MFAP5 Rabbit Polyclonal Antibody

MFAP5 Rabbit Polyclonal Antibody

MFAP5 Polyclonal Antibody
ABP59265-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human MFAP5 protein at amino acid sequence of 10-90 Applications tips:
Description: A polyclonal antibody for detection of MFAP5 from Human, Mouse. This MFAP5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MFAP5 protein at amino acid sequence of 10-90

MFAP5 Polyclonal Antibody
ABP59265-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human MFAP5 protein at amino acid sequence of 10-90 Applications tips:
Description: A polyclonal antibody for detection of MFAP5 from Human, Mouse. This MFAP5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MFAP5 protein at amino acid sequence of 10-90

MFAP5 Polyclonal Antibody
ABP59265-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MFAP5 protein at amino acid sequence of 10-90 Applications tips:
Description: A polyclonal antibody for detection of MFAP5 from Human, Mouse. This MFAP5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MFAP5 protein at amino acid sequence of 10-90

MFAP5 Polyclonal Antibody
A56134	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

MFAP5 Antibody
37713-100ul	SAB	100ul	EUR 252

MFAP5 antibody
70R-18492	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal MFAP5 antibody

MFAP5 Antibody
DF13146	Affbiotech	200ul	EUR 304
Description: MFAP5 Antibody detects endogenous levels of MFAP5.

MFAP5 Antibody
DF12539	Affbiotech	200ul	EUR 304
Description: MFAP5 Antibody detects endogenous levels of MFAP5.

MFAP5 Antibody
1-CSB-PA013750GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MFAP5 Antibody
1-CSB-PA623799LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MFAP5 Antibody
1-CSB-PA701502	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

MFAP5 Polyclonal Antibody, HRP Conjugated
A56135	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

MFAP5 Polyclonal Antibody, FITC Conjugated
A56136	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

MFAP5 Polyclonal Antibody, Biotin Conjugated
A56137	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

MFAP5 Conjugated Antibody
C37713	SAB	100ul	EUR 397

anti- MFAP5 antibody
FNab05147	FN Test	100µg	EUR 548.75
Immunogen: microfibrillar associated protein 5 Uniprot ID: Q13361 Gene ID: 8076 Research Area: Immunology, Cardiovascular
Description: Antibody raised against MFAP5

Anti-MFAP5 antibody
PAab05147	Lifescience Market	100 ug	EUR 386

Anti-MFAP5 antibody
STJ192486	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MFAP5

MFAP5 siRNA
20-abx924031	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MFAP5 siRNA
20-abx924032	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MFAP5 Antibody, HRP conjugated
1-CSB-PA623799LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MFAP5 Antibody, FITC conjugated
1-CSB-PA623799LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MFAP5 Antibody, Biotin conjugated
1-CSB-PA623799LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse)
4-PAF590Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Gly25~Pro152) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5)

MFAP5 Blocking Peptide
DF13146-BP	Affbiotech	1mg	EUR 195

MFAP5 Blocking Peptide
DF12539-BP	Affbiotech	1mg	EUR 195

MFAP5 cloning plasmid
CSB-CL623799HU-10ug	Cusabio	10ug	EUR 255
Formulation: 10 μg plasmid + 200μl Glycerol Length: 522 Sequence: atgtcgctcttgggacccaaggtgctgctgtttcttgctgcattcatcatcacctctgactggatacccctgggggtcaatagtcaacgaggagacgatgtgactcaagcgactccagaaacattcacagaagatcctaatctggtgaatgatcccgctacagatgaaacagtttt Show more
Description: A cloning plasmid for the MFAP5 gene.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat)
4-PAF590Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Leu24~Cys162) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5)

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), APC
4-PAF590Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Gly25~Pro152) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), Biotinylated
4-PAF590Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Gly25~Pro152) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Biotin.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), Cy3
4-PAF590Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Gly25~Pro152) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Cy3.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), FITC
4-PAF590Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Gly25~Pro152) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with FITC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), HRP
4-PAF590Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Gly25~Pro152) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with HRP.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), PE
4-PAF590Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Gly25~Pro152) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with PE.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat)
4-PAF590Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Asp32~Asp164) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5)

Microfibrillar Associated Protein 5 (MFAP5) Antibody
20-abx113733	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody
20-abx109326	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody
abx122837-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody
20-abx103845	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody
20-abx103846	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody
20-abx103847	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody
abx235147-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody
20-abx210999	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Mouse MFAP5 shRNA Plasmid
20-abx974089	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human MFAP5 ELISA Kit
ELA-E11955h	Lifescience Market	96 Tests	EUR 824

MFAP5 ELISA KIT|Human
EF004275	Lifescience Market	96 Tests	EUR 689

Human MFAP5 shRNA Plasmid
20-abx955358	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MFAP5 Recombinant Protein (Human)
RP019240	ABM	100 ug	Ask for price

MFAP5 Recombinant Protein (Rat)
RP211505	ABM	100 ug	Ask for price

MFAP5 Recombinant Protein (Mouse)
RP150392	ABM	100 ug	Ask for price

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), APC
4-PAF590Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Leu24~Cys162) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAF590Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Leu24~Cys162) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Biotin.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), Cy3
4-PAF590Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Leu24~Cys162) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Cy3.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), FITC
4-PAF590Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Leu24~Cys162) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with FITC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), HRP
4-PAF590Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Leu24~Cys162) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with HRP.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), PE
4-PAF590Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Leu24~Cys162) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with PE.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), APC-Cy7
4-PAF590Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Gly25~Pro152) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC-Cy7.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), APC
4-PAF590Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Asp32~Asp164) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAF590Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Asp32~Asp164) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Biotin.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), Cy3
4-PAF590Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Asp32~Asp164) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Cy3.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), FITC
4-PAF590Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Asp32~Asp164) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with FITC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), HRP
4-PAF590Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Asp32~Asp164) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with HRP.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), PE
4-PAF590Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Asp32~Asp164) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with PE.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAF590Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MFAP5 (Leu24~Cys162) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC-Cy7.

MFAP5 Rabbit Polyclonal Antibody