NRG4 Rabbit Polyclonal Antibody

NRG4 Rabbit Polyclonal Antibody

NRG4 Polyclonal Antibody
ABP59535-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60 Applications tips:
Description: A polyclonal antibody for detection of NRG4 from Human, Mouse. This NRG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60

NRG4 Polyclonal Antibody
ABP59535-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60 Applications tips:
Description: A polyclonal antibody for detection of NRG4 from Human, Mouse. This NRG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60

NRG4 Polyclonal Antibody
ES11386-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NRG4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NRG4 Polyclonal Antibody
ES11386-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NRG4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Neuregulin 4 (NRG4) ELISA Kit
DLR-NRG4-Hu-48T	DL Develop	48T	EUR 517
Should the Human Neuregulin 4 (NRG4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Neuregulin 4 (NRG4) ELISA Kit
DLR-NRG4-Hu-96T	DL Develop	96T	EUR 673
Should the Human Neuregulin 4 (NRG4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Neuregulin 4 (NRG4) ELISA Kit
DLR-NRG4-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Neuregulin 4 (NRG4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Neuregulin 4 (NRG4) ELISA Kit
DLR-NRG4-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Neuregulin 4 (NRG4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Neuregulin 4 (NRG4) ELISA Kit
RDR-NRG4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Neuregulin 4 (NRG4) ELISA Kit
RDR-NRG4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Neuregulin 4 (NRG4) ELISA Kit
RDR-NRG4-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Neuregulin 4 (NRG4) ELISA Kit
RDR-NRG4-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Neuregulin 4 (NRG4) ELISA Kit
RD-NRG4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Neuregulin 4 (NRG4) ELISA Kit
RD-NRG4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Neuregulin 4 (NRG4) ELISA Kit
RD-NRG4-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Neuregulin 4 (NRG4) ELISA Kit
RD-NRG4-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

NRG4 Rabbit pAb
A2599-100ul	Abclonal	100 ul	EUR 308

NRG4 Rabbit pAb
A2599-200ul	Abclonal	200 ul	EUR 459

NRG4 Rabbit pAb
A2599-20ul	Abclonal	20 ul	EUR 183

NRG4 Rabbit pAb
A2599-50ul	Abclonal	50 ul	EUR 223

NRG4 antibody
70R-18964	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NRG4 antibody

NRG4 Antibody
36182-100ul	SAB	100ul	EUR 252

NRG4 antibody
38430-100ul	SAB	100ul	EUR 252

NRG4 Antibody
1-CSB-PA10569A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

NRG4 Antibody
DF7046	Affbiotech	200ul	EUR 304
Description: NRG4 Antibody detects endogenous levels of total NRG4.

NRG4 Antibody
1-CSB-PA278214	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

NRG4 Antibody
1-CSB-PA016080GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

NRG4 Antibody
ABD7046	Lifescience Market	100 ug	EUR 438

NRG4 Polyclonal Antibody, HRP Conjugated
A64125	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

NRG4 Polyclonal Antibody, FITC Conjugated
A64126	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

NRG4 Polyclonal Antibody, Biotin Conjugated
A64127	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Neuregulin 4 (NRG4) Polyclonal Antibody (Human)
4-PAC174Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRG4 (Met1~Phe62) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4)

Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse)
4-PAC174Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRG4 (Met1~Ser62) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4)

NRG4 Conjugated Antibody
C36182	SAB	100ul	EUR 397

Anti-NRG4 antibody
STJ24820	St John's Laboratory	100 µl	EUR 277

Anti-NRG4 antibody
STJ192544	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NRG4

Neuregulin 4 (NRG4) Polyclonal Antibody (Human), APC
4-PAC174Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRG4 (Met1~Phe62) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with APC.

Neuregulin 4 (NRG4) Polyclonal Antibody (Human), Biotinylated
4-PAC174Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRG4 (Met1~Phe62) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with Biotin.

Neuregulin 4 (NRG4) Polyclonal Antibody (Human), Cy3
4-PAC174Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRG4 (Met1~Phe62) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with Cy3.

Neuregulin 4 (NRG4) Polyclonal Antibody (Human), FITC
4-PAC174Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRG4 (Met1~Phe62) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with FITC.

Neuregulin 4 (NRG4) Polyclonal Antibody (Human), HRP
4-PAC174Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRG4 (Met1~Phe62) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with HRP.

Neuregulin 4 (NRG4) Polyclonal Antibody (Human), PE
4-PAC174Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRG4 (Met1~Phe62) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with PE.

Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), APC
4-PAC174Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRG4 (Met1~Ser62) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with APC.

Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), Biotinylated
4-PAC174Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRG4 (Met1~Ser62) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with Biotin.

Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), Cy3
4-PAC174Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRG4 (Met1~Ser62) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with Cy3.

Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), FITC
4-PAC174Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRG4 (Met1~Ser62) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with FITC.

Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), HRP
4-PAC174Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRG4 (Met1~Ser62) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with HRP.

Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), PE
4-PAC174Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRG4 (Met1~Ser62) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with PE.

Rabbit Neuregulin 4 (NRG4) ELISA Kit
abx362372-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

NRG4 siRNA
20-abx926394	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NRG4 siRNA
20-abx926395	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-NRG4
YF-PA22379	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to NRG4

anti-NRG4
YF-PA27668	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to NRG4

NRG4 Antibody, HRP conjugated
1-CSB-PA10569B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NRG4 Antibody, FITC conjugated
1-CSB-PA10569C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NRG4 Antibody, Biotin conjugated
1-CSB-PA10569D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Neuregulin 4 (NRG4) Antibody
20-abx177746	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Neuregulin 4 (NRG4) Antibody
20-abx212234	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Neuregulin-4 (Nrg4) Antibody
20-abx114064	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Neuregulin 4 (NRG4) Antibody
20-abx121652	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Neuregulin 4 (NRG4) Antibody
20-abx128608	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Neuregulin 4 (NRG4) Antibody
20-abx129434	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Neuregulin 4 (NRG4) Antibody
20-abx132300	Abbexa	EUR 495.00 EUR 1358.00 EUR 648.00 EUR 154.00 EUR 342.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Neuregulin 4 (NRG4) Antibody
20-abx173755	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Neuregulin 4 (NRG4) Antibody
20-abx301982	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuregulin 4 (NRG4) Antibody
20-abx002032	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Neuregulin 4 (NRG4) Polyclonal Antibody (Human), APC-Cy7
4-PAC174Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRG4 (Met1~Phe62) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with APC-Cy7.

Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC174Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRG4 (Met1~Ser62) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with APC-Cy7.

NRG4 Blocking Peptide
DF7046-BP	Affbiotech	1mg	EUR 195

NRG4 cloning plasmid
CSB-CL848829HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 348 Sequence: atgccaacagatcacgaagagccctgtggtcccagtcacaagtcgttttgcctgaatggggggctttgttatgtgatacctactattcccagcccattttgtaggtgcgttgaaaactatacaggagctcgttgtgaagaggtttttctcccaggctccagcatccaaactaaaag Show more
Description: A cloning plasmid for the NRG4 gene.

NRG4, Human Recombinant
P1580-10	Biovision	10 µg	EUR 196

Neuregulin 4 (NRG4) Antibody Pair
20-abx370478	Abbexa	EUR 1748.00 EUR 1121.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Neuregulin 4 (NRG4) Antibody (HRP)
20-abx306456	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuregulin 4 (NRG4) Antibody (FITC)
20-abx306457	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuregulin 4 (NRG4) Antibody (Biotin)
20-abx306458	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuregulin 4 (NRG4) Monoclonal Antibody (Human)
4-MAC174Hu21	Cloud-Clone	EUR 289.00 EUR 3170.00 EUR 775.00 EUR 370.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Met1~Phe62 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4)

NRG4 protein (His tag)
80R-3605	Fitzgerald	50 ug	EUR 424
Description: Purified recombinant NRG4 protein (His tag)

Mouse Nrg4 ELISA KIT
ELI-23788m	Lifescience Market	96 Tests	EUR 865

Human NRG4 ELISA KIT
ELI-44442h	Lifescience Market	96 Tests	EUR 824

Human NRG4 shRNA Plasmid
20-abx965452	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse NRG4 shRNA Plasmid
20-abx979171	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Neuregulin 4 (NRG4)
4-RPC174Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8WWG1 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 39.2kDa Isoelectric Point: 6.2
Description: Recombinant Human Neuregulin 4 expressed in: E.coli

Recombinant Neuregulin 4 (NRG4)
4-RPC174Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9WTX4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 10.5kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Neuregulin 4 expressed in: E.coli

Mouse NRG4 ELISA Kit
STJ150270	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of NRG-4 in Mouse serum, plasma and other biological fluids

Neuregulin 4 (NRG4) Monoclonal Antibody (Human), APC
4-MAC174Hu21-APC	Cloud-Clone	EUR 408.00 EUR 4175.00 EUR 1137.00 EUR 530.00 EUR 246.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Met1~Phe62 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with APC.

Neuregulin 4 (NRG4) Monoclonal Antibody (Human), Biotinylated
4-MAC174Hu21-Biotin	Cloud-Clone	EUR 357.00 EUR 3120.00 EUR 892.00 EUR 447.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Met1~Phe62 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with Biotin.

Neuregulin 4 (NRG4) Monoclonal Antibody (Human), Cy3
4-MAC174Hu21-Cy3	Cloud-Clone	EUR 503.00 EUR 5525.00 EUR 1475.00 EUR 665.00 EUR 287.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Met1~Phe62 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with Cy3.

Neuregulin 4 (NRG4) Monoclonal Antibody (Human), FITC
4-MAC174Hu21-FITC	Cloud-Clone	EUR 346.00 EUR 3360.00 EUR 930.00 EUR 444.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Met1~Phe62 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with FITC.

Neuregulin 4 (NRG4) Monoclonal Antibody (Human), HRP
4-MAC174Hu21-HRP	Cloud-Clone	EUR 370.00 EUR 3635.00 EUR 1002.00 EUR 476.00 EUR 230.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Met1~Phe62 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with HRP.

Neuregulin 4 (NRG4) Monoclonal Antibody (Human), PE
4-MAC174Hu21-PE	Cloud-Clone	EUR 346.00 EUR 3360.00 EUR 930.00 EUR 444.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Met1~Phe62 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with PE.

Neuregulin 4 (NRG4) Blocking Peptide
20-abx162626	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Human Neuregulin 4 (NRG4) Protein
20-abx166554	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Neuregulin 4 (NRG4) Protein
20-abx167365	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Neuregulin 4 (NRG4) Protein
20-abx262416	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Nrg4 ORF Vector (Rat) (pORF)
ORF071514	ABM	1.0 ug DNA	EUR 506

NRG4 ORF Vector (Human) (pORF)
ORF007218	ABM	1.0 ug DNA	EUR 95

Nrg4 ORF Vector (Mouse) (pORF)
ORF051675	ABM	1.0 ug DNA	EUR 506

NRG4 ELISA Kit (Human) (OKAN06417)
OKAN06417	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: The neuregulins, including NRG4, activate type-1 growth factor receptors (see EGFR; MIM 131550) to initiating cell-to-cell signaling through tyrosine phosphorylation (Harari et al., 1999 [PubMed 10348342]).[supplied by OMIM, Mar 2008];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

NRG4 ELISA Kit (Human) (OKCD01642)
OKCD01642	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Low affinity ligand for the ERBB4 tyrosine kinase receptor. Concomitantly recruits ERBB1 and ERBB2 coreceptors, resulting in ligand-stimulated tyrosine phosphorylation and activation of the ERBB receptors. Does not bind to the ERBB1, ERBB2 and ERBB3 receptors.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.056 ng/mL

Nrg4 ELISA Kit (Mouse) (OKCD01643)
OKCD01643	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Low affinity ligand for the ERBB4 tyrosine kinase receptor. Concomitantly recruits ERBB1 and ERBB2 coreceptors, resulting in ligand-stimulated tyrosine phosphorylation and activation of the ERBB receptors. Does not bind to the ERBB1, ERBB2 and ERBB3 receptors.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.116 ng/mL

NRG4 ELISA Kit (Mouse) (OKEI00350)
OKEI00350	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Neuregulin 4 (NRG4) Monoclonal Antibody (Human), APC-Cy7
4-MAC174Hu21-APC-Cy7	Cloud-Clone	EUR 697.00 EUR 8230.00 EUR 2155.00 EUR 940.00 EUR 373.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Met1~Phe62 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with APC-Cy7.

Human neuregulin-4 (NRG4) ELISA kit
CSB-EL016080HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human neuregulin-4 (NRG4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human neuregulin-4 (NRG4) ELISA kit
1-CSB-EL016080HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human neuregulin-4 (NRG4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse neuregulin-4 (NRG4) ELISA kit
CSB-EL016080MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse neuregulin-4 (NRG4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse neuregulin-4 (NRG4) ELISA kit
1-CSB-EL016080MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse neuregulin-4 (NRG4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Neuregulin 4 (NRG4) ELISA Kit
20-abx154449	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Neuregulin 4 (NRG4) ELISA Kit
20-abx152489	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Neuregulin 4 (NRG4) ELISA Kit
abx254297-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Neuregulin 4 (NRG4) ELISA Kit
abx252831-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Monkey Neuregulin 4 (NRG4) ELISA Kit
abx359592-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Neuregulin 4 (NRG4) ELISA Kit
abx361378-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Neuregulin 4 (NRG4) ELISA Kit
abx356190-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Neuregulin 4 (NRG4) CLIA Kit
20-abx493518	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Neuregulin 4 (NRG4) CLIA Kit
20-abx493519	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Nrg4 sgRNA CRISPR Lentivector set (Rat)
K6740101	ABM	3 x 1.0 ug	EUR 339

Nrg4 sgRNA CRISPR Lentivector set (Mouse)
K4512801	ABM	3 x 1.0 ug	EUR 339

NRG4 sgRNA CRISPR Lentivector set (Human)
K1455101	ABM	3 x 1.0 ug	EUR 339

NRG4 Neuregulin-4 Human Recombinant Protein
PROTQ8WWG1	BosterBio	Regular: 10ug	EUR 317
Description: NRG4 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 84 amino acids (1-61 a.a.) and having a molecular mass of 9.1kDa. NRG4 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Neuregulin 4 ELISA Kit (NRG4)
RK01962	Abclonal	96 Tests	EUR 521

Human Neuregulin 4 (NRG4) ELISA Kit
SEC174Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuregulin 4 (NRG4) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Neuregulin 4 (NRG4) ELISA Kit
SEC174Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuregulin 4 (NRG4) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

NRG4 Rabbit Polyclonal Antibody