CelltaGen
셀타젠 Genetic Genotyping

MICA Rabbit Polyclonal Antibody

MICA Polyclonal Antibody

ABP59274-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MICA protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MICA from Human. This MICA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MICA protein at amino acid sequence of 30-110

MICA Rabbit pAb

A12622-100ul 100 ul
EUR 308

MICA Rabbit pAb

A12622-200ul 200 ul
EUR 459

MICA Rabbit pAb

A12622-20ul 20 ul
EUR 183

MICA Rabbit pAb

A12622-50ul 50 ul
EUR 223

MICA Rabbit pAb

A1390-100ul 100 ul
EUR 308

MICA Rabbit pAb

A1390-200ul 200 ul
EUR 459

MICA Rabbit pAb

A1390-20ul 20 ul
EUR 183

MICA Rabbit pAb

A1390-50ul 50 ul
EUR 223

Polyclonal MICA Antibody (Center)

APR06106G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MICA (Center). This antibody is tested and proven to work in the following applications:

MICA antibody

70R-6091 50 ug
EUR 467
Description: Rabbit polyclonal MICA antibody raised against the N terminal of MICA

MICA Antibody

ABD6403 100 ug
EUR 438

MICA antibody

38237-100ul 100ul
EUR 252

MICA antibody

10R-6540 100 ug
EUR 208
Description: Mouse monoclonal MICA antibody

MICA Antibody

24546-100ul 100ul
EUR 390

MICA antibody

70R-1705 100 ug
EUR 377
Description: Rabbit polyclonal MICA antibody raised against the middle region of MICA

MICA antibody

70R-18509 50 ul
EUR 435
Description: Rabbit polyclonal MICA antibody

MICA Antibody

DF6403 200ul
EUR 304
Description: MICA Antibody detects endogenous levels of total MICA.

MICA Antibody

1-CSB-PA013806ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MICA. Recognizes MICA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

MICA Antibody

1-CSB-PA013806ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MICA. Recognizes MICA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MICA Antibody

1-CSB-PA013806GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MICA. Recognizes MICA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal MICA Antibody (C-Terminus)

APR02372G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MICA (C-Terminus). This antibody is tested and proven to work in the following applications:

MICA Conjugated Antibody

C38237 100ul
EUR 397

anti- MICA antibody

FNab05176 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: MHC class I polypeptide-related sequence A
  • Uniprot ID: Q29983
  • Gene ID: 100507436
  • Research Area: Immunology
Description: Antibody raised against MICA

Anti-MICA Antibody

PB9612 100ug/vial
EUR 294

Anti-MICA antibody

PAab05176 100 ug
EUR 412

Anti-MICA antibody

STJ24550 100 µl
EUR 277
Description: This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants.

Anti-MICA antibody

STJ114496 100 µl
EUR 277
Description: This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants.

Anti-MICA antibody

STJ192332 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MICA

MICA siRNA

20-abx924137
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-MICA

YF-PA13161 50 ug
EUR 363
Description: Mouse polyclonal to MICA

anti-MICA

YF-PA13162 100 ug
EUR 403
Description: Rabbit polyclonal to MICA

MICA cloning plasmid

CSB-CL013806HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1152
  • Sequence: atggggctgggcccggtcttcctgcttctggctggcatcttcccttttgcacctccgggagctgctgctgagccccacagtcttcgttataacctcacggtgctgtcctgggatggatctgtgcagtcagggtttctcactgaggtacatctggatggtcagcccttcctgcgct
  • Show more
Description: A cloning plasmid for the MICA gene.

MICA Blocking Peptide

33R-5029 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MICA antibody, catalog no. 70R-6091

MICA Blocking Peptide

33R-5386 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MICA antibody, catalog no. 70R-1705

MICA Blocking Peptide

DF6403-BP 1mg
EUR 195

pDONR223-MICA Plasmid

PVTB00776 2 ug
EUR 356

pCMV-SPORT6-MICA

PVT13890 2 ug
EUR 391

Human MICA ELISA Kit

ELA-E1845h 96 Tests
EUR 824

MICA ELISA KIT|Human

EF000010 96 Tests
EUR 689

MICA Rabbit Polyclonal Antibody