NRARP Rabbit Polyclonal Antibody
NRARP Polyclonal Antibody |
ABP59531-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NRARP protein
- Applications tips:
|
Description: A polyclonal antibody for detection of NRARP from Human, Mouse. This NRARP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRARP protein |
NRARP Polyclonal Antibody |
ABP59531-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NRARP protein
- Applications tips:
|
Description: A polyclonal antibody for detection of NRARP from Human, Mouse. This NRARP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRARP protein |
NRARP Polyclonal Antibody |
ES10964-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NRARP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NRARP Polyclonal Antibody |
ES10964-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NRARP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NRARP Rabbit pAb |
A12875-100ul |
Abclonal |
100 ul |
EUR 308 |
NRARP Rabbit pAb |
A12875-200ul |
Abclonal |
200 ul |
EUR 459 |
NRARP Rabbit pAb |
A12875-20ul |
Abclonal |
20 ul |
EUR 183 |
NRARP Rabbit pAb |
A12875-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal NRARP Antibody (Center) |
AMM06821G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NRARP (Center). This antibody is tested and proven to work in the following applications: |
NRARP Polyclonal Conjugated Antibody |
C27828 |
SAB |
100ul |
EUR 397 |
NRARP Antibody |
1-CSB-PA016069LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRARP. Recognizes NRARP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
NRARP antibody |
70R-3353 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NRARP antibody raised against the middle region of NRARP |
NRARP Polyclonal Antibody, HRP Conjugated |
A63051 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
NRARP Polyclonal Antibody, FITC Conjugated |
A63052 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
NRARP Polyclonal Antibody, Biotin Conjugated |
A63053 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Anti-NRARP antibody |
STJ192122 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NRARP |
NRARP siRNA |
20-abx926369 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NRARP siRNA |
20-abx926370 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Polyclonal Goat Anti-NRARP Antibody (N Terminus) |
AMM05947G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-NRARP (N Terminus). This antibody is tested and proven to work in the following applications: |
NRARP Antibody, HRP conjugated |
1-CSB-PA016069LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRARP. Recognizes NRARP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NRARP Antibody, FITC conjugated |
1-CSB-PA016069LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRARP. Recognizes NRARP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NRARP Antibody, Biotin conjugated |
1-CSB-PA016069LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRARP. Recognizes NRARP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
NRARP Blocking Peptide |
33R-7666 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NRARP antibody, catalog no. 70R-3353 |
NRARP cloning plasmid |
CSB-CL770360HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 345
- Sequence: atgagccaggccgagctgtccacctgctccgcgccgcagacgcagcgcatcttccaggaggctgtgcgcaagggcaacacgcaggagctgcagtcgctgctgcagaacatgaccaactgcgagttcaacgtgaactcgttcgggcccgagggccagacggcgctgcaccagtcggt
- Show more
|
Description: A cloning plasmid for the NRARP gene. |
Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse) |
4-PAS396Mu01 |
Cloud-Clone |
-
EUR 266.00
-
EUR 2813.00
-
EUR 694.00
-
EUR 337.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRARP (Gln3~Tyr109)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP) |
Mouse NRARP shRNA Plasmid |
20-abx975984 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NRARP shRNA Plasmid |
20-abx968297 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NRARP Recombinant Protein (Human) |
RP021631 |
ABM |
100 ug |
Ask for price |
NRARP Recombinant Protein (Mouse) |
RP154964 |
ABM |
100 ug |
Ask for price |
NRARP Recombinant Protein (Rat) |
RP214505 |
ABM |
100 ug |
Ask for price |
Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), APC |
4-PAS396Mu01-APC |
Cloud-Clone |
-
EUR 374.00
-
EUR 3689.00
-
EUR 1016.00
-
EUR 481.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRARP (Gln3~Tyr109)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with APC. |
Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), Biotinylated |
4-PAS396Mu01-Biotin |
Cloud-Clone |
-
EUR 332.00
-
EUR 2763.00
-
EUR 803.00
-
EUR 411.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRARP (Gln3~Tyr109)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with Biotin. |
Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), Cy3 |
4-PAS396Mu01-Cy3 |
Cloud-Clone |
-
EUR 457.00
-
EUR 4877.00
-
EUR 1313.00
-
EUR 600.00
-
EUR 267.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRARP (Gln3~Tyr109)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with Cy3. |
Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), FITC |
4-PAS396Mu01-FITC |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRARP (Gln3~Tyr109)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with FITC. |
Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), HRP |
4-PAS396Mu01-HRP |
Cloud-Clone |
-
EUR 341.00
-
EUR 3213.00
-
EUR 897.00
-
EUR 433.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRARP (Gln3~Tyr109)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with HRP. |
Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), PE |
4-PAS396Mu01-PE |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRARP (Gln3~Tyr109)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with PE. |
Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAS396Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 628.00
-
EUR 7258.00
-
EUR 1912.00
-
EUR 842.00
-
EUR 344.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRARP (Gln3~Tyr109)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with APC-Cy7. |
NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody |
abx027512-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody |
abx027512-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Notch Regulated Ankyrin Repeat Protein (NRARP) Antibody |
20-abx104074 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody |
abx432090-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody |
20-abx301239 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nrarp ORF Vector (Rat) (pORF) |
ORF071503 |
ABM |
1.0 ug DNA |
EUR 506 |
NRARP ORF Vector (Human) (pORF) |
ORF007211 |
ABM |
1.0 ug DNA |
EUR 95 |
Nrarp ORF Vector (Mouse) (pORF) |
ORF051656 |
ABM |
1.0 ug DNA |
EUR 506 |
NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody (HRP) |
20-abx304669 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody (FITC) |
20-abx304670 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody (Biotin) |
20-abx304671 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nrarp sgRNA CRISPR Lentivector set (Rat) |
K6638101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nrarp sgRNA CRISPR Lentivector set (Mouse) |
K3735501 |
ABM |
3 x 1.0 ug |
EUR 339 |
NRARP sgRNA CRISPR Lentivector set (Human) |
K1453801 |
ABM |
3 x 1.0 ug |
EUR 339 |
NRARP Rabbit Polyclonal Antibody