NINJ1 Rabbit Polyclonal Antibody

NINJ1 Rabbit Polyclonal Antibody

NINJ1 Polyclonal Antibody
A67086	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

NINJ1 Polyclonal Antibody
ABP59466-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human NINJ1 protein Applications tips:
Description: A polyclonal antibody for detection of NINJ1 from Human, Mouse, Rat. This NINJ1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NINJ1 protein

NINJ1 Polyclonal Antibody
ABP59466-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human NINJ1 protein Applications tips:
Description: A polyclonal antibody for detection of NINJ1 from Human, Mouse, Rat. This NINJ1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NINJ1 protein

NINJ1 Polyclonal Antibody
ABP59466-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NINJ1 protein Applications tips:
Description: A polyclonal antibody for detection of NINJ1 from Human, Mouse, Rat. This NINJ1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NINJ1 protein

NINJ1 Polyclonal Antibody
ES11146-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NINJ1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NINJ1 Polyclonal Antibody
ES11146-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NINJ1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Ninjurin 1 (NINJ1) ELISA Kit
DLR-NINJ1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Ninjurin 1 (NINJ1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ninjurin 1 (NINJ1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ninjurin 1 (NINJ1) ELISA Kit
DLR-NINJ1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Ninjurin 1 (NINJ1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ninjurin 1 (NINJ1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ninjurin 1 (NINJ1) ELISA Kit
RDR-NINJ1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Ninjurin 1 (NINJ1) ELISA Kit
RDR-NINJ1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Ninjurin 1 (NINJ1) ELISA Kit
RD-NINJ1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Ninjurin 1 (NINJ1) ELISA Kit
RD-NINJ1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

NINJ1 Rabbit pAb
A16406-100ul	Abclonal	100 ul	EUR 308

NINJ1 Rabbit pAb
A16406-200ul	Abclonal	200 ul	EUR 459

NINJ1 Rabbit pAb
A16406-20ul	Abclonal	20 ul	EUR 183

NINJ1 Rabbit pAb
A16406-50ul	Abclonal	50 ul	EUR 223

NINJ1 Polyclonal Conjugated Antibody
C29832	SAB	100ul	EUR 397

NINJ1 Antibody
1-CSB-PA856441LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NINJ1. Recognizes NINJ1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

NINJ1 Polyclonal Antibody, HRP Conjugated
A67087	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

NINJ1 Polyclonal Antibody, FITC Conjugated
A67088	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

NINJ1 Polyclonal Antibody, Biotin Conjugated
A67089	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Polyclonal NINJ1 / Ninjurin Antibody (C-Terminus)
AMM06695G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NINJ1 / Ninjurin (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal NINJ1 antibody - N-terminal region
AMM06697G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NINJ1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Anti-NINJ1 antibody
STJ118846	St John's Laboratory	100 µl	EUR 277

Anti-NINJ1 antibody
STJ192304	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NINJ1

Ninj1/ Rat Ninj1 ELISA Kit
ELI-45714r	Lifescience Market	96 Tests	EUR 886

NINJ1 siRNA
20-abx903564	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NINJ1 siRNA
20-abx925907	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NINJ1 siRNA
20-abx925908	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NINJ1 Antibody, HRP conjugated
1-CSB-PA856441LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NINJ1. Recognizes NINJ1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NINJ1 Antibody, FITC conjugated
1-CSB-PA856441LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NINJ1. Recognizes NINJ1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NINJ1 Antibody, Biotin conjugated
1-CSB-PA856441LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NINJ1. Recognizes NINJ1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Ninjurin 1 (NINJ1) Antibody
20-abx177810	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Ninjurin 1 (NINJ1) Antibody
20-abx173830	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Ninjurin-1 (NINJ1) Antibody
20-abx302043	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NINJ1 cloning plasmid
CSB-CL856441HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 459 Sequence: atggactcgggaaccgaggagtacgagctcaacggcggcctgcctccgggcacacccggctccccggacgcctcgccggcccgctggggctggaggcacgggcccatcaacgtgaaccattacgccagcaagaagagcgcagccgagagcatgctggacatcgcgctgctgatggc Show more
Description: A cloning plasmid for the NINJ1 gene.

NINJ1 cloning plasmid
CSB-CL856441HU2-10ug	Cusabio	10ug	EUR 238
Formulation: 10 μg plasmid + 200μl Glycerol Length: 459 Sequence: atggactcgggaaccgaggagtacgagctcaacggcggcctgcctccgggcacacccggctccccggacgcctcgccggcccgctggggctggaggcacgggcccatcaacgtgaaccattacgccagcaagaagagcgcagccgagagcatgctggacatcgcgctgctgatggc Show more
Description: A cloning plasmid for the NINJ1 gene.

Ninjurin-1 (NINJ1) Antibody (HRP)
20-abx310403	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ninjurin-1 (NINJ1) Antibody (FITC)
20-abx310404	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ninjurin-1 (NINJ1) Antibody (Biotin)
20-abx310405	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NINJ1 ELISA KIT|Human
EF005359	Lifescience Market	96 Tests	EUR 689

Mouse NINJ1 shRNA Plasmid
20-abx971750	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat NINJ1 shRNA Plasmid
20-abx984940	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NINJ1 shRNA Plasmid
20-abx953196	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NINJ1 Recombinant Protein (Human)
RP021229	ABM	100 ug	Ask for price

NINJ1 Recombinant Protein (Human)
RP021232	ABM	100 ug	Ask for price

NINJ1 Recombinant Protein (Mouse)
RP154112	ABM	100 ug	Ask for price

NINJ1 Recombinant Protein (Rat)
RP213935	ABM	100 ug	Ask for price

Human Ninjurin 1 (NINJ1) Protein
20-abx654563	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Ninj1 ORF Vector (Rat) (pORF)
ORF071313	ABM	1.0 ug DNA	EUR 506

NINJ1 ORF Vector (Human) (pORF)
ORF007077	ABM	1.0 ug DNA	EUR 95

NINJ1 ORF Vector (Human) (pORF)
ORF007078	ABM	1.0 ug DNA	EUR 95

Ninj1 ORF Vector (Mouse) (pORF)
ORF051372	ABM	1.0 ug DNA	EUR 506

NINJ1 ELISA Kit (Human) (OKCD01958)
OKCD01958	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Homophilic cell adhesion molecule that promotes axonal growth. May play a role in nerve regeneration and in the formation and function of other tissues. Cell adhesion requires divalent cations. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.111 ng/mL

NINJ1 ELISA Kit (Mouse) (OKCA01735)
OKCA01735	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Homophilic cell adhesion molecule that promotes axonal growth. May play a role in nerve regeneration and in the formation and function of other tissues. Cell adhesion requires divalent cations.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL

NINJ1 ELISA Kit (Human) (OKCA02127)
OKCA02127	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Homophilic cell adhesion molecule that promotes axonal growth. May play a role in nerve regeneration and in the formation and function of other tissues. Cell adhesion requires divalent cations. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.25 pg/mL

Human Ninjurin-1(NINJ1) ELISA kit
CSB-EL015808HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ninjurin-1 (NINJ1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Ninjurin-1(NINJ1) ELISA kit
1-CSB-EL015808HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ninjurin-1(NINJ1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Ninjurin-1(NINJ1) ELISA kit
CSB-EL015808MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ninjurin-1 (NINJ1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Ninjurin-1(NINJ1) ELISA kit
1-CSB-EL015808MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ninjurin-1(NINJ1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Ninjurin 1 (NINJ1) ELISA Kit
20-abx152526	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Ninjurin- 1, NINJ1 ELISA KIT
ELI-23174h	Lifescience Market	96 Tests	EUR 824

Mouse Ninjurin- 1, Ninj1 ELISA KIT
ELI-44028m	Lifescience Market	96 Tests	EUR 865

Rat Ninjurin-1 (NINJ1) ELISA Kit
abx391714-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ninjurin 1 (NINJ1) CLIA Kit
20-abx495469	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Ninjurin-1 (NINJ1) ELISA Kit
abx390057-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Ninj1 sgRNA CRISPR Lentivector set (Rat)
K6930801	ABM	3 x 1.0 ug	EUR 339

Ninj1 sgRNA CRISPR Lentivector set (Mouse)
K3656801	ABM	3 x 1.0 ug	EUR 339

NINJ1 sgRNA CRISPR Lentivector set (Human)
K1427601	ABM	3 x 1.0 ug	EUR 339

Human Ninjurin 1(NINJ1)ELISA Kit
QY-E01652	Qayee Biotechnology	96T	EUR 361

Human Ninjurin 1 (NINJ1) ELISA Kit
SEH541Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ninjurin 1 (NINJ1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ninjurin 1 (NINJ1) in Tissue homogenates, cell lysates and other biological fluids.

Human Ninjurin 1 (NINJ1) ELISA Kit
SEH541Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ninjurin 1 (NINJ1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ninjurin 1 (NINJ1) in Tissue homogenates, cell lysates and other biological fluids.

Human Ninjurin 1 (NINJ1) ELISA Kit
SEH541Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ninjurin 1 (NINJ1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ninjurin 1 (NINJ1) in Tissue homogenates, cell lysates and other biological fluids.

Human Ninjurin 1 (NINJ1) ELISA Kit
SEH541Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ninjurin 1 (NINJ1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ninjurin 1 (NINJ1) in Tissue homogenates, cell lysates and other biological fluids.

Human Ninjurin 1 (NINJ1) ELISA Kit
4-SEH541Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Ninjurin 1 elisa. Alternative names of the recognized antigen: NIN1 Nerve Injury-Induced Protein-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ninjurin 1 (NINJ1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human NINJ1 (Ninjurin 1)
ELK4538	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ninjurin 1 (NINJ1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ninjurin 1 (NIN Show more
Description: A sandwich ELISA kit for detection of Ninjurin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Ninj1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6930802	ABM	1.0 ug DNA	EUR 154

Ninj1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6930803	ABM	1.0 ug DNA	EUR 154

Ninj1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6930804	ABM	1.0 ug DNA	EUR 154

Ninj1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3656802	ABM	1.0 ug DNA	EUR 154

Ninj1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3656803	ABM	1.0 ug DNA	EUR 154

Ninj1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3656804	ABM	1.0 ug DNA	EUR 154

NINJ1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1427602	ABM	1.0 ug DNA	EUR 154

NINJ1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1427603	ABM	1.0 ug DNA	EUR 154

NINJ1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1427604	ABM	1.0 ug DNA	EUR 154

NINJ1 Protein Vector (Mouse) (pPB-C-His)
PV205486	ABM	500 ng	EUR 603

NINJ1 Protein Vector (Mouse) (pPB-N-His)
PV205487	ABM	500 ng	EUR 603

NINJ1 Protein Vector (Mouse) (pPM-C-HA)
PV205488	ABM	500 ng	EUR 603

NINJ1 Protein Vector (Mouse) (pPM-C-His)
PV205489	ABM	500 ng	EUR 603

NINJ1 Protein Vector (Rat) (pPB-C-His)
PV285250	ABM	500 ng	EUR 603

NINJ1 Protein Vector (Rat) (pPB-N-His)
PV285251	ABM	500 ng	EUR 603

NINJ1 Protein Vector (Rat) (pPM-C-HA)
PV285252	ABM	500 ng	EUR 603

NINJ1 Protein Vector (Rat) (pPM-C-His)
PV285253	ABM	500 ng	EUR 603

NINJ1 Protein Vector (Human) (pPB-C-His)
PV028305	ABM	500 ng	EUR 329

NINJ1 Protein Vector (Human) (pPB-N-His)
PV028306	ABM	500 ng	EUR 329

NINJ1 Protein Vector (Human) (pPM-C-HA)
PV028307	ABM	500 ng	EUR 329

NINJ1 Protein Vector (Human) (pPM-C-His)
PV028308	ABM	500 ng	EUR 329

NINJ1 Protein Vector (Human) (pPB-C-His)
PV028309	ABM	500 ng	EUR 329

NINJ1 Protein Vector (Human) (pPB-N-His)
PV028310	ABM	500 ng	EUR 329

NINJ1 Protein Vector (Human) (pPM-C-HA)
PV028311	ABM	500 ng	EUR 329

NINJ1 Protein Vector (Human) (pPM-C-His)
PV028312	ABM	500 ng	EUR 329

Ninj1 3'UTR Luciferase Stable Cell Line
TU114087	ABM	1.0 ml	Ask for price

Ninj1 3'UTR GFP Stable Cell Line
TU164087	ABM	1.0 ml	Ask for price

Ninj1 3'UTR Luciferase Stable Cell Line
TU213978	ABM	1.0 ml	Ask for price

Ninj1 3'UTR GFP Stable Cell Line
TU263978	ABM	1.0 ml	Ask for price

NINJ1 3'UTR GFP Stable Cell Line
TU065687	ABM	1.0 ml	EUR 1394

NINJ1 3'UTR Luciferase Stable Cell Line
TU015687	ABM	1.0 ml	EUR 1394

Ninj1 ELISA Kit| Rat Ninjurin-1 ELISA Kit
EF019074	Lifescience Market	96 Tests	EUR 689

Ninj1 ELISA Kit| Mouse Ninjurin-1 ELISA Kit
EF015696	Lifescience Market	96 Tests	EUR 689

NINJ1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV712761	ABM	1.0 ug DNA	EUR 316

NINJ1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV712765	ABM	1.0 ug DNA	EUR 316

NINJ1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV712766	ABM	1.0 ug DNA	EUR 316

NINJ1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV696139	ABM	1.0 ug DNA	EUR 514

NINJ1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV696143	ABM	1.0 ug DNA	EUR 514

NINJ1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV696144	ABM	1.0 ug DNA	EUR 514

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody
ABP57577-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4c Rabbit Polyclonal Antibody
ABP57578-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG5 Rabbit Polyclonal Antibody
ABP57579-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG7 Rabbit Polyclonal Antibody
ABP57580-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG13 Rabbit Polyclonal Antibody
ABP57581-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG14L Rabbit Polyclonal Antibody
ABP57583-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody
ABP57583-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody
ABP57583-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

NBR1 Rabbit Polyclonal Antibody
ABP57585-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57585-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57585-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

WIPI2 Rabbit Polyclonal Antibody
ABP57587-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of WIPI2 Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

WIPI2 Rabbit Polyclonal Antibody
ABP57587-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of WIPI2 Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

WIPI2 Rabbit Polyclonal Antibody
ABP57587-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of WIPI2 Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

FAK Rabbit Polyclonal Antibody
ABP57588-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of FAK Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

FAK Rabbit Polyclonal Antibody
ABP57588-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of FAK Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

FAK Rabbit Polyclonal Antibody
ABP57588-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of FAK Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

Gab1 Rabbit Polyclonal Antibody
ABP57589-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Gab1 Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

Gab1 Rabbit Polyclonal Antibody
ABP57589-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Gab1 Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

Gab1 Rabbit Polyclonal Antibody
ABP57589-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Gab1 Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

ERK1 Rabbit Polyclonal Antibody
ABP57590-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ERK1 Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

ERK1 Rabbit Polyclonal Antibody
ABP57590-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ERK1 Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

ERK1 Rabbit Polyclonal Antibody
ABP57590-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ERK1 Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NINJ1 Rabbit Polyclonal Antibody