CelltaGen
셀타젠 Genetic Genotyping

MICA Rabbit Polyclonal Antibody

MICA Polyclonal Antibody

ES11174-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MICA from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MICA Rabbit pAb

A1390-100ul 100 ul
EUR 308

MICA Rabbit pAb

A1390-200ul 200 ul
EUR 459

MICA Rabbit pAb

A1390-20ul 20 ul
EUR 183

MICA Rabbit pAb

A1390-50ul 50 ul
EUR 223

MICA Rabbit pAb

A12622-100ul 100 ul
EUR 308

MICA Rabbit pAb

A12622-200ul 200 ul
EUR 459

MICA Rabbit pAb

A12622-20ul 20 ul
EUR 183

MICA Rabbit pAb

A12622-50ul 50 ul
EUR 223

Polyclonal MICA Antibody (Center)

APR06106G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MICA (Center). This antibody is tested and proven to work in the following applications:

MICA Antibody

24546-100ul 100ul
EUR 390

MICA antibody

70R-1705 100 ug
EUR 377
Description: Rabbit polyclonal MICA antibody raised against the middle region of MICA

MICA antibody

70R-18509 50 ul
EUR 435
Description: Rabbit polyclonal MICA antibody

MICA antibody

38237-100ul 100ul
EUR 252

MICA antibody

10R-6540 100 ug
EUR 208
Description: Mouse monoclonal MICA antibody

MICA Antibody

DF6403 200ul
EUR 304
Description: MICA Antibody detects endogenous levels of total MICA.

MICA Antibody

1-CSB-PA013806ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MICA. Recognizes MICA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

MICA Antibody

1-CSB-PA013806ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MICA. Recognizes MICA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MICA Antibody

1-CSB-PA013806GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MICA. Recognizes MICA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MICA antibody

70R-6091 50 ug
EUR 467
Description: Rabbit polyclonal MICA antibody raised against the N terminal of MICA

MICA Antibody

ABD6403 100 ug
EUR 438

Polyclonal MICA Antibody (C-Terminus)

APR02372G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MICA (C-Terminus). This antibody is tested and proven to work in the following applications:

MICA Conjugated Antibody

C38237 100ul
EUR 397

anti- MICA antibody

FNab05176 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: MHC class I polypeptide-related sequence A
  • Uniprot ID: Q29983
  • Gene ID: 100507436
  • Research Area: Immunology
Description: Antibody raised against MICA

Anti-MICA antibody

PAab05176 100 ug
EUR 412

Anti-MICA Antibody

PB9612 100ug/vial
EUR 294

Anti-MICA antibody

STJ24550 100 µl
EUR 277
Description: This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants.

Anti-MICA antibody

STJ114496 100 µl
EUR 277
Description: This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants.

Anti-MICA antibody

STJ192332 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MICA

MICA siRNA

20-abx924137
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-MICA

YF-PA13161 50 ug
EUR 363
Description: Mouse polyclonal to MICA

anti-MICA

YF-PA13162 100 ug
EUR 403
Description: Rabbit polyclonal to MICA

MICA Blocking Peptide

33R-5029 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MICA antibody, catalog no. 70R-6091

MICA Blocking Peptide

33R-5386 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MICA antibody, catalog no. 70R-1705

MICA Blocking Peptide

DF6403-BP 1mg
EUR 195

MICA cloning plasmid

CSB-CL013806HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1152
  • Sequence: atggggctgggcccggtcttcctgcttctggctggcatcttcccttttgcacctccgggagctgctgctgagccccacagtcttcgttataacctcacggtgctgtcctgggatggatctgtgcagtcagggtttctcactgaggtacatctggatggtcagcccttcctgcgct
  • Show more
Description: A cloning plasmid for the MICA gene.

pDONR223-MICA Plasmid

PVTB00776 2 ug
EUR 356

pCMV-SPORT6-MICA

PVT13890 2 ug
EUR 391

Anti-MICA/MICB Purified

11-822-C100 0.1 mg
EUR 195

Anti-MICA/MICB APC

1A-822-C100 0.1 mg
EUR 331

MICA Rabbit Polyclonal Antibody