NRARP Rabbit Polyclonal Antibody

NRARP Rabbit Polyclonal Antibody

NRARP Polyclonal Antibody
ABP59531-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human NRARP protein Applications tips:
Description: A polyclonal antibody for detection of NRARP from Human, Mouse. This NRARP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRARP protein

NRARP Polyclonal Antibody
ABP59531-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NRARP protein Applications tips:
Description: A polyclonal antibody for detection of NRARP from Human, Mouse. This NRARP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRARP protein

NRARP Polyclonal Antibody
ES10964-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NRARP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NRARP Polyclonal Antibody
ES10964-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NRARP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NRARP Rabbit pAb
A12875-100ul	Abclonal	100 ul	EUR 308

NRARP Rabbit pAb
A12875-200ul	Abclonal	200 ul	EUR 459

NRARP Rabbit pAb
A12875-20ul	Abclonal	20 ul	EUR 183

NRARP Rabbit pAb
A12875-50ul	Abclonal	50 ul	EUR 223

Polyclonal NRARP Antibody (Center)
AMM06821G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NRARP (Center). This antibody is tested and proven to work in the following applications:

NRARP Polyclonal Conjugated Antibody
C27828	SAB	100ul	EUR 397

NRARP Antibody
1-CSB-PA016069LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRARP. Recognizes NRARP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NRARP antibody
70R-3353	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal NRARP antibody raised against the middle region of NRARP

NRARP Polyclonal Antibody, HRP Conjugated
A63051	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

NRARP Polyclonal Antibody, FITC Conjugated
A63052	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

NRARP Polyclonal Antibody, Biotin Conjugated
A63053	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Anti-NRARP antibody
STJ114741	St John's Laboratory	100 µl	EUR 277

Anti-NRARP antibody
STJ73075	St John's Laboratory	100 µg	EUR 260

Anti-NRARP antibody
STJ192122	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NRARP

NRARP siRNA
20-abx926369	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NRARP siRNA
20-abx926370	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Polyclonal Goat Anti-NRARP Antibody (N Terminus)
AMM05947G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-NRARP (N Terminus). This antibody is tested and proven to work in the following applications:

NRARP Antibody, HRP conjugated
1-CSB-PA016069LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRARP. Recognizes NRARP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NRARP Antibody, FITC conjugated
1-CSB-PA016069LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRARP. Recognizes NRARP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NRARP Antibody, Biotin conjugated
1-CSB-PA016069LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRARP. Recognizes NRARP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NRARP Blocking Peptide
33R-7666	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NRARP antibody, catalog no. 70R-3353

NRARP cloning plasmid
CSB-CL770360HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 345 Sequence: atgagccaggccgagctgtccacctgctccgcgccgcagacgcagcgcatcttccaggaggctgtgcgcaagggcaacacgcaggagctgcagtcgctgctgcagaacatgaccaactgcgagttcaacgtgaactcgttcgggcccgagggccagacggcgctgcaccagtcggt Show more
Description: A cloning plasmid for the NRARP gene.

Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse)
4-PAS396Mu01	Cloud-Clone	EUR 266.00 EUR 2813.00 EUR 694.00 EUR 337.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRARP (Gln3~Tyr109) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP)

NRARP ELISA KIT|Human
EF005366	Lifescience Market	96 Tests	EUR 689

Mouse NRARP shRNA Plasmid
20-abx975984	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NRARP shRNA Plasmid
20-abx968297	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NRARP ELISA KIT
ELI-38150h	Lifescience Market	96 Tests	EUR 824

Mouse Nrarp ELISA KIT
ELI-39747m	Lifescience Market	96 Tests	EUR 865

NRARP Recombinant Protein (Human)
RP021631	ABM	100 ug	Ask for price

NRARP Recombinant Protein (Mouse)
RP154964	ABM	100 ug	Ask for price

NRARP Recombinant Protein (Rat)
RP214505	ABM	100 ug	Ask for price

Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), APC
4-PAS396Mu01-APC	Cloud-Clone	EUR 374.00 EUR 3689.00 EUR 1016.00 EUR 481.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRARP (Gln3~Tyr109) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with APC.

Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), Biotinylated
4-PAS396Mu01-Biotin	Cloud-Clone	EUR 332.00 EUR 2763.00 EUR 803.00 EUR 411.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRARP (Gln3~Tyr109) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with Biotin.

Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), Cy3
4-PAS396Mu01-Cy3	Cloud-Clone	EUR 457.00 EUR 4877.00 EUR 1313.00 EUR 600.00 EUR 267.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRARP (Gln3~Tyr109) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with Cy3.

Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), FITC
4-PAS396Mu01-FITC	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRARP (Gln3~Tyr109) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with FITC.

Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), HRP
4-PAS396Mu01-HRP	Cloud-Clone	EUR 341.00 EUR 3213.00 EUR 897.00 EUR 433.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRARP (Gln3~Tyr109) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with HRP.

Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), PE
4-PAS396Mu01-PE	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRARP (Gln3~Tyr109) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with PE.

Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), APC-Cy7
4-PAS396Mu01-APC-Cy7	Cloud-Clone	EUR 628.00 EUR 7258.00 EUR 1912.00 EUR 842.00 EUR 344.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRARP (Gln3~Tyr109) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with APC-Cy7.

NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody
abx027512-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody
abx027512-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Notch Regulated Ankyrin Repeat Protein (NRARP) Antibody
20-abx104074	Abbexa	EUR 467.00 EUR 133.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody
abx432090-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody
20-abx301239	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nrarp ORF Vector (Rat) (pORF)
ORF071503	ABM	1.0 ug DNA	EUR 506

NRARP ORF Vector (Human) (pORF)
ORF007211	ABM	1.0 ug DNA	EUR 95

Nrarp ORF Vector (Mouse) (pORF)
ORF051656	ABM	1.0 ug DNA	EUR 506

NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody (HRP)
20-abx304669	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody (FITC)
20-abx304670	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody (Biotin)
20-abx304671	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nrarp sgRNA CRISPR Lentivector set (Rat)
K6638101	ABM	3 x 1.0 ug	EUR 339

Nrarp sgRNA CRISPR Lentivector set (Mouse)
K3735501	ABM	3 x 1.0 ug	EUR 339

NRARP sgRNA CRISPR Lentivector set (Human)
K1453801	ABM	3 x 1.0 ug	EUR 339

NRARP Rabbit Polyclonal Antibody