NR1H4 Rabbit Polyclonal Antibody
 NR1H4 Polyclonal Antibody |
|
ABP59523-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NR1H4 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NR1H4 from Human, Mouse, Rat. This NR1H4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR1H4 protein |
NR1H4 Polyclonal Antibody |
|
A55491 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
NR1H4 Polyclonal Antibody |
|
31507-100ul |
SAB |
100ul |
EUR 252 |
NR1H4 Polyclonal Antibody |
|
31507-50ul |
SAB |
50ul |
EUR 187 |
NR1H4 Polyclonal Antibody |
|
27782-100ul |
SAB |
100ul |
EUR 252 |
NR1H4 Polyclonal Antibody |
|
27782-50ul |
SAB |
50ul |
EUR 187 |
 NR1H4 Rabbit pAb |
|
A12788-100ul |
Abclonal |
100 ul |
EUR 308 |
NR1H4 Rabbit pAb |
|
A12788-200ul |
Abclonal |
200 ul |
EUR 459 |
NR1H4 Rabbit pAb |
|
A12788-20ul |
Abclonal |
20 ul |
EUR 183 |
NR1H4 Rabbit pAb |
|
A12788-50ul |
Abclonal |
50 ul |
EUR 223 |
NR1H4 Rabbit pAb |
|
A8320-100ul |
Abclonal |
100 ul |
EUR 308 |
NR1H4 Rabbit pAb |
|
A8320-200ul |
Abclonal |
200 ul |
EUR 459 |
NR1H4 Rabbit pAb |
|
A8320-20ul |
Abclonal |
20 ul |
EUR 183 |
NR1H4 Rabbit pAb |
|
A8320-50ul |
Abclonal |
50 ul |
EUR 223 |
 NR1H4 Polyclonal Conjugated Antibody |
|
C31507 |
SAB |
100ul |
EUR 397 |
NR1H4 Polyclonal Conjugated Antibody |
|
C27782 |
SAB |
100ul |
EUR 397 |
 NR1H4 antibody |
|
70R-1941 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal NR1H4 antibody raised against the middle region of NR1H4 |
 NR1H4 Antibody |
|
DF12511 |
Affbiotech |
200ul |
EUR 304 |
|
Description: NR1H4 Antibody detects endogenous levels of NR1H4. |
NR1H4 Antibody |
|
1-CSB-PA839406LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NR1H4. Recognizes NR1H4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200 |
 NR1H4 Polyclonal Antibody, HRP Conjugated |
|
A55492 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 NR1H4 Polyclonal Antibody, FITC Conjugated |
|
A55493 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 NR1H4 Polyclonal Antibody, Biotin Conjugated |
|
A55494 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Anti-NR1H4 antibody |
|
STJ110618 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a ligand-activated transcription factor that shares structural features in common with nuclear hormone receptor family members. This protein functions as a receptor for bile acids, and when bound to bile acids, binds to DNA and regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described. |
Anti-NR1H4 antibody |
|
STJ114657 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a ligand-activated transcription factor that shares structural features in common with nuclear hormone receptor family members. This protein functions as a receptor for bile acids, and when bound to bile acids, binds to DNA and regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described. |
Anti-NR1H4 antibody |
|
STJ192265 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to NR1H4 |
 NR1H4 siRNA |
|
20-abx903643 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR1H4 siRNA |
|
20-abx926325 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR1H4 siRNA |
|
20-abx926326 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 NR1H4 Antibody, HRP conjugated |
|
1-CSB-PA839406LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NR1H4. Recognizes NR1H4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 NR1H4 Antibody, FITC conjugated |
|
1-CSB-PA839406LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NR1H4. Recognizes NR1H4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 NR1H4 Antibody, Biotin conjugated |
|
1-CSB-PA839406LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NR1H4. Recognizes NR1H4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 ELISA kit) Rabbit Bile acid receptor(NR1H4) ELISA kit |
|
E04B0957-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Bile acid receptor(NR1H4) ELISA kit |
|
E04B0957-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Bile acid receptor(NR1H4) ELISA kit |
|
E04B0957-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 NR1H4 Blocking Peptide |
|
33R-8322 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR1H4 antibody, catalog no. 70R-1941 |
NR1H4 Blocking Peptide |
|
DF12511-BP |
Affbiotech |
1mg |
EUR 195 |
 NR1H4 cloning plasmid |
|
CSB-CL839406HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1431
- Sequence: atgggatcaaaaatgaatctcattgaacattcccatttacctaccacagatgaattttctttttctgaaaatttatttggtgttttaacagaacaagtggcaggtcctctgggacagaacctggaagtggaaccatactcgcaatacagcaatgttcagtttccccaagttcaac
- Show more
|
|
Description: A cloning plasmid for the NR1H4 gene. |
) anti-NR1H4 (1G11) |
|
LF-MA10211 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to NR1H4 |
 Antibody) Bile Acid Receptor (NR1H4) Antibody |
|
20-abx005908 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
 Anti-Bile Acid Receptor NR1H4 Antibody |
|
A00835-1 |
BosterBio |
100ug/vial |
EUR 294 |
 Rat NR1H4 shRNA Plasmid |
|
20-abx986022 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human NR1H4 shRNA Plasmid |
|
20-abx956708 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse NR1H4 shRNA Plasmid |
|
20-abx972543 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) NR1H4 Recombinant Protein (Human) |
|
RP041740 |
ABM |
100 ug |
Ask for price |
) NR1H4 Recombinant Protein (Rat) |
|
RP214445 |
ABM |
100 ug |
Ask for price |
) NR1H4 Recombinant Protein (Mouse) |
|
RP154856 |
ABM |
100 ug |
Ask for price |
NR1H4 Recombinant Protein (Mouse) |
|
RP154859 |
ABM |
100 ug |
Ask for price |
NR1H4 Recombinant Protein (Mouse) |
|
RP154862 |
ABM |
100 ug |
Ask for price |
 (M01), Clone: 1G11) Monoclonal NR1H4 Antibody (monoclonal) (M01), Clone: 1G11 |
|
APR08817G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human NR1H4 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1G11. This antibody is applicable in WB and IF, E |
 (M02), Clone: 1B10) Monoclonal NR1H4 Antibody (monoclonal) (M02), Clone: 1B10 |
|
APR08818G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human NR1H4 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1B10. This antibody is applicable in WB and IF, E |
) Human Bile acid receptor (NR1H4) |
|
1-CSB-EP839406HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 70.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Bile acid receptor(NR1H4) expressed in E.coli |
 (pORF)) Nr1h4 ORF Vector (Rat) (pORF) |
|
ORF071483 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) NR1H4 ORF Vector (Human) (pORF) |
|
ORF013914 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Nr1h4 ORF Vector (Mouse) (pORF) |
|
ORF051620 |
ABM |
1.0 ug DNA |
EUR 506 |
Nr1h4 ORF Vector (Mouse) (pORF) |
|
ORF051621 |
ABM |
1.0 ug DNA |
EUR 506 |
Nr1h4 ORF Vector (Mouse) (pORF) |
|
ORF051622 |
ABM |
1.0 ug DNA |
EUR 506 |
 anti-Bile Acid Receptor NR1H4 |
|
YF-PA25442 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to Bile Acid Receptor NR1H4 |
 (OKAN05719)) NR1H4 ELISA Kit (Human) (OKAN05719) |
|
OKAN05719 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
|
Description: Description of target: This gene encodes a ligand-activated transcription factor that shares structural features in common with nuclear hormone receptor family members. This protein functions as a receptor for bile acids, and when bound to bile acids, binds to DNA and regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.067 ng/mL |
 (OKCD07945)) NR1H4 ELISA Kit (Human) (OKCD07945) |
|
OKCD07945 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
|
Description: Description of target: This gene encodes a ligand-activated transcription factor that shares structural features in common with nuclear hormone receptor family members. This protein functions as a receptor for bile acids, and when bound to bile acids, binds to DNA and regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.067ng/mL |
 (OKCD07946)) NR1H4 ELISA Kit (Mouse) (OKCD07946) |
|
OKCD07946 |
Aviva Systems Biology |
96 Wells |
EUR 1001 |
|
Description: Description of target: This gene encodes a ligand-activated transcription factor that shares structural features in common with nuclear hormone receptor family members. This protein functions as a receptor for bile acids, and when bound to bile acids, binds to DNA and regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.051ng/mL |
 (OKEH01446)) NR1H4 ELISA Kit (Human) (OKEH01446) |
|
OKEH01446 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: This gene encodes a ligand-activated transcription factor that shares structural features in common with nuclear hormone receptor family members. This protein functions as a receptor for bile acids, and when bound to bile acids, binds to DNA and regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
 (OKEH04757)) Nr1h4 ELISA Kit (Rat) (OKEH04757) |
|
OKEH04757 |
Aviva Systems Biology |
96 Wells |
EUR 740 |
|
Description: Description of target: Nuclear hormone receptor that is activated by farnesol metabolites.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.1 pg/mL |
) NR1H4 sgRNA CRISPR Lentivector set (Human) |
|
K1451601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Nr1h4 sgRNA CRISPR Lentivector set (Mouse) |
|
K4421001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Nr1h4 sgRNA CRISPR Lentivector set (Rat) |
|
K6835501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Anti-Bile Acid Receptor NR1H4 (1B10) |
|
YF-MA17057 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Bile Acid Receptor NR1H4 |
 ELISA kit) Rabbit nuclear receptor subfamily 1, group H, member 4 (NR1H4) ELISA kit |
|
E04N0563-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit nuclear receptor subfamily 1, group H, member 4 (NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit nuclear receptor subfamily 1, group H, member 4 (NR1H4) ELISA kit |
|
E04N0563-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit nuclear receptor subfamily 1, group H, member 4 (NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit nuclear receptor subfamily 1, group H, member 4 (NR1H4) ELISA kit |
|
E04N0563-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit nuclear receptor subfamily 1, group H, member 4 (NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA Kit) Cow Bile Acid Receptor (NR1H4) ELISA Kit |
|
abx519217-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Bile Acid Receptor (NR1H4) ELISA Kit |
|
abx519219-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rat Bile Acid Receptor (NR1H4) ELISA Kit |
|
abx519220-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 Rat Nr1h4/ Bile acid receptor ELISA Kit |
|
E0692Ra |
Sunlong |
1 Kit |
EUR 571 |
 ELISA kit) Goat Bile acid receptor(NR1H4) ELISA kit |
|
E06B0957-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Goat Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Bile acid receptor(NR1H4) ELISA kit |
|
E06B0957-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Goat Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Bile acid receptor(NR1H4) ELISA kit |
|
E06B0957-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Goat Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Rat Bile acid receptor(NR1H4) ELISA kit |
|
E02B0957-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Bile acid receptor(NR1H4) ELISA kit |
|
E02B0957-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Bile acid receptor(NR1H4) ELISA kit |
|
E02B0957-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Human Bile acid receptor(NR1H4) ELISA kit |
|
E01B0957-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Bile acid receptor(NR1H4) ELISA kit |
|
E01B0957-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Bile acid receptor(NR1H4) ELISA kit |
|
E01B0957-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Mouse Bile acid receptor(NR1H4) ELISA kit |
|
E03B0957-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Bile acid receptor(NR1H4) ELISA kit |
|
E03B0957-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Bile acid receptor(NR1H4) ELISA kit |
|
E03B0957-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Pig Bile acid receptor(NR1H4) ELISA kit |
|
E07B0957-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Porcine Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Bile acid receptor(NR1H4) ELISA kit |
|
E07B0957-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Porcine Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Bile acid receptor(NR1H4) ELISA kit |
|
E07B0957-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Porcine Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Monkey Bile acid receptor(NR1H4) ELISA kit |
|
E09B0957-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Monkey Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Bile acid receptor(NR1H4) ELISA kit |
|
E09B0957-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Monkey Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Bile acid receptor(NR1H4) ELISA kit |
|
E09B0957-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Monkey Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Dog Bile acid receptor(NR1H4) ELISA kit |
|
E08B0957-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Canine Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Bile acid receptor(NR1H4) ELISA kit |
|
E08B0957-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Canine Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Bile acid receptor(NR1H4) ELISA kit |
|
E08B0957-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Canine Bile acid receptor(NR1H4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Human NR1H4/ Bile acid receptor ELISA Kit |
|
E1786Hu |
Sunlong |
1 Kit |
EUR 571 |
 ELISA Kit) Human NR1H4(Bile acid receptor) ELISA Kit |
|
EH2066 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q96RI1
- Alias: NR1H4(Bile acid receptor)/Retinoid X receptor-interacting protein 14/RXR-interacting protein 14/Nuclear receptor subfamily 1 group H member 4/Farnesoid X-activated receptor/Farnesol receptor/H
- Show more
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
 ELISA Kit) Human Bile Acid Receptor (NR1H4) ELISA Kit |
|
abx251396-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 (Target 1)) NR1H4 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1451602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) NR1H4 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1451603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) NR1H4 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1451604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Nr1h4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4421002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Nr1h4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4421003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Nr1h4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4421004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Nr1h4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6835502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Nr1h4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6835503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Nr1h4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6835504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) NR1H4 Protein Vector (Human) (pPB-C-His) |
|
PV055653 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) NR1H4 Protein Vector (Human) (pPB-N-His) |
|
PV055654 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) NR1H4 Protein Vector (Human) (pPM-C-HA) |
|
PV055655 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) NR1H4 Protein Vector (Human) (pPM-C-His) |
|
PV055656 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) NR1H4 Protein Vector (Mouse) (pPB-C-His) |
|
PV206478 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) NR1H4 Protein Vector (Mouse) (pPB-N-His) |
|
PV206479 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) NR1H4 Protein Vector (Mouse) (pPM-C-HA) |
|
PV206480 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) NR1H4 Protein Vector (Mouse) (pPM-C-His) |
|
PV206481 |
ABM |
500 ng |
EUR 603 |
NR1H4 Protein Vector (Mouse) (pPB-C-His) |
|
PV206482 |
ABM |
500 ng |
EUR 603 |
NR1H4 Protein Vector (Mouse) (pPB-N-His) |
|
PV206483 |
ABM |
500 ng |
EUR 603 |
NR1H4 Protein Vector (Mouse) (pPM-C-HA) |
|
PV206484 |
ABM |
500 ng |
EUR 603 |
NR1H4 Protein Vector (Mouse) (pPM-C-His) |
|
PV206485 |
ABM |
500 ng |
EUR 603 |
NR1H4 Protein Vector (Mouse) (pPB-C-His) |
|
PV206486 |
ABM |
500 ng |
EUR 603 |
NR1H4 Protein Vector (Mouse) (pPB-N-His) |
|
PV206487 |
ABM |
500 ng |
EUR 603 |
NR1H4 Protein Vector (Mouse) (pPM-C-HA) |
|
PV206488 |
ABM |
500 ng |
EUR 603 |
NR1H4 Protein Vector (Mouse) (pPM-C-His) |
|
PV206489 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) NR1H4 Protein Vector (Rat) (pPB-C-His) |
|
PV285930 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) NR1H4 Protein Vector (Rat) (pPB-N-His) |
|
PV285931 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) NR1H4 Protein Vector (Rat) (pPM-C-HA) |
|
PV285932 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) NR1H4 Protein Vector (Rat) (pPM-C-His) |
|
PV285933 |
ABM |
500 ng |
EUR 603 |
 Nr1h4 3'UTR GFP Stable Cell Line |
|
TU164289 |
ABM |
1.0 ml |
Ask for price |
 NR1H4 3'UTR Luciferase Stable Cell Line |
|
TU015934 |
ABM |
1.0 ml |
EUR 1394 |
 Nr1h4 3'UTR Luciferase Stable Cell Line |
|
TU114289 |
ABM |
1.0 ml |
Ask for price |
 NR1H4 3'UTR GFP Stable Cell Line |
|
TU065934 |
ABM |
1.0 ml |
EUR 1394 |
Nr1h4 3'UTR GFP Stable Cell Line |
|
TU264160 |
ABM |
1.0 ml |
Ask for price |
Nr1h4 3'UTR Luciferase Stable Cell Line |
|
TU214160 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NR1H4 Rabbit Polyclonal Antibody
)
)
