NR4A2 Rabbit Polyclonal Antibody
NR4A2 Polyclonal Antibody |
ABP59528-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NR4A2 protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of NR4A2 from Human, Mouse, Rat. This NR4A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR4A2 protein at amino acid sequence of 100-180 |
NR4A2 Polyclonal Antibody |
ES11283-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NR4A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NR4A2 Polyclonal Antibody |
ES11283-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NR4A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NR4A2 Rabbit pAb |
A17318-100ul |
Abclonal |
100 ul |
EUR 308 |
NR4A2 Rabbit pAb |
A17318-200ul |
Abclonal |
200 ul |
EUR 459 |
NR4A2 Rabbit pAb |
A17318-20ul |
Abclonal |
20 ul |
EUR 183 |
NR4A2 Rabbit pAb |
A17318-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal NR4A2 Antibody (Center) |
APR08823G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR4A2 (Center). This antibody is tested and proven to work in the following applications: |
NR4A2 antibody |
70R-18956 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NR4A2 antibody |
NR4A2 Antibody |
35847-100ul |
SAB |
100ul |
EUR 252 |
NR4A2 antibody |
10R-1497 |
Fitzgerald |
50 ug |
EUR 242 |
Description: Mouse monoclonal NR4A2 antibody |
NR4A2 Antibody |
1-CSB-PA949280 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NR4A2. Recognizes NR4A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
NR4A2 Antibody |
1-CSB-PA449475 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NR4A2. Recognizes NR4A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
NR4A2 Antibody |
1-CSB-PA016063GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against NR4A2. Recognizes NR4A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
Polyclonal NURR1 (NR4A2) Antibody (N-term) |
APR10842G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NURR1 (NR4A2) (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal NR4A2 antibody - C-terminal region |
APR08828G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR4A2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
Nurr1/NR4A2 Antibody |
DF12678 |
Affbiotech |
200ul |
EUR 304 |
Description: Nurr1/NR4A2 Antibody detects endogenous levels of Nurr1/NR4A2. |
NR4A2 Conjugated Antibody |
C35847 |
SAB |
100ul |
EUR 397 |
Anti-NR4A2 antibody |
STJ119448 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. The encoded protein may act as a transcription factor. Mutations in this gene have been associated with disorders related to dopaminergic dysfunction, including Parkinson disease, schizophernia, and manic depression. Misregulation of this gene may be associated with rheumatoid arthritis. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. |
Anti-NR4A2 antibody |
STJ192441 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NR4A2 |
NR4A2 siRNA |
20-abx903651 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR4A2 siRNA |
20-abx926353 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR4A2 siRNA |
20-abx926354 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti- Nurr1/NR4A2 antibody |
FNab05936 |
FN Test |
100µg |
EUR 585 |
- Immunogen: nuclear receptor subfamily 4, group A, member 2
- Uniprot ID: P43354
- Research Area: Neuroscience, Signal Transduction, Metabolism, Developmental biology
|
Description: Antibody raised against Nurr1/NR4A2 |
Anti-Nurr1/NR4A2 Antibody |
PB9297 |
BosterBio |
100ug/vial |
EUR 294 |
NR4A2 cloning plasmid |
CSB-CL016063HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1797
- Sequence: atgccttgtgttcaggcgcagtatgggtcctcgcctcaaggagccagccccgcttctcagagctacagttaccactcttcgggagaatacagctccgatttcttaactccagagtttgtcaagtttagcatggacctcaccaacactgaaatcactgccaccacttctctcccca
- Show more
|
Description: A cloning plasmid for the NR4A2 gene. |
Anti-NR4A2 (4A6) |
YF-MA20377 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to NR4A2 |
Nurr1/NR4A2 Blocking Peptide |
DF12678-BP |
Affbiotech |
1mg |
EUR 195 |
Mouse NR4A2 shRNA Plasmid |
20-abx971844 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat NR4A2 shRNA Plasmid |
20-abx985815 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NR4A2 shRNA Plasmid |
20-abx953279 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NR4A2 Recombinant Protein (Human) |
RP021625 |
ABM |
100 ug |
Ask for price |
NR4A2 Recombinant Protein (Mouse) |
RP154928 |
ABM |
100 ug |
Ask for price |
NR4A2 Recombinant Protein (Mouse) |
RP154931 |
ABM |
100 ug |
Ask for price |
NR4A2 Recombinant Protein (Rat) |
RP214481 |
ABM |
100 ug |
Ask for price |
Intermediate-Early Receptor Protein (NR4A2) Antibody |
abx235936-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Monoclonal NR4A2 Antibody (monoclonal) (M02), Clone: 1G6 |
APR08824G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human NR4A2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1G6. This antibody is applicable in WB and IF, E |
Monoclonal NR4A2 Antibody (monoclonal) (M07), Clone: 4A6 |
APR08825G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human NR4A2 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 4A6. This antibody is applicable in WB and IF, E |
Monoclonal NR4A2 Antibody (monoclonal) (M08), Clone: 2G5 |
APR08826G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human NR4A2 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 2G5. This antibody is applicable in WB and IF |
Monoclonal NR4A2 Antibody (monoclonal) (M10), Clone: 1C6 |
APR08827G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human NR4A2 (monoclonal) (M10). The antibodies are raised in mouse and are from clone 1C6. This antibody is applicable in WB and IF, E |
Nr4a2 ORF Vector (Rat) (pORF) |
ORF071495 |
ABM |
1.0 ug DNA |
EUR 506 |
NR4A2 ORF Vector (Human) (pORF) |
ORF007209 |
ABM |
1.0 ug DNA |
EUR 95 |
Nr4a2 ORF Vector (Mouse) (pORF) |
ORF051644 |
ABM |
1.0 ug DNA |
EUR 506 |
Nr4a2 ORF Vector (Mouse) (pORF) |
ORF051645 |
ABM |
1.0 ug DNA |
EUR 506 |
NR4A2 ELISA Kit (Mouse) (OKCA01737) |
OKCA01737 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Transcriptional regulator which is important for the differentiation and maintenance of meso-diencephalic dopaminergic (mdDA) neurons during development. It is crucial for expression of a set of genes such as SLC6A3, SLC18A2, TH and DRD2 which are essential for development of mdDA neurons.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 1.56 pg/mL |
NR4A2 ELISA Kit (Human) (OKEH03465) |
OKEH03465 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Transcriptional regulator which is important for the differentiation and maintenance of meso-diencephalic dopaminergic (mdDA) neurons during development. It is crucial for expression of a set of genes such as SLC6A3, SLC18A2, TH and DRD2 which are essential for development of mdDA neurons.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9 pg/mL |
Nr4a2 sgRNA CRISPR Lentivector set (Rat) |
K6907301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nr4a2 sgRNA CRISPR Lentivector set (Mouse) |
K4838101 |
ABM |
3 x 1.0 ug |
EUR 339 |
NR4A2 sgRNA CRISPR Lentivector set (Human) |
K1453201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nr4a2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6907302 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr4a2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6907303 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr4a2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6907304 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr4a2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4838102 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr4a2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4838103 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr4a2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4838104 |
ABM |
1.0 ug DNA |
EUR 154 |
NR4A2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1453202 |
ABM |
1.0 ug DNA |
EUR 154 |
NR4A2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1453203 |
ABM |
1.0 ug DNA |
EUR 154 |
NR4A2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1453204 |
ABM |
1.0 ug DNA |
EUR 154 |
NR4A2 Protein Vector (Rat) (pPB-C-His) |
PV285978 |
ABM |
500 ng |
EUR 603 |
NR4A2 Protein Vector (Rat) (pPB-N-His) |
PV285979 |
ABM |
500 ng |
EUR 603 |
NR4A2 Protein Vector (Rat) (pPM-C-HA) |
PV285980 |
ABM |
500 ng |
EUR 603 |
NR4A2 Protein Vector (Rat) (pPM-C-His) |
PV285981 |
ABM |
500 ng |
EUR 603 |
NR4A2 Protein Vector (Mouse) (pPB-C-His) |
PV206574 |
ABM |
500 ng |
EUR 603 |
NR4A2 Protein Vector (Mouse) (pPB-N-His) |
PV206575 |
ABM |
500 ng |
EUR 603 |
NR4A2 Protein Vector (Mouse) (pPM-C-HA) |
PV206576 |
ABM |
500 ng |
EUR 603 |
NR4A2 Protein Vector (Mouse) (pPM-C-His) |
PV206577 |
ABM |
500 ng |
EUR 603 |
NR4A2 Protein Vector (Mouse) (pPB-C-His) |
PV206578 |
ABM |
500 ng |
EUR 603 |
NR4A2 Protein Vector (Mouse) (pPB-N-His) |
PV206579 |
ABM |
500 ng |
EUR 603 |
NR4A2 Protein Vector (Mouse) (pPM-C-HA) |
PV206580 |
ABM |
500 ng |
EUR 603 |
NR4A2 Protein Vector (Mouse) (pPM-C-His) |
PV206581 |
ABM |
500 ng |
EUR 603 |
NR4A2 Protein Vector (Human) (pPB-C-His) |
PV028833 |
ABM |
500 ng |
EUR 329 |
NR4A2 Protein Vector (Human) (pPB-N-His) |
PV028834 |
ABM |
500 ng |
EUR 329 |
NR4A2 Protein Vector (Human) (pPM-C-HA) |
PV028835 |
ABM |
500 ng |
EUR 329 |
NR4A2 Protein Vector (Human) (pPM-C-His) |
PV028836 |
ABM |
500 ng |
EUR 329 |
Nr4a2 3'UTR Luciferase Stable Cell Line |
TU114304 |
ABM |
1.0 ml |
Ask for price |
Nr4a2 3'UTR GFP Stable Cell Line |
TU164304 |
ABM |
1.0 ml |
Ask for price |
Nr4a2 3'UTR Luciferase Stable Cell Line |
TU214172 |
ABM |
1.0 ml |
Ask for price |
Nr4a2 3'UTR GFP Stable Cell Line |
TU264172 |
ABM |
1.0 ml |
Ask for price |
NR4A2 3'UTR GFP Stable Cell Line |
TU065951 |
ABM |
1.0 ml |
EUR 1394 |
NR4A2 3'UTR Luciferase Stable Cell Line |
TU015951 |
ABM |
1.0 ml |
EUR 1394 |
Nuclear receptor subfamily 4 group A member 2 (NR4A2) Antibody |
20-abx213782 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 4, Group A, Member 2 (NR4A2) Antibody |
20-abx114199 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear receptor subfamily 4 group A member 2 (NR4A2) Antibody |
20-abx241582 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR4A2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV695053 |
ABM |
1.0 ug DNA |
EUR 682 |
NR4A2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV695057 |
ABM |
1.0 ug DNA |
EUR 682 |
NR4A2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV695058 |
ABM |
1.0 ug DNA |
EUR 682 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
NR4A2 Rabbit Polyclonal Antibody