MICA Rabbit Polyclonal Antibody
MICA Polyclonal Antibody |
ES11174-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MICA from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MICA Rabbit pAb |
A1390-100ul |
Abclonal |
100 ul |
EUR 308 |
MICA Rabbit pAb |
A1390-200ul |
Abclonal |
200 ul |
EUR 459 |
MICA Rabbit pAb |
A1390-20ul |
Abclonal |
20 ul |
EUR 183 |
MICA Rabbit pAb |
A1390-50ul |
Abclonal |
50 ul |
EUR 223 |
MICA Rabbit pAb |
A12622-100ul |
Abclonal |
100 ul |
EUR 308 |
MICA Rabbit pAb |
A12622-200ul |
Abclonal |
200 ul |
EUR 459 |
MICA Rabbit pAb |
A12622-20ul |
Abclonal |
20 ul |
EUR 183 |
MICA Rabbit pAb |
A12622-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal MICA Antibody (Center) |
APR06106G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MICA (Center). This antibody is tested and proven to work in the following applications: |
MICA Antibody |
24546-100ul |
SAB |
100ul |
EUR 390 |
MICA antibody |
70R-1705 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal MICA antibody raised against the middle region of MICA |
MICA antibody |
70R-18509 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MICA antibody |
MICA antibody |
38237-100ul |
SAB |
100ul |
EUR 252 |
MICA antibody |
10R-6540 |
Fitzgerald |
100 ug |
EUR 208 |
Description: Mouse monoclonal MICA antibody |
MICA Antibody |
DF6403 |
Affbiotech |
200ul |
EUR 304 |
Description: MICA Antibody detects endogenous levels of total MICA. |
MICA Antibody |
1-CSB-PA013806ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MICA. Recognizes MICA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200 |
MICA Antibody |
1-CSB-PA013806ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MICA. Recognizes MICA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
MICA Antibody |
1-CSB-PA013806GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against MICA. Recognizes MICA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
MICA antibody |
70R-6091 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal MICA antibody raised against the N terminal of MICA |
Polyclonal MICA Antibody (C-Terminus) |
APR02372G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MICA (C-Terminus). This antibody is tested and proven to work in the following applications: |
MICA Conjugated Antibody |
C38237 |
SAB |
100ul |
EUR 397 |
anti- MICA antibody |
FNab05176 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: MHC class I polypeptide-related sequence A
- Uniprot ID: Q29983
- Gene ID: 100507436
- Research Area: Immunology
|
Description: Antibody raised against MICA |
Anti-MICA Antibody |
PB9612 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-MICA antibody |
STJ24550 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants. |
Anti-MICA antibody |
STJ114496 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants. |
Anti-MICA antibody |
STJ192332 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MICA |
MICA siRNA |
20-abx924137 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-MICA |
YF-PA13161 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to MICA |
anti-MICA |
YF-PA13162 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to MICA |
MICA Blocking Peptide |
33R-5029 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MICA antibody, catalog no. 70R-6091 |
MICA Blocking Peptide |
33R-5386 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MICA antibody, catalog no. 70R-1705 |
MICA Blocking Peptide |
DF6403-BP |
Affbiotech |
1mg |
EUR 195 |
MICA cloning plasmid |
CSB-CL013806HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1152
- Sequence: atggggctgggcccggtcttcctgcttctggctggcatcttcccttttgcacctccgggagctgctgctgagccccacagtcttcgttataacctcacggtgctgtcctgggatggatctgtgcagtcagggtttctcactgaggtacatctggatggtcagcccttcctgcgct
- Show more
|
Description: A cloning plasmid for the MICA gene. |
Anti-MICA/MICB Purified |
11-822-C100 |
ExBio |
0.1 mg |
EUR 195 |
Anti-MICA/MICB APC |
1A-822-C100 |
ExBio |
0.1 mg |
EUR 331 |
MICA Rabbit Polyclonal Antibody