pAb
A8133-20ul	Abclonal	20 ul	EUR 183

MEP1A Rabbit pAb
A8133-50ul	Abclonal	50 ul	EUR 223

MEP1A Antibody
40314-100ul	SAB	100ul	EUR 252

MEP1A Antibody
1-CSB-PA620984ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MEP1A. Recognizes MEP1A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MEP1A Antibody
1-CSB-PA047131	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MEP1A. Recognizes MEP1A from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

Polyclonal MEP1A Antibody (N-term)
APR05684G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MEP1A (N-term). This antibody is tested and proven to work in the following applications:

MEP1A Conjugated Antibody
C40314	SAB	100ul	EUR 397

anti- MEP1A antibody
FNab05125	FN Test	100µg	EUR 585
Immunogen: meprin A, alpha(PABA peptide hydrolase) Uniprot ID: Q16819 Gene ID: 4224 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against MEP1A

Anti-MEP1A antibody
PAab05125	Lifescience Market	100 ug	EUR 412

Anti-MEP1A antibody
STJ110432	St John's Laboratory	100 µl	EUR 277

Anti-MEP1A antibody
STJ192516	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MEP1A

Meprin A Alpha (MEP1a) Polyclonal Antibody (Mouse)
4-PAA171Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MEP1a (Asn219~Gly463) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Meprin A Alpha (MEP1a)

MEP1A siRNA
20-abx903219	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MEP1A siRNA
20-abx923932	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MEP1A siRNA
20-abx923933	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Meprin A Alpha (MEP1a) Polyclonal Antibody (Mouse), APC
4-PAA171Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MEP1a (Asn219~Gly463) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Meprin A Alpha (MEP1a). This antibody is labeled with APC.

Meprin A Alpha (MEP1a) Polyclonal Antibody (Mouse), Biotinylated
4-PAA171Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MEP1a (Asn219~Gly463) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Meprin A Alpha (MEP1a). This antibody is labeled with Biotin.

Meprin A Alpha (MEP1a) Polyclonal Antibody (Mouse), Cy3
4-PAA171Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MEP1a (Asn219~Gly463) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Meprin A Alpha (MEP1a). This antibody is labeled with Cy3.

Meprin A Alpha (MEP1a) Polyclonal Antibody (Mouse), FITC
4-PAA171Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MEP1a (Asn219~Gly463) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Meprin A Alpha (MEP1a). This antibody is labeled with FITC.

Meprin A Alpha (MEP1a) Polyclonal Antibody (Mouse), HRP
4-PAA171Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MEP1a (Asn219~Gly463) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Meprin A Alpha (MEP1a). This antibody is labeled with HRP.

Meprin A Alpha (MEP1a) Polyclonal Antibody (Mouse), PE
4-PAA171Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MEP1a (Asn219~Gly463) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Meprin A Alpha (MEP1a). This antibody is labeled with PE.

MEP1A cloning plasmid
CSB-CL620984HU-10ug	Cusabio	10ug	EUR 737
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2241 Sequence: ATGGCTTGGATTAGATCCACTTGCATTCTCTTTTTTACCTTGCTTTTTGCCCACATAGCAGCTGTACCGATTAAGTATCTTCCTGAAGAAAATGTACATGATGCAGATTTTGGTGAACAGAAGGATATTTCAGAAATCAATTTAGCTGCAGGCTTGGACCTCTTTCAAGGGGACA Show more
Description: A cloning plasmid for the MEP1A gene.

Meprin A Alpha (MEP1a) Antibody
20-abx101342	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Meprin A Alpha (MEP1a) Antibody
20-abx101343	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Meprin A Alpha (MEP1a) Antibody
20-abx173538	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Meprin A Alpha (MEP1a) Antibody
20-abx177529	Abbexa	EUR 1135.00 EUR 551.00	1 mg 200 ug
Please enquire.

Meprin A Alpha (MEP1a) Antibody
20-abx177530	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Meprin A Alpha (MEP1a) Polyclonal Antibody (Human, Mouse, Rat)
4-PAA171Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MEP1a (His213~Val506) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Meprin A Alpha (MEP1a)

Meprin A Alpha (MEP1a) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA171Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MEP1a (Asn219~Gly463) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Meprin A Alpha (MEP1a). This antibody is labeled with APC-Cy7.

Meprin A Alpha (MEP1a) Polyclonal Antibody (Human, Mouse, Rat), APC
4-PAA171Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MEP1a (His213~Val506) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Meprin A Alpha (MEP1a). This antibody is labeled with APC.

Meprin A Alpha (MEP1a) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated
4-PAA171Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MEP1a (His213~Val506) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Meprin A Alpha (MEP1a). This antibody is labeled with Biotin.

Meprin A Alpha (MEP1a) Polyclonal Antibody (Human, Mouse, Rat), Cy3
4-PAA171Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MEP1a (His213~Val506) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Meprin A Alpha (MEP1a). This antibody is labeled with Cy3.

Meprin A Alpha (MEP1a) Polyclonal Antibody (Human, Mouse, Rat), FITC
4-PAA171Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MEP1a (His213~Val506) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Meprin A Alpha (MEP1a). This antibody is labeled with FITC.

Meprin A Alpha (MEP1a) Polyclonal Antibody (Human, Mouse, Rat), HRP
4-PAA171Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MEP1a (His213~Val506) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Meprin A Alpha (MEP1a). This antibody is labeled with HRP.

Meprin A Alpha (MEP1a) Polyclonal Antibody (Human, Mouse, Rat), PE
4-PAA171Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MEP1a (His213~Val506) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Meprin A Alpha (MEP1a). This antibody is labeled with PE.

Rat MEP1A shRNA Plasmid
20-abx985220	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human MEP1A ELISA Kit
ELA-E2226h	Lifescience Market	96 Tests	EUR 824

MEP1A ELISA KIT|Human
EF006243	Lifescience Market	96 Tests	EUR 689

Human MEP1A shRNA Plasmid
20-abx952873	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MEP1A shRNA Plasmid
20-abx971494	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MEP1A Recombinant Protein (Human)
RP041299	ABM	100 ug	Ask for price

MEP1A Recombinant Protein (Rat)
RP211382	ABM	100 ug	Ask for price

MEP1A Recombinant Protein (Mouse)
RP150224	ABM	100 ug	Ask for price

Meprin A Alpha (MEP1a) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7
4-PAA171Hu01-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MEP1a (His213~Val506) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Meprin A Alpha (MEP1a). This antibody is labeled with APC-Cy7.

Mep1a ORF Vector (Mouse) (pORF)
ORF050076	ABM	1.0 ug DNA	EUR 506

MEP1A ORF Vector (Human) (pORF)
ORF013767	ABM	1.0 ug DNA	EUR 354

Mep1a ORF Vector (Rat) (pORF)
ORF070462	ABM	1.0 ug DNA	EUR 506

Recombinant Meprin A Alpha (MEP1a)
4-RPA171Hu01	Cloud-Clone	EUR 583.84 EUR 259.00 EUR 1914.40 EUR 704.80 EUR 1309.60 EUR 454.00 EUR 4636.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q16819 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 37.1kDa Isoelectric Point: 6.4
Description: Recombinant Human Meprin A Alpha expressed in: E.coli

Recombinant Meprin A Alpha (MEP1a)
4-RPA171Mu01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P28825 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.4kDa Isoelectric Point: 6.9
Description: Recombinant Mouse Meprin A Alpha expressed in: E.coli

Meprin A, Alpha/PABA Peptide Hydrolase (MEP1A) Antibody
abx145434-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Meprin A, Alpha/PABA Peptide Hydrolase (MEP1A) Antibody
abx032644-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Meprin A, Alpha/PABA Peptide Hydrolase (MEP1A) Antibody
abx032644-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Meprin A, Alpha/PABA Peptide Hydrolase (MEP1A) Antibody
20-abx005700	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Meprin A, Alpha/PABA Peptide Hydrolase (MEP1A) Antibody
20-abx320474	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Meprin A, alpha/PABA Peptide Hydrolase (MEP1A) Antibody
20-abx242495	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Meprin A, Alpha/PABA Peptide Hydrolase (MEP1A) Antibody
abx235125-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Meprin A, Alpha/PABA Peptide Hydrolase (MEP1A) Antibody
20-abx225290	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

ELISA kit for Mouse Meprinalpha/MEP1A
EK5788	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Meprinalpha/MEP1A in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Meprin A Alpha (MEP1a) Protein
20-abx067992	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Meprin A Alpha (MEP1a) Protein
20-abx067994	Abbexa	EUR 815.00 EUR 314.00 EUR 2569.00 EUR 968.00 EUR 565.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

MEP1A sgRNA CRISPR Lentivector set (Human)
K1290601	ABM	3 x 1.0 ug	EUR 339

Mep1a sgRNA CRISPR Lentivector set (Mouse)
K3422701	ABM	3 x 1.0 ug	EUR 339

OVA conjugated Meprin A Alpha (MEP1a)
4-CPA171Mu21	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P28825 Buffer composition: PBS, pH 7.4. Form: Freeze-dried powder Predicted Molecular Mass (KD): Inquire Isoelectric Point: Inquire
Description: Recombinant Mouse Meprin A Alpha expressed in: Protein conjugation

Mep1a sgRNA CRISPR Lentivector set (Rat)
K6774501	ABM	3 x 1.0 ug	EUR 339

Human Meprin A Alpha (MEP1a) ELISA Kit
4-CEA171Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Meprin A Alpha elisa. Alternative names of the recognized antigen: PPHA PABA Peptide Hydrolase Endopeptidase-2 N-benzoyl-L-tyrosyl-P-amino-Benzoic Acid Hydrolase Subunit Alpha PABA Peptide Hydrolase
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Meprin A Alpha (MEP1a) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Meprin A Alpha (MEP1a) ELISA Kit
CEA171Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4391.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Meprin A Alpha (MEP1a) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Meprin A Alpha (MEP1a) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Meprin A Alpha (MEP1a) ELISA Kit
CEA171Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 449.27
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Meprin A Alpha (MEP1a) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Meprin A Alpha (MEP1a) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Meprin A Alpha (MEP1a) ELISA Kit
CEA171Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 598.96
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Meprin A Alpha (MEP1a) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Meprin A Alpha (MEP1a) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Meprin A Alpha (MEP1a) ELISA Kit
CEA171Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2395.32
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Meprin A Alpha (MEP1a) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Meprin A Alpha (MEP1a) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Meprin A Alpha (MEP1a) ELISA Kit
4-CEA171Mu	Cloud-Clone	EUR 4442.00 EUR 2346.00 EUR 599.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Meprin A Alpha elisa. Alternative names of the recognized antigen: PPHA PABA Peptide Hydrolase Endopeptidase-2 N-benzoyl-L-tyrosyl-P-amino-Benzoic Acid Hydrolase Subunit Alpha PABA Peptide Hydrolase
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Mouse Meprin A Alpha (MEP1a) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Meprin A Alpha (MEP1a) ELISA Kit
CEA171Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4626.78
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Meprin A Alpha (MEP1a) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Meprin A Alpha (MEP1a) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Meprin A Alpha (MEP1a) ELISA Kit
CEA171Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 468.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Meprin A Alpha (MEP1a) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Meprin A Alpha (MEP1a) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Meprin A Alpha (MEP1a) ELISA Kit
CEA171Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 626.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Meprin A Alpha (MEP1a) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Meprin A Alpha (MEP1a) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Meprin A Alpha (MEP1a) ELISA Kit
CEA171Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2520.06
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Meprin A Alpha (MEP1a) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Meprin A Alpha (MEP1a) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Meprin A Alpha (MEP1a) ELISA Kit
4-CEA171Ra	Cloud-Clone	EUR 4677.00 EUR 2471.00 EUR 627.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Meprin A Alpha elisa. Alternative names of the recognized antigen: PPHA PABA Peptide Hydrolase Endopeptidase-2 N-benzoyl-L-tyrosyl-P-amino-Benzoic Acid Hydrolase Subunit Alpha PABA Peptide Hydrolase
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Meprin A Alpha (MEP1a) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Meprin A Alpha (MEP1a) ELISA Kit
CEA171Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Meprin A Alpha (MEP1a) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Meprin A Alpha (MEP1a) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Meprin A Alpha (MEP1a) ELISA Kit
CEA171Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Meprin A Alpha (MEP1a) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Meprin A Alpha (MEP1a) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Meprin A Alpha (MEP1a) ELISA Kit
CEA171Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Meprin A Alpha (MEP1a) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Meprin A Alpha (MEP1a) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Meprin A Alpha (MEP1a) ELISA Kit
CEA171Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Meprin A Alpha (MEP1a) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Meprin A Alpha (MEP1a) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Meprin A Alpha (MEP1a) ELISA Kit
20-abx258936	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Meprin A Alpha (MEP1a) CLIA Kit
20-abx490585	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 20 working days.

MEP1A sgRNA CRISPR Lentivector (Human) (Target 1)
K1290602	ABM	1.0 ug DNA	EUR 154

MEP1A Rabbit Polyclonal Antibody