셀타젠 Genetic Genotyping

MXI1 Rabbit Polyclonal Antibody

MXI1 Polyclonal Antibody

ABP59349-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MXI1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MXI1 from Human, Mouse, Rat. This MXI1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MXI1 protein

MXI1 Polyclonal Antibody

ES11015-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MXI1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MXI1 Polyclonal Antibody

ES11015-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MXI1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MXI1 Rabbit pAb

A12098-100ul 100 ul
EUR 308

MXI1 Rabbit pAb

A12098-200ul 200 ul
EUR 459

MXI1 Rabbit pAb

A12098-20ul 20 ul
EUR 183

MXI1 Rabbit pAb

A12098-50ul 50 ul
EUR 223

MXI1 Rabbit pAb

A6661-100ul 100 ul
EUR 308

MXI1 Rabbit pAb

A6661-200ul 200 ul
EUR 459

MXI1 Rabbit pAb

A6661-20ul 20 ul
EUR 183

MXI1 Rabbit pAb

A6661-50ul 50 ul
EUR 223

MXI1 antibody

39081-100ul 100ul
EUR 252

MXI1 antibody

10R-1598 100 ug
EUR 512
Description: Mouse monoclonal MXI1 antibody

MXI1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MXI1. Recognizes MXI1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

MXI1 Conjugated Antibody

C39081 100ul
EUR 397

Anti-MXI1 antibody

STJ28744 100 µl
EUR 277
Description: Expression of the c-myc gene, which produces an oncogenic transcription factor, is tightly regulated in normal cells but is frequently deregulated in human cancers. The protein encoded by this gene is a transcriptional repressor thought to negatively regulate MYC function, and is therefore a potential tumor suppressor. This protein inhibits the transcriptional activity of MYC by competing for MAX, another basic helix-loop-helix protein that binds to MYC and is required for its function. Defects in this gene are frequently found in patients with prostate tumors. Three alternatively spliced transcripts encoding different isoforms have been described. Additional alternatively spliced transcripts may exist but the products of these transcripts have not been verified experimentally.

Anti-MXI1 antibody

STJ113993 100 µl
EUR 277
Description: Expression of the c-myc gene, which produces an oncogenic transcription factor, is tightly regulated in normal cells but is frequently deregulated in human cancers. The protein encoded by this gene is a transcriptional repressor thought to negatively regulate MYC function, and is therefore a potential tumor suppressor. This protein inhibits the transcriptional activity of MYC by competing for MAX, another basic helix-loop-helix protein that binds to MYC and is required for its function. Defects in this gene are frequently found in patients with prostate tumors. Three alternatively spliced transcripts encoding different isoforms have been described. Additional alternatively spliced transcripts may exist but the products of these transcripts have not been verified experimentally.

Anti-MXI1 antibody

STJ192173 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MXI1

Mxi1/ Rat Mxi1 ELISA Kit

ELI-39465r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA13285 50 ul
EUR 363
Description: Mouse polyclonal to MXI1


YF-PA13286 50 ul
EUR 363
Description: Mouse polyclonal to MXI1

MXI1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MXI1. Recognizes MXI1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MXI1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MXI1. Recognizes MXI1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MXI1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MXI1. Recognizes MXI1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MXI1 cloning plasmid

CSB-CL015254HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 549
  • Sequence: atgccgagcccccgactgcagcattcaaagcccccacggaggttgagccgggcacagaaacacagcagcgggagcagcaacaccagcactgccaacagacgagctcatctgcgcctttgtttagaacgcttaaaagttctgattccactaggaccagactgcacccggcacacaac
  • Show more
Description: A cloning plasmid for the MXI1 gene.

MXI1 cloning plasmid

CSB-CL015254HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 705
  • Sequence: atggagaagcacatcaacacttttctgcagaacgtgcagattctgctcgaggccgccagctacctggagcagatcgagaaagaaaacaaaaagtgtgaacatggctacgcctcttcattcccgtccatgccgagcccccgactgcagcattcaaagcccccacggaggttgagccg
  • Show more
Description: A cloning plasmid for the MXI1 gene.


PVT14066 2 ug
EUR 391


PVT14208 2 ug
EUR 495

Anti-MXI1 (1F3)

YF-MA14338 100 ug
EUR 363
Description: Mouse monoclonal to MXI1

Anti-MXI1 (1B10)

YF-MA14339 100 ug
EUR 363
Description: Mouse monoclonal to MXI1


EF005248 96 Tests
EUR 689

Mouse MXI1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MXI1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MXI1 Recombinant Protein (Human)

RP020437 100 ug Ask for price

MXI1 Recombinant Protein (Human)

RP020440 100 ug Ask for price

MXI1 Recombinant Protein (Mouse)

RP152423 100 ug Ask for price

MXI1 Recombinant Protein (Mouse)

RP152426 100 ug Ask for price

MXI1 Recombinant Protein (Mouse)

RP152429 100 ug Ask for price

MXI1 Recombinant Protein (Rat)

RP212846 100 ug Ask for price

Max-Interacting Protein 1 (MXI1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Max-Interacting Protein 1 (MXI1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Max-Interacting Protein 1 (MXI1) Antibody

abx145977-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Max-Interacting Protein 1 (MXI1) Antibody

abx028460-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Max-Interacting Protein 1 (MXI1) Antibody

abx028460-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Max-Interacting Protein 1 (MXI1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Max-Interacting Protein 1 (MXI1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Max-Interacting Protein 1 (MXI1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Max-Interacting Protein 1 (MXI1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mxi1 ORF Vector (Rat) (pORF)

ORF070950 1.0 ug DNA
EUR 506

MXI1 ORF Vector (Human) (pORF)

ORF006813 1.0 ug DNA
EUR 95

MXI1 ORF Vector (Human) (pORF)

ORF006814 1.0 ug DNA
EUR 95

Mxi1 ORF Vector (Mouse) (pORF)

ORF050809 1.0 ug DNA
EUR 506

Mxi1 ORF Vector (Mouse) (pORF)

ORF050810 1.0 ug DNA
EUR 506

Mxi1 ORF Vector (Mouse) (pORF)

ORF050811 1.0 ug DNA
EUR 506

Mxi1 sgRNA CRISPR Lentivector set (Mouse)

K4790001 3 x 1.0 ug
EUR 339

Mxi1 sgRNA CRISPR Lentivector set (Rat)

K6820501 3 x 1.0 ug
EUR 339

MXI1 sgRNA CRISPR Lentivector set (Human)

K1370201 3 x 1.0 ug
EUR 339

Mxi1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4790002 1.0 ug DNA
EUR 154

Mxi1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4790003 1.0 ug DNA
EUR 154

Mxi1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4790004 1.0 ug DNA
EUR 154

Mxi1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6820502 1.0 ug DNA
EUR 154

Mxi1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6820503 1.0 ug DNA
EUR 154

Mxi1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6820504 1.0 ug DNA
EUR 154

MXI1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1370202 1.0 ug DNA
EUR 154

MXI1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1370203 1.0 ug DNA
EUR 154

MXI1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1370204 1.0 ug DNA
EUR 154

MXI1 Protein Vector (Mouse) (pPB-C-His)

PV203234 500 ng
EUR 603

MXI1 Protein Vector (Mouse) (pPB-N-His)

PV203235 500 ng
EUR 603

MXI1 Protein Vector (Mouse) (pPM-C-HA)

PV203236 500 ng
EUR 603

MXI1 Protein Vector (Mouse) (pPM-C-His)

PV203237 500 ng
EUR 603

MXI1 Protein Vector (Mouse) (pPB-C-His)

PV203238 500 ng
EUR 603

MXI1 Protein Vector (Mouse) (pPB-N-His)

PV203239 500 ng
EUR 603

MXI1 Protein Vector (Mouse) (pPM-C-HA)

PV203240 500 ng
EUR 603

MXI1 Protein Vector (Mouse) (pPM-C-His)

PV203241 500 ng
EUR 603

MXI1 Protein Vector (Mouse) (pPB-C-His)

PV203242 500 ng
EUR 603

MXI1 Protein Vector (Mouse) (pPB-N-His)

PV203243 500 ng
EUR 603

MXI1 Protein Vector (Mouse) (pPM-C-HA)

PV203244 500 ng
EUR 603

MXI1 Protein Vector (Mouse) (pPM-C-His)

PV203245 500 ng
EUR 603

MXI1 Protein Vector (Rat) (pPB-C-His)

PV283798 500 ng
EUR 603

MXI1 Protein Vector (Rat) (pPB-N-His)

PV283799 500 ng
EUR 603

MXI1 Protein Vector (Rat) (pPM-C-HA)

PV283800 500 ng
EUR 603

MXI1 Protein Vector (Rat) (pPM-C-His)

PV283801 500 ng
EUR 603

MXI1 Protein Vector (Human) (pPB-C-His)

PV027249 500 ng
EUR 329

MXI1 Protein Vector (Human) (pPB-N-His)

PV027250 500 ng
EUR 329

MXI1 Protein Vector (Human) (pPM-C-HA)

PV027251 500 ng
EUR 329

MXI1 Protein Vector (Human) (pPM-C-His)

PV027252 500 ng
EUR 329

MXI1 Protein Vector (Human) (pPB-C-His)

PV027253 500 ng
EUR 329

MXI1 Protein Vector (Human) (pPB-N-His)

PV027254 500 ng
EUR 329

MXI1 Protein Vector (Human) (pPM-C-HA)

PV027255 500 ng
EUR 329

MXI1 Protein Vector (Human) (pPM-C-His)

PV027256 500 ng
EUR 329

Human MAX Interactor 1(MXI1)ELISA Kit

QY-E04804 96T
EUR 361

Mxi1 3'UTR Luciferase Stable Cell Line

TU113670 1.0 ml Ask for price

Mxi1 3'UTR GFP Stable Cell Line

TU163670 1.0 ml Ask for price

Mxi1 3'UTR Luciferase Stable Cell Line

TU213592 1.0 ml Ask for price

Mxi1 3'UTR GFP Stable Cell Line

TU263592 1.0 ml Ask for price

MXI1 3'UTR GFP Stable Cell Line

TU064996 1.0 ml
EUR 1521

MXI1 3'UTR Luciferase Stable Cell Line

TU014996 1.0 ml
EUR 1521

Human Max- interacting protein 1, MXI1 ELISA KIT

ELI-20014h 96 Tests
EUR 824

Mouse Max- interacting protein 1, Mxi1 ELISA KIT

ELI-43980m 96 Tests
EUR 865

Rat Max-interacting protein 1 (MXI1) ELISA Kit

abx391585-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Max-interacting protein 1 (MXI1) ELISA Kit

abx385133-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Max-interacting protein 1 (MXI1) ELISA Kit

abx389829-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

MXI1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV712569 1.0 ug DNA
EUR 316

MXI1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV712573 1.0 ug DNA
EUR 316

MXI1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV712574 1.0 ug DNA
EUR 316

MXI1 Rabbit Polyclonal Antibody