NR1H2 Rabbit Polyclonal Antibody

NR1H2 Polyclonal Antibody
ABP59522-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human NR1H2 protein Applications tips:
Description: A polyclonal antibody for detection of NR1H2 from Human, Mouse, Rat. This NR1H2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR1H2 protein

NR1H2 Polyclonal Antibody
ABP59522-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NR1H2 protein Applications tips:
Description: A polyclonal antibody for detection of NR1H2 from Human, Mouse, Rat. This NR1H2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR1H2 protein

NR1H2 Polyclonal Antibody
ES10971-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NR1H2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NR1H2 Polyclonal Antibody
ES10971-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NR1H2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NR1H2 Rabbit pAb
A16291-100ul	Abclonal	100 ul	EUR 308

NR1H2 Rabbit pAb
A16291-200ul	Abclonal	200 ul	EUR 459

NR1H2 Rabbit pAb
A16291-20ul	Abclonal	20 ul	EUR 183

NR1H2 Rabbit pAb
A16291-50ul	Abclonal	50 ul	EUR 223

NR1H2 Rabbit pAb
A8979-100ul	Abclonal	100 ul	EUR 308

NR1H2 Rabbit pAb
A8979-200ul	Abclonal	200 ul	EUR 459

NR1H2 Rabbit pAb
A8979-20ul	Abclonal	20 ul	Ask for price

NR1H2 Rabbit pAb
A8979-50ul	Abclonal	50 ul	Ask for price

NR1H2 Polyclonal Conjugated Antibody
C29799	SAB	100ul	EUR 397

NR1H2 antibody
70R-18948	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NR1H2 antibody

NR1H2 antibody
70R-1007	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal NR1H2 antibody raised against the middle region of NR1H2

NR1H2 Antibody
DF12126	Affbiotech	200ul	EUR 304
Description: NR1H2 antibody detects endogenous levels of NR1H2.

NR1H2 Antibody
1-CSB-PA016045GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NR1H2 Antibody
1-CSB-PA016045HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Polyclonal NR1H2 Antibody (N-term)
APR08815G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR1H2 (N-term). This antibody is tested and proven to work in the following applications:

anti- NR1H2 antibody
FNab05834	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:2000 Immunogen: nuclear receptor subfamily 1, group H, member 2 Uniprot ID: P55055 Gene ID: 7376 Research Area: Neuroscience, Cardiovascular, Metabolism
Description: Antibody raised against NR1H2

Anti-NR1H2 antibody
PAab05834	Lifescience Market	100 ug	EUR 386

Anti-NR1H2 antibody
STJ111504	St John's Laboratory	100 µl	EUR 277

Anti-NR1H2 antibody
STJ118737	St John's Laboratory	100 µl	EUR 277

Anti-NR1H2 antibody
STJ192129	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NR1H2

NR1H2 siRNA
20-abx903642	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NR1H2 siRNA
20-abx926321	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NR1H2 siRNA
20-abx926322	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Polyclonal NR1H2 / LXR Beta Antibody (N-Terminus)
APR08812G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NR1H2 / LXR Beta (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-LXR beta / NR1H2 Antibody
AMM05049G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-LXR beta / NR1H2 . This antibody is tested and proven to work in the following applications:

NR1H2 Antibody, HRP conjugated
1-CSB-PA016045HB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NR1H2 Antibody, FITC conjugated
1-CSB-PA016045HC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NR1H2 Antibody, Biotin conjugated
1-CSB-PA016045HD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR1H2. Recognizes NR1H2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NR1H2 Blocking Peptide
33R-6119	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR1H2 antibody, catalog no. 70R-1007

NR1H2 Blocking Peptide
DF12126-BP	Affbiotech	1mg	EUR 195

NR1H2 cloning plasmid
CSB-CL016045HU-10ug	Cusabio	10ug	EUR 497
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1386 Sequence: atgtcctctcctaccacgagttccctggatacccccctgcctggaaatggcccccctcagcctggcgccccttcttcttcacccactgtaaaggaggagggtccggagccgtggcccgggggtccggaccctgatgtcccaggcactgatgaggccagctcagcctgcagcacag Show more
Description: A cloning plasmid for the NR1H2 gene.

pDONR223-NR1H2 Plasmid
PVTB01054-1	Lifescience Market	2 ug	EUR 356

Anti-LXR beta / NR1H2 antibody
STJ70603	St John's Laboratory	100 µg	EUR 359

Human NR1H2 ELISA Kit
ELA-E0212h	Lifescience Market	96 Tests	EUR 824

NR1H2 ELISA KIT|Human
EF000502	Lifescience Market	96 Tests	EUR 689

Mouse NR1H2 shRNA Plasmid
20-abx973322	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat NR1H2 shRNA Plasmid
20-abx985915	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NR1H2 shRNA Plasmid
20-abx955046	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NR1H2 Recombinant Protein (Human)
RP021589	ABM	100 ug	Ask for price

NR1H2 Recombinant Protein (Mouse)
RP154847	ABM	100 ug	Ask for price

NR1H2 Recombinant Protein (Rat)
RP214439	ABM	100 ug	Ask for price

Oxysterols Receptor LXR-Beta (NR1H2) Antibody
20-abx123816	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Oxysterols Receptor LXR-Beta (NR1H2) Antibody
abx033981-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Oxysterols Receptor LXR-Beta (NR1H2) Antibody
abx033981-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Oxysterols Receptor LXR-Beta (NR1H2) Antibody
abx235834-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Oxysterols Receptor LXR-Beta (NR1H2) Antibody
20-abx312965	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Monoclonal NR1H2 Antibody (monoclonal) (M04), Clone: 10
APR08814G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human NR1H2 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 10. This antibody is applicable in WB and IF, E

Oxysterols Receptor LXR-Beta (NR1H2) Antibody (HRP)
20-abx312966	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Oxysterols Receptor LXR-Beta (NR1H2) Antibody (FITC)
20-abx312967	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Oxysterols Receptor LXR-Beta (NR1H2) Antibody (Biotin)
20-abx312968	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nr1h2 ORF Vector (Rat) (pORF)
ORF071481	ABM	1.0 ug DNA	EUR 506

NR1H2 ORF Vector (Human) (pORF)
ORF007197	ABM	1.0 ug DNA	EUR 95

Nr1h2 ORF Vector (Mouse) (pORF)
ORF051617	ABM	1.0 ug DNA	EUR 506

Monoclonal NR1H2 Antibody (monoclonal) (M01), Clone: 2H2-H3
APR08813G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human NR1H2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2H2-H3. This antibody is applicable in WB, E

Nr1h2 sgRNA CRISPR Lentivector set (Rat)
K6856901	ABM	3 x 1.0 ug	EUR 339

NR1H2 sgRNA CRISPR Lentivector set (Human)
K1451401	ABM	3 x 1.0 ug	EUR 339

Nr1h2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6856902	ABM	1.0 ug DNA	EUR 154

Nr1h2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6856903	ABM	1.0 ug DNA	EUR 154

Nr1h2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6856904	ABM	1.0 ug DNA	EUR 154

NR1H2 Rabbit Polyclonal Antibody