NR1H2 Rabbit Polyclonal Antibody
 NR1H2 Polyclonal Antibody |
|
ABP59522-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NR1H2 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NR1H2 from Human, Mouse, Rat. This NR1H2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR1H2 protein |
NR1H2 Polyclonal Antibody |
|
ABP59522-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NR1H2 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NR1H2 from Human, Mouse, Rat. This NR1H2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR1H2 protein |
NR1H2 Polyclonal Antibody |
|
29799-100ul |
SAB |
100ul |
EUR 252 |
NR1H2 Polyclonal Antibody |
|
29799-50ul |
SAB |
50ul |
EUR 187 |
 NR1H2 Rabbit pAb |
|
A16291-100ul |
Abclonal |
100 ul |
EUR 308 |
NR1H2 Rabbit pAb |
|
A16291-200ul |
Abclonal |
200 ul |
EUR 459 |
NR1H2 Rabbit pAb |
|
A16291-20ul |
Abclonal |
20 ul |
EUR 183 |
NR1H2 Rabbit pAb |
|
A16291-50ul |
Abclonal |
50 ul |
EUR 223 |
NR1H2 Rabbit pAb |
|
A8979-100ul |
Abclonal |
100 ul |
EUR 308 |
NR1H2 Rabbit pAb |
|
A8979-200ul |
Abclonal |
200 ul |
EUR 459 |
NR1H2 Rabbit pAb |
|
A8979-20ul |
Abclonal |
20 ul |
Ask for price |
NR1H2 Rabbit pAb |
|
A8979-50ul |
Abclonal |
50 ul |
Ask for price |
 NR1H2 Polyclonal Conjugated Antibody |
|
C29799 |
SAB |
100ul |
EUR 397 |
 NR1H2 antibody |
|
70R-18948 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal NR1H2 antibody |
NR1H2 antibody |
|
70R-1007 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal NR1H2 antibody raised against the middle region of NR1H2 |
 NR1H2 Antibody |
|
DF12126 |
Affbiotech |
200ul |
EUR 304 |
|
Description: NR1H2 antibody detects endogenous levels of NR1H2. |
NR1H2 Antibody |
|
1-CSB-PA016045GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
NR1H2 Antibody |
|
1-CSB-PA016045HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
) Polyclonal NR1H2 Antibody (N-term) |
|
APR08815G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR1H2 (N-term). This antibody is tested and proven to work in the following applications: |
 anti- NR1H2 antibody |
|
FNab05834 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200-1:2000
- Immunogen: nuclear receptor subfamily 1, group H, member 2
- Uniprot ID: P55055
- Gene ID: 7376
- Research Area: Neuroscience, Cardiovascular, Metabolism
|
|
Description: Antibody raised against NR1H2 |
 Anti-NR1H2 antibody |
|
STJ192129 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to NR1H2 |
 NR1H2 siRNA |
|
20-abx903642 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR1H2 siRNA |
|
20-abx926321 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR1H2 siRNA |
|
20-abx926322 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
) Polyclonal NR1H2 / LXR Beta Antibody (N-Terminus) |
|
APR08812G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NR1H2 / LXR Beta (N-Terminus). This antibody is tested and proven to work in the following applications: |
 Polyclonal Goat Anti-LXR beta / NR1H2 Antibody |
|
AMM05049G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-LXR beta / NR1H2 . This antibody is tested and proven to work in the following applications: |
 NR1H2 Antibody, HRP conjugated |
|
1-CSB-PA016045HB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 NR1H2 Antibody, FITC conjugated |
|
1-CSB-PA016045HC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 NR1H2 Antibody, Biotin conjugated |
|
1-CSB-PA016045HD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 NR1H2 cloning plasmid |
|
CSB-CL016045HU-10ug |
Cusabio |
10ug |
EUR 497 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1386
- Sequence: atgtcctctcctaccacgagttccctggatacccccctgcctggaaatggcccccctcagcctggcgccccttcttcttcacccactgtaaaggaggagggtccggagccgtggcccgggggtccggaccctgatgtcccaggcactgatgaggccagctcagcctgcagcacag
- Show more
|
|
Description: A cloning plasmid for the NR1H2 gene. |
 NR1H2 Blocking Peptide |
|
33R-6119 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR1H2 antibody, catalog no. 70R-1007 |
NR1H2 Blocking Peptide |
|
DF12126-BP |
Affbiotech |
1mg |
EUR 195 |
 Rat NR1H2 shRNA Plasmid |
|
20-abx985915 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human NR1H2 shRNA Plasmid |
|
20-abx955046 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse NR1H2 shRNA Plasmid |
|
20-abx973322 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) NR1H2 Recombinant Protein (Human) |
|
RP021589 |
ABM |
100 ug |
Ask for price |
) NR1H2 Recombinant Protein (Rat) |
|
RP214439 |
ABM |
100 ug |
Ask for price |
) NR1H2 Recombinant Protein (Mouse) |
|
RP154847 |
ABM |
100 ug |
Ask for price |
 Antibody) Oxysterols Receptor LXR-Beta (NR1H2) Antibody |
|
20-abx123816 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Oxysterols Receptor LXR-Beta (NR1H2) Antibody |
|
abx033981-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Oxysterols Receptor LXR-Beta (NR1H2) Antibody |
|
abx033981-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Oxysterols Receptor LXR-Beta (NR1H2) Antibody |
|
20-abx312965 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Oxysterols Receptor LXR-Beta (NR1H2) Antibody |
|
abx235834-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 (M04), Clone: 10) Monoclonal NR1H2 Antibody (monoclonal) (M04), Clone: 10 |
|
APR08814G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human NR1H2 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 10. This antibody is applicable in WB and IF, E |
 Antibody (HRP)) Oxysterols Receptor LXR-Beta (NR1H2) Antibody (HRP) |
|
20-abx312966 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Oxysterols Receptor LXR-Beta (NR1H2) Antibody (FITC) |
|
20-abx312967 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Oxysterols Receptor LXR-Beta (NR1H2) Antibody (Biotin) |
|
20-abx312968 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) NR1H2 ORF Vector (Human) (pORF) |
|
ORF007197 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Nr1h2 ORF Vector (Rat) (pORF) |
|
ORF071481 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Nr1h2 ORF Vector (Mouse) (pORF) |
|
ORF051617 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKEH04158)) NR1H2 ELISA Kit (Human) (OKEH04158) |
|
OKEH04158 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: The liver X receptors, LXRA (NR1H3; MIM 602423) and LXRB, form a subfamily of the nuclear receptor superfamily and are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. The inducible LXRA is highly expressed in liver, adrenal gland, intestine, adipose tissue, macrophages, lung, and kidney, whereas LXRB is ubiquitously expressed. Ligand-activated LXRs form obligate heterodimers with retinoid X receptors (RXRs; see MIM 180245) and regulate expression of target genes containing LXR response elements (summary by Korf et al., 2009 [PubMed 19436111]).[supplied by OMIM, Jan 2010];Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
 (OKEH05901)) NR1H2 ELISA Kit (Mouse) (OKEH05901) |
|
OKEH05901 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: Nuclear receptor. Binds preferentially to double-stranded oligonucleotide direct repeats having the consensus half-site sequence 5'-AGGTCA-3' and 4-nt spacing (DR-4). Regulates cholesterol uptake through MYLIP-dependent ubiquitination of LDLR, VLDLR and LRP8; DLDLR and LRP8. Interplays functionally with RORA for the regulation of genes involved in liver metabolism. Exhibits a ligand-dependent transcriptional activation activity.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL |
 (OKEH06326)) NR1H2 ELISA Kit (Rat) (OKEH06326) |
|
OKEH06326 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: Nuclear receptor. Binds preferentially to double-stranded oligonucleotide direct repeats having the consensus half-site sequence 5'-AGGTCA-3' and 4-nt spacing (DR-4). Regulates cholesterol uptake through MYLIP-dependent ubiquitination of LDLR, VLDLR and LRP8; DLDLR and LRP8. Interplays functionally with RORA for the regulation of genes involved in liver metabolism. Exhibits a ligand-dependent transcriptional activation activity.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.087 ng/mL |
 (M01), Clone: 2H2-H3) Monoclonal NR1H2 Antibody (monoclonal) (M01), Clone: 2H2-H3 |
|
APR08813G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human NR1H2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2H2-H3. This antibody is applicable in WB, E |
) NR1H2 sgRNA CRISPR Lentivector set (Human) |
|
K1451401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Nr1h2 sgRNA CRISPR Lentivector set (Rat) |
|
K6856901 |
ABM |
3 x 1.0 ug |
EUR 339 |
NR1H2 Rabbit Polyclonal Antibody
