NR5A2 Rabbit Polyclonal Antibody

NR5A2 Rabbit Polyclonal Antibody

NR5A2 Rabbit pAb
A13688-100ul 100 ul
EUR 308

NR5A2 Rabbit pAb
A13688-200ul 200 ul
EUR 459

NR5A2 Rabbit pAb
A13688-20ul 20 ul
EUR 183

NR5A2 Rabbit pAb
A13688-50ul 50 ul
EUR 223

NR5A2 Rabbit pAb
A5766-100ul 100 ul
EUR 308

NR5A2 Rabbit pAb
A5766-200ul 200 ul
EUR 459

NR5A2 Rabbit pAb
A5766-20ul 20 ul
EUR 183

NR5A2 Rabbit pAb
A5766-50ul 50 ul
EUR 223

NR5A2 Rabbit pAb
A16854-100ul 100 ul
EUR 308

NR5A2 Rabbit pAb
A16854-200ul 200 ul
EUR 459

NR5A2 Rabbit pAb
A16854-20ul 20 ul
EUR 183

NR5A2 Rabbit pAb
A16854-50ul 50 ul
EUR 223

NR5A2 antibody
20R-A2453 50 ug
EUR 656
Description: Rabbit polyclonal NR5A2 antibody

NR5A2 Antibody
33028-100ul 100ul
EUR 252

NR5A2 Antibody
DF8470 200ul
EUR 304
Description: NR5A2 Antibody detects endogenous levels of total NR5A2.

NR5A2 Antibody
1-CSB-PA016066LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR5A2. Recognizes NR5A2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

NR5A2 Antibody
ABD8470 100 ug
EUR 438

Polyclonal Mouse Nr5a2 Antibody (Center)
APR17831G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Nr5a2 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal NR5A2 / LRH1 Antibody (internal region)
APG02944G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NR5A2 / LRH1 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal Nr5a2 Antibody - C-terminal region
APG02945G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Nr5a2 - C-terminal region. This antibody is tested and proven to work in the following applications:

NR5A2 Conjugated Antibody
C33028 100ul
EUR 397

anti- NR5A2 antibody
FNab05848 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • Immunogen: nuclear receptor subfamily 5, group A, member 2
  • Uniprot ID: O00482
  • Gene ID: 2494
  • Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against NR5A2

Anti-NR5A2 antibody
PAab05848 100 ug
EUR 386

Anti-NR5A2 antibody
STJ28333 100 µl
EUR 277
Description: The protein encoded by this gene is a DNA-binding zinc finger transcription factor and is a member of the fushi tarazu factor-1 subfamily of orphan nuclear receptors. The encoded protein is involved in the expression of genes for hepatitis B virus and cholesterol biosynthesis, and may be an important regulator of embryonic development.

Anti-NR5A2 antibody
STJ115643 100 µl
EUR 277
Description: The protein encoded by this gene is a DNA-binding zinc finger transcription factor and is a member of the fushi tarazu factor-1 subfamily of orphan nuclear receptors. The encoded protein is involved in the expression of genes for hepatitis B virus and cholesterol biosynthesis, and may be an important regulator of embryonic development.

Anti-NR5A2 antibody
STJ119222 100 µl
EUR 277

Anti-NR5A2 antibody
STJ192282 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NR5A2

Anti-NR5A2/Lrh 1 Rabbit Monoclonal Antibody
M01332 100ug/vial
EUR 397
Description: Rabbit Monoclonal NR5A2/Lrh 1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

NR5A2 siRNA
20-abx903654
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR5A2 siRNA
20-abx926359
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR5A2 siRNA
20-abx926360
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal NR5A2 / LRH-1 Antibody (C-Terminus)
APG02943G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR5A2 / LRH-1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal NR5A2 / LRH-1 Antibody (aa1-67)
APR11151G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR5A2 / LRH-1 (aa1-67). This antibody is tested and proven to work in the following applications:

NR5A2 Antibody, HRP conjugated
1-CSB-PA016066LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR5A2. Recognizes NR5A2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NR5A2 Antibody, FITC conjugated
1-CSB-PA016066LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR5A2. Recognizes NR5A2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NR5A2 Antibody, Biotin conjugated
1-CSB-PA016066LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR5A2. Recognizes NR5A2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NR5A2 recombinant monoclonal antibody
A5795 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human NR5A2 for WB,ELISA

Anti-NR5A2/LRH1 Antibody
PB9298 100ug/vial
EUR 294

Anti-NR5A2 / LRH1 antibody
STJ73058 100 µg
EUR 359

NR5A2 Blocking Peptide
DF8470-BP 1mg
EUR 195

NR5A2 cloning plasmid
CSB-CL016066HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1488
  • Sequence: ATGTCTTCTAATTCAGATACTGGGGATTTACAAGAGTCTTTAAAGCACGGACTTACACCTATTGTGTCTCAATTTAAAATGGTGAATTACTCCTATGATGAAGATCTGGAAGAGCTTTGTCCCGTGTGTGGAGATAAAGTGTCTGGGTACCATTATGGGCTCCTCACCTGTGAAA
  • Show more
Description: A cloning plasmid for the NR5A2 gene.

anti-NR5A2 / LRH1
YF-PA23740 50 ul
EUR 334
Description: Mouse polyclonal to NR5A2 / LRH1

NR5A2 ELISA KIT|Human
EF001321 96 Tests
EUR 689

Mouse NR5A2 shRNA Plasmid
20-abx973710
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NR5A2 shRNA Plasmid
20-abx986020
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NR5A2 shRNA Plasmid
20-abx951659
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NR5A2 Recombinant Protein (Human)
RP041746 100 ug Ask for price

NR5A2 Recombinant Protein (Mouse)
RP154940 100 ug Ask for price

NR5A2 Recombinant Protein (Mouse)
RP154943 100 ug Ask for price

NR5A2 Recombinant Protein (Rat)
RP214493 100 ug Ask for price

Anti-NR5A2 / LRH1 (aa328-338) antibody
STJ72073 100 µg
EUR 359

Nr5a2 ORF Vector (Rat) (pORF)
ORF071499 1.0 ug DNA
EUR 506

NR5A2 ORF Vector (Human) (pORF)
ORF013916 1.0 ug DNA
EUR 95

Nr5a2 ORF Vector (Mouse) (pORF)
ORF051648 1.0 ug DNA
EUR 506

Nr5a2 ORF Vector (Mouse) (pORF)
ORF051649 1.0 ug DNA
EUR 506

NR5A2 ELISA Kit (Human) (OKCD00926)
OKCD00926 96 Wells
EUR 831
Description: Description of target: Binds to the sequence element 5'-AACGACCGACCTTGAG-3' of the enhancer II of hepatitis B virus genes, a critical cis-element of their expression and regulation. May be responsible for the liver-specific activity of enhancer II, probably in combination with other hepatocyte transcription factors. Key regulator of cholesterol 7-alpha-hydroxylase gene (CYP7A) expression in liver. May also contribute to the regulation of pancreas-specific genes and play important roles in embryonic development. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

NR5A2 ELISA Kit (Rat) (OKCD00412)
OKCD00412 96 Wells
EUR 896
Description: Description of target: Binds to promoters containing the sequence element 5'-AACGACCGACCTTGAG-3'. Plays a role in the regulation of gene expression in liver and pancreas. May play a role in embryonic development (By similarity).By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL

NR5A2 ELISA Kit (Mouse) (OKEH05874)
OKEH05874 96 Wells
EUR 662
Description: Description of target: Binds to promoters containing the sequence element 5'-AACGACCGACCTTGAG-3'. Plays a role in the regulation of gene expression in liver and pancreas. May play a role in embryonic development.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.1 pg/mL

NR5A2 ELISA Kit (Rat) (OKEH07092)
OKEH07092 96 Wells
EUR 662
Description: Description of target: Binds to promoters containing the sequence element 5'-AACGACCGACCTTGAG-3'. Plays a role in the regulation of gene expression in liver and pancreas. May play a role in embryonic development.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.083 ng/mL

Nr5a2 sgRNA CRISPR Lentivector set (Mouse)
K4875201 3 x 1.0 ug
EUR 339

Nr5a2 sgRNA CRISPR Lentivector set (Rat)
K6833701 3 x 1.0 ug
EUR 339

NR5A2 sgRNA CRISPR Lentivector set (Human)
K1453501 3 x 1.0 ug
EUR 339

Nr5a2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4875202 1.0 ug DNA
EUR 154

Nr5a2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4875203 1.0 ug DNA
EUR 154

Nr5a2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4875204 1.0 ug DNA
EUR 154

Nr5a2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6833702 1.0 ug DNA
EUR 154

Nr5a2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6833703 1.0 ug DNA
EUR 154

Nr5a2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6833704 1.0 ug DNA
EUR 154

NR5A2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1453502 1.0 ug DNA
EUR 154

NR5A2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1453503 1.0 ug DNA
EUR 154

NR5A2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1453504 1.0 ug DNA
EUR 154

NR5A2 Protein Vector (Rat) (pPB-C-His)
PV285994 500 ng
EUR 603

NR5A2 Protein Vector (Rat) (pPB-N-His)
PV285995 500 ng
EUR 603

NR5A2 Protein Vector (Rat) (pPM-C-HA)
PV285996 500 ng
EUR 603

NR5A2 Protein Vector (Rat) (pPM-C-His)
PV285997 500 ng
EUR 603

NR5A2 Protein Vector (Mouse) (pPB-C-His)
PV206590 500 ng
EUR 603

NR5A2 Protein Vector (Mouse) (pPB-N-His)
PV206591 500 ng
EUR 603

NR5A2 Protein Vector (Mouse) (pPM-C-HA)
PV206592 500 ng
EUR 603

NR5A2 Protein Vector (Mouse) (pPM-C-His)
PV206593 500 ng
EUR 603

NR5A2 Protein Vector (Mouse) (pPB-C-His)
PV206594 500 ng
EUR 603

NR5A2 Protein Vector (Mouse) (pPB-N-His)
PV206595 500 ng
EUR 603

NR5A2 Protein Vector (Mouse) (pPM-C-HA)
PV206596 500 ng
EUR 603

NR5A2 Protein Vector (Mouse) (pPM-C-His)
PV206597 500 ng
EUR 603

NR5A2 Protein Vector (Human) (pPB-C-His)
PV055661 500 ng
EUR 481

NR5A2 Protein Vector (Human) (pPB-N-His)
PV055662 500 ng
EUR 481

NR5A2 Protein Vector (Human) (pPM-C-HA)
PV055663 500 ng
EUR 481

NR5A2 Protein Vector (Human) (pPM-C-His)
PV055664 500 ng
EUR 481

Nr5a2 3'UTR Luciferase Stable Cell Line
TU114307 1.0 ml Ask for price

Nr5a2 3'UTR GFP Stable Cell Line
TU164307 1.0 ml Ask for price

Nr5a2 3'UTR Luciferase Stable Cell Line
TU214175 1.0 ml Ask for price

Nr5a2 3'UTR GFP Stable Cell Line
TU264175 1.0 ml Ask for price

NR5A2 3'UTR GFP Stable Cell Line
TU065954 1.0 ml
EUR 2333

NR5A2 3'UTR Luciferase Stable Cell Line
TU015954 1.0 ml
EUR 2333

Nuclear Receptor Subfamily 5 Group A Member 2 (NR5A2) Antibody
20-abx004414
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 5 Group A Member 2 (NR5A2) Antibody
abx122664-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

NR5A2 Rabbit Polyclonal Antibody