MICA Rabbit Polyclonal Antibody
MICA Polyclonal Antibody |
ABP59274-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MICA protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of MICA from Human. This MICA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MICA protein at amino acid sequence of 30-110 |
MICA Rabbit pAb |
A12622-100ul |
Abclonal |
100 ul |
EUR 308 |
MICA Rabbit pAb |
A12622-200ul |
Abclonal |
200 ul |
EUR 459 |
MICA Rabbit pAb |
A12622-20ul |
Abclonal |
20 ul |
EUR 183 |
MICA Rabbit pAb |
A12622-50ul |
Abclonal |
50 ul |
EUR 223 |
MICA Rabbit pAb |
A1390-100ul |
Abclonal |
100 ul |
EUR 308 |
MICA Rabbit pAb |
A1390-200ul |
Abclonal |
200 ul |
EUR 459 |
MICA Rabbit pAb |
A1390-20ul |
Abclonal |
20 ul |
EUR 183 |
MICA Rabbit pAb |
A1390-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal MICA Antibody (Center) |
APR06106G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MICA (Center). This antibody is tested and proven to work in the following applications: |
MICA antibody |
70R-6091 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal MICA antibody raised against the N terminal of MICA |
MICA antibody |
38237-100ul |
SAB |
100ul |
EUR 252 |
MICA antibody |
10R-6540 |
Fitzgerald |
100 ug |
EUR 208 |
Description: Mouse monoclonal MICA antibody |
MICA Antibody |
24546-100ul |
SAB |
100ul |
EUR 390 |
MICA antibody |
70R-1705 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal MICA antibody raised against the middle region of MICA |
MICA antibody |
70R-18509 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MICA antibody |
MICA Antibody |
DF6403 |
Affbiotech |
200ul |
EUR 304 |
Description: MICA Antibody detects endogenous levels of total MICA. |
MICA Antibody |
1-CSB-PA013806ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MICA. Recognizes MICA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200 |
MICA Antibody |
1-CSB-PA013806ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MICA. Recognizes MICA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
MICA Antibody |
1-CSB-PA013806GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against MICA. Recognizes MICA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal MICA Antibody (C-Terminus) |
APR02372G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MICA (C-Terminus). This antibody is tested and proven to work in the following applications: |
MICA Conjugated Antibody |
C38237 |
SAB |
100ul |
EUR 397 |
anti- MICA antibody |
FNab05176 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: MHC class I polypeptide-related sequence A
- Uniprot ID: Q29983
- Gene ID: 100507436
- Research Area: Immunology
|
Description: Antibody raised against MICA |
Anti-MICA Antibody |
PB9612 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-MICA antibody |
STJ24550 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants. |
Anti-MICA antibody |
STJ114496 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants. |
Anti-MICA antibody |
STJ192332 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MICA |
MICA siRNA |
20-abx924137 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-MICA |
YF-PA13161 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to MICA |
anti-MICA |
YF-PA13162 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to MICA |
MICA cloning plasmid |
CSB-CL013806HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1152
- Sequence: atggggctgggcccggtcttcctgcttctggctggcatcttcccttttgcacctccgggagctgctgctgagccccacagtcttcgttataacctcacggtgctgtcctgggatggatctgtgcagtcagggtttctcactgaggtacatctggatggtcagcccttcctgcgct
- Show more
|
Description: A cloning plasmid for the MICA gene. |
MICA Blocking Peptide |
33R-5029 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MICA antibody, catalog no. 70R-6091 |
MICA Blocking Peptide |
33R-5386 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MICA antibody, catalog no. 70R-1705 |
MICA Blocking Peptide |
DF6403-BP |
Affbiotech |
1mg |
EUR 195 |
MICA Rabbit Polyclonal Antibody