
셀타젠 Genetic Genotyping

NR1H2 Rabbit Polyclonal Antibody

NR1H2 Rabbit Polyclonal Antibody

NR1H2 Polyclonal Antibody

ABP59522-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NR1H2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NR1H2 from Human, Mouse, Rat. This NR1H2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR1H2 protein

NR1H2 Polyclonal Antibody

ABP59522-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NR1H2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NR1H2 from Human, Mouse, Rat. This NR1H2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR1H2 protein

NR1H2 Polyclonal Antibody

29799-100ul 100ul
EUR 252

NR1H2 Polyclonal Antibody

29799-50ul 50ul
EUR 187

NR1H2 Rabbit pAb

A16291-100ul 100 ul
EUR 308

NR1H2 Rabbit pAb

A16291-200ul 200 ul
EUR 459

NR1H2 Rabbit pAb

A16291-20ul 20 ul
EUR 183

NR1H2 Rabbit pAb

A16291-50ul 50 ul
EUR 223

NR1H2 Rabbit pAb

A8979-100ul 100 ul
EUR 308

NR1H2 Rabbit pAb

A8979-200ul 200 ul
EUR 459

NR1H2 Rabbit pAb

A8979-20ul 20 ul Ask for price

NR1H2 Rabbit pAb

A8979-50ul 50 ul Ask for price

NR1H2 Polyclonal Conjugated Antibody

C29799 100ul
EUR 397

NR1H2 antibody

70R-18948 50 ul
EUR 435
Description: Rabbit polyclonal NR1H2 antibody

NR1H2 antibody

70R-1007 100 ug
EUR 377
Description: Rabbit polyclonal NR1H2 antibody raised against the middle region of NR1H2

NR1H2 Antibody

DF12126 200ul
EUR 304
Description: NR1H2 antibody detects endogenous levels of NR1H2.

NR1H2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NR1H2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Polyclonal NR1H2 Antibody (N-term)

APR08815G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR1H2 (N-term). This antibody is tested and proven to work in the following applications:

anti- NR1H2 antibody

FNab05834 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: nuclear receptor subfamily 1, group H, member 2
  • Uniprot ID: P55055
  • Gene ID: 7376
  • Research Area: Neuroscience, Cardiovascular, Metabolism
Description: Antibody raised against NR1H2

Anti-NR1H2 antibody

PAab05834 100 ug
EUR 386

Anti-NR1H2 antibody

STJ111504 100 µl
EUR 277

Anti-NR1H2 antibody

STJ118737 100 µl
EUR 277

Anti-NR1H2 antibody

STJ192129 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NR1H2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal NR1H2 / LXR Beta Antibody (N-Terminus)

APR08812G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NR1H2 / LXR Beta (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-LXR beta / NR1H2 Antibody

AMM05049G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-LXR beta / NR1H2 . This antibody is tested and proven to work in the following applications:

NR1H2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NR1H2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NR1H2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NR1H2 cloning plasmid

CSB-CL016045HU-10ug 10ug
EUR 497
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1386
  • Sequence: atgtcctctcctaccacgagttccctggatacccccctgcctggaaatggcccccctcagcctggcgccccttcttcttcacccactgtaaaggaggagggtccggagccgtggcccgggggtccggaccctgatgtcccaggcactgatgaggccagctcagcctgcagcacag
  • Show more
Description: A cloning plasmid for the NR1H2 gene.

NR1H2 Blocking Peptide

33R-6119 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR1H2 antibody, catalog no. 70R-1007

NR1H2 Blocking Peptide

DF12126-BP 1mg
EUR 195

pDONR223-NR1H2 Plasmid

PVTB01054-1 2 ug
EUR 356

Anti-LXR beta / NR1H2 antibody

STJ70603 100 µg
EUR 359

Rat NR1H2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NR1H2 ELISA Kit

ELA-E0212h 96 Tests
EUR 824


EF000502 96 Tests
EUR 689

Human NR1H2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NR1H2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NR1H2 Recombinant Protein (Human)

RP021589 100 ug Ask for price

NR1H2 Recombinant Protein (Rat)

RP214439 100 ug Ask for price

NR1H2 Recombinant Protein (Mouse)

RP154847 100 ug Ask for price

Oxysterols Receptor LXR-Beta (NR1H2) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Oxysterols Receptor LXR-Beta (NR1H2) Antibody

abx033981-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Oxysterols Receptor LXR-Beta (NR1H2) Antibody

abx033981-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Oxysterols Receptor LXR-Beta (NR1H2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Oxysterols Receptor LXR-Beta (NR1H2) Antibody

abx235834-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Monoclonal NR1H2 Antibody (monoclonal) (M04), Clone: 10

APR08814G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NR1H2 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 10. This antibody is applicable in WB and IF, E

Oxysterols Receptor LXR-Beta (NR1H2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Oxysterols Receptor LXR-Beta (NR1H2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Oxysterols Receptor LXR-Beta (NR1H2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NR1H2 ORF Vector (Human) (pORF)

ORF007197 1.0 ug DNA
EUR 95

Nr1h2 ORF Vector (Rat) (pORF)

ORF071481 1.0 ug DNA
EUR 506

Nr1h2 ORF Vector (Mouse) (pORF)

ORF051617 1.0 ug DNA
EUR 506

NR1H2 ELISA Kit (Human) (OKEH04158)

OKEH04158 96 Wells
EUR 662
Description: Description of target: The liver X receptors, LXRA (NR1H3; MIM 602423) and LXRB, form a subfamily of the nuclear receptor superfamily and are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. The inducible LXRA is highly expressed in liver, adrenal gland, intestine, adipose tissue, macrophages, lung, and kidney, whereas LXRB is ubiquitously expressed. Ligand-activated LXRs form obligate heterodimers with retinoid X receptors (RXRs; see MIM 180245) and regulate expression of target genes containing LXR response elements (summary by Korf et al., 2009 [PubMed 19436111]).[supplied by OMIM, Jan 2010];Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

NR1H2 ELISA Kit (Mouse) (OKEH05901)

OKEH05901 96 Wells
EUR 662
Description: Description of target: Nuclear receptor. Binds preferentially to double-stranded oligonucleotide direct repeats having the consensus half-site sequence 5'-AGGTCA-3' and 4-nt spacing (DR-4). Regulates cholesterol uptake through MYLIP-dependent ubiquitination of LDLR, VLDLR and LRP8; DLDLR and LRP8. Interplays functionally with RORA for the regulation of genes involved in liver metabolism. Exhibits a ligand-dependent transcriptional activation activity.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL

NR1H2 ELISA Kit (Rat) (OKEH06326)

OKEH06326 96 Wells
EUR 662
Description: Description of target: Nuclear receptor. Binds preferentially to double-stranded oligonucleotide direct repeats having the consensus half-site sequence 5'-AGGTCA-3' and 4-nt spacing (DR-4). Regulates cholesterol uptake through MYLIP-dependent ubiquitination of LDLR, VLDLR and LRP8; DLDLR and LRP8. Interplays functionally with RORA for the regulation of genes involved in liver metabolism. Exhibits a ligand-dependent transcriptional activation activity.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.087 ng/mL

Monoclonal NR1H2 Antibody (monoclonal) (M01), Clone: 2H2-H3

APR08813G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NR1H2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2H2-H3. This antibody is applicable in WB, E

NR1H2 sgRNA CRISPR Lentivector set (Human)

K1451401 3 x 1.0 ug
EUR 339

Nr1h2 sgRNA CRISPR Lentivector set (Rat)

K6856901 3 x 1.0 ug
EUR 339

NR1H2 Rabbit Polyclonal Antibody