셀타젠 Genetic Genotyping

NRG4 Rabbit Polyclonal Antibody

NRG4 Polyclonal Antibody

ABP59535-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60
  • Applications tips:
Description: A polyclonal antibody for detection of NRG4 from Human, Mouse. This NRG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60

NRG4 Polyclonal Antibody

ABP59535-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60
  • Applications tips:
Description: A polyclonal antibody for detection of NRG4 from Human, Mouse. This NRG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60

NRG4 Polyclonal Antibody

ABP59535-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60
  • Applications tips:
Description: A polyclonal antibody for detection of NRG4 from Human, Mouse. This NRG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRG4 protein at amino acid sequence of 11-60

NRG4 Polyclonal Antibody

A64124 100 µg
EUR 570.55
Description: Ask the seller for details

Human Neuregulin 4 (NRG4) ELISA Kit

DLR-NRG4-Hu-48T 48T
EUR 517
  • Should the Human Neuregulin 4 (NRG4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Neuregulin 4 (NRG4) ELISA Kit

DLR-NRG4-Hu-96T 96T
EUR 673
  • Should the Human Neuregulin 4 (NRG4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Neuregulin 4 (NRG4) ELISA Kit

DLR-NRG4-Mu-48T 48T
EUR 527
  • Should the Mouse Neuregulin 4 (NRG4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Neuregulin 4 (NRG4) ELISA Kit

DLR-NRG4-Mu-96T 96T
EUR 688
  • Should the Mouse Neuregulin 4 (NRG4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuregulin 4 (NRG4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Neuregulin 4 (NRG4) ELISA Kit

RD-NRG4-Hu-48Tests 48 Tests
EUR 521

Human Neuregulin 4 (NRG4) ELISA Kit

RD-NRG4-Hu-96Tests 96 Tests
EUR 723

Mouse Neuregulin 4 (NRG4) ELISA Kit

RD-NRG4-Mu-48Tests 48 Tests
EUR 533

Mouse Neuregulin 4 (NRG4) ELISA Kit

RD-NRG4-Mu-96Tests 96 Tests
EUR 740

Human Neuregulin 4 (NRG4) ELISA Kit

RDR-NRG4-Hu-48Tests 48 Tests
EUR 544

Human Neuregulin 4 (NRG4) ELISA Kit

RDR-NRG4-Hu-96Tests 96 Tests
EUR 756

Mouse Neuregulin 4 (NRG4) ELISA Kit

RDR-NRG4-Mu-48Tests 48 Tests
EUR 557

Mouse Neuregulin 4 (NRG4) ELISA Kit

RDR-NRG4-Mu-96Tests 96 Tests
EUR 774

NRG4 Rabbit pAb

A2599-100ul 100 ul
EUR 308

NRG4 Rabbit pAb

A2599-200ul 200 ul
EUR 459

NRG4 Rabbit pAb

A2599-20ul 20 ul
EUR 183

NRG4 Rabbit pAb

A2599-50ul 50 ul
EUR 223

NRG4 Antibody

ABD7046 100 ug
EUR 438

NRG4 Antibody

36182-100ul 100ul
EUR 252

NRG4 antibody

38430-100ul 100ul
EUR 252

NRG4 antibody

70R-18964 50 ul
EUR 435
Description: Rabbit polyclonal NRG4 antibody

NRG4 Antibody

DF7046 200ul
EUR 304
Description: NRG4 Antibody detects endogenous levels of total NRG4.

NRG4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

NRG4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

NRG4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

NRG4 Polyclonal Antibody, HRP Conjugated

A64125 100 µg
EUR 570.55
Description: The best epigenetics products

NRG4 Polyclonal Antibody, FITC Conjugated

A64126 100 µg
EUR 570.55
Description: kits suitable for this type of research

NRG4 Polyclonal Antibody, Biotin Conjugated

A64127 100 µg
EUR 570.55
Description: fast delivery possible

Neuregulin 4 (NRG4) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Phe62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4)

Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Ser62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4)

NRG4 Conjugated Antibody

C36182 100ul
EUR 397

Anti-NRG4 antibody

STJ24820 100 µl
EUR 277

Anti-NRG4 antibody

STJ192544 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NRG4

Neuregulin 4 (NRG4) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Phe62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with APC.

Neuregulin 4 (NRG4) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Phe62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with Biotin.

Neuregulin 4 (NRG4) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Phe62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with Cy3.

Neuregulin 4 (NRG4) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Phe62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with FITC.

Neuregulin 4 (NRG4) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Phe62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with HRP.

Neuregulin 4 (NRG4) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Phe62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with PE.

Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Ser62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with APC.

Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Ser62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with Biotin.

Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Ser62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with Cy3.

Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Ser62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with FITC.

Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Ser62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with HRP.

Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Ser62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with PE.

Rabbit Neuregulin 4 (NRG4) ELISA Kit

abx362372-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA22379 100 ug
EUR 403
Description: Rabbit polyclonal to NRG4


YF-PA27668 50 ug
EUR 363
Description: Mouse polyclonal to NRG4

Neuregulin-4 (Nrg4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuregulin 4 (NRG4) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neuregulin 4 (NRG4) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neuregulin 4 (NRG4) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Neuregulin 4 (NRG4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuregulin 4 (NRG4) Antibody

  • EUR 495.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 154.00
  • EUR 342.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neuregulin 4 (NRG4) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neuregulin 4 (NRG4) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neuregulin 4 (NRG4) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuregulin 4 (NRG4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NRG4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NRG4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NRG4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRG4. Recognizes NRG4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Neuregulin 4 (NRG4) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Phe62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with APC-Cy7.

Neuregulin 4 (NRG4) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRG4 (Met1~Ser62)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Neuregulin 4 (NRG4). This antibody is labeled with APC-Cy7.

NRG4 Blocking Peptide

DF7046-BP 1mg
EUR 195

NRG4 cloning plasmid

CSB-CL848829HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 348
  • Sequence: atgccaacagatcacgaagagccctgtggtcccagtcacaagtcgttttgcctgaatggggggctttgttatgtgatacctactattcccagcccattttgtaggtgcgttgaaaactatacaggagctcgttgtgaagaggtttttctcccaggctccagcatccaaactaaaag
  • Show more
Description: A cloning plasmid for the NRG4 gene.

NRG4, Human Recombinant

P1580-10 10 µg
EUR 196

Neuregulin 4 (NRG4) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuregulin 4 (NRG4) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuregulin 4 (NRG4) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuregulin 4 (NRG4) Antibody Pair

  • EUR 1748.00
  • EUR 1121.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Neuregulin 4 (NRG4) Monoclonal Antibody (Human)

  • EUR 289.00
  • EUR 3170.00
  • EUR 775.00
  • EUR 370.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Phe62
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4)

Mouse NRG4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NRG4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Nrg4 ELISA KIT

ELI-23788m 96 Tests
EUR 865


ELI-44442h 96 Tests
EUR 824

NRG4 protein (His tag)

80R-3605 50 ug
EUR 424
Description: Purified recombinant NRG4 protein (His tag)

Recombinant Neuregulin 4 (NRG4)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8WWG1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 39.2kDa
  • Isoelectric Point: 6.2
Description: Recombinant Human Neuregulin 4 expressed in: E.coli

Recombinant Neuregulin 4 (NRG4)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9WTX4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 10.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Neuregulin 4 expressed in: E.coli

Mouse NRG4 ELISA Kit

STJ150270 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of NRG-4 in Mouse serum, plasma and other biological fluids

Neuregulin 4 (NRG4) Monoclonal Antibody (Human), APC

  • EUR 408.00
  • EUR 4175.00
  • EUR 1137.00
  • EUR 530.00
  • EUR 246.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Phe62
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with APC.

Neuregulin 4 (NRG4) Monoclonal Antibody (Human), Biotinylated

  • EUR 357.00
  • EUR 3120.00
  • EUR 892.00
  • EUR 447.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Phe62
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with Biotin.

Neuregulin 4 (NRG4) Monoclonal Antibody (Human), Cy3

  • EUR 503.00
  • EUR 5525.00
  • EUR 1475.00
  • EUR 665.00
  • EUR 287.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Phe62
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with Cy3.

Neuregulin 4 (NRG4) Monoclonal Antibody (Human), FITC

  • EUR 346.00
  • EUR 3360.00
  • EUR 930.00
  • EUR 444.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Phe62
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with FITC.

Neuregulin 4 (NRG4) Monoclonal Antibody (Human), HRP

  • EUR 370.00
  • EUR 3635.00
  • EUR 1002.00
  • EUR 476.00
  • EUR 230.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Phe62
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with HRP.

Neuregulin 4 (NRG4) Monoclonal Antibody (Human), PE

  • EUR 346.00
  • EUR 3360.00
  • EUR 930.00
  • EUR 444.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Phe62
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with PE.

Mouse Neuregulin 4 (NRG4) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neuregulin 4 (NRG4) Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Human Neuregulin 4 (NRG4) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Neuregulin 4 (NRG4) Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

NRG4 ORF Vector (Human) (pORF)

ORF007218 1.0 ug DNA
EUR 95

Nrg4 ORF Vector (Rat) (pORF)

ORF071514 1.0 ug DNA
EUR 506

Nrg4 ORF Vector (Mouse) (pORF)

ORF051675 1.0 ug DNA
EUR 506

NRG4 ELISA Kit (Human) (OKCD01642)

OKCD01642 96 Wells
EUR 831
Description: Description of target: Low affinity ligand for the ERBB4 tyrosine kinase receptor. Concomitantly recruits ERBB1 and ERBB2 coreceptors, resulting in ligand-stimulated tyrosine phosphorylation and activation of the ERBB receptors. Does not bind to the ERBB1, ERBB2 and ERBB3 receptors.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.056 ng/mL

Nrg4 ELISA Kit (Mouse) (OKCD01643)

OKCD01643 96 Wells
EUR 857
Description: Description of target: Low affinity ligand for the ERBB4 tyrosine kinase receptor. Concomitantly recruits ERBB1 and ERBB2 coreceptors, resulting in ligand-stimulated tyrosine phosphorylation and activation of the ERBB receptors. Does not bind to the ERBB1, ERBB2 and ERBB3 receptors.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.116 ng/mL

NRG4 ELISA Kit (Human) (OKAN06417)

OKAN06417 96 Wells
EUR 792
Description: Description of target: The neuregulins, including NRG4, activate type-1 growth factor receptors (see EGFR; MIM 131550) to initiating cell-to-cell signaling through tyrosine phosphorylation (Harari et al., 1999 [PubMed 10348342]).[supplied by OMIM, Mar 2008];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

NRG4 ELISA Kit (Mouse) (OKEI00350)

OKEI00350 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Neuregulin 4 (NRG4) Monoclonal Antibody (Human), APC-Cy7

  • EUR 697.00
  • EUR 8230.00
  • EUR 2155.00
  • EUR 940.00
  • EUR 373.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Phe62
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Neuregulin 4 (NRG4). This antibody is labeled with APC-Cy7.

Pig Neuregulin 4 (NRG4) ELISA Kit

abx361378-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Neuregulin 4 (NRG4) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Neuregulin 4 (NRG4) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Chicken Neuregulin 4 (NRG4) ELISA Kit

abx356190-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Neuregulin 4 (NRG4) ELISA Kit

abx359592-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Neuregulin 4 (NRG4) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Neuregulin 4 (NRG4) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Neuregulin 4 (NRG4) ELISA Kit

abx252831-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Neuregulin 4 (NRG4) ELISA Kit

abx254297-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

NRG4 sgRNA CRISPR Lentivector set (Human)

K1455101 3 x 1.0 ug
EUR 339

Nrg4 sgRNA CRISPR Lentivector set (Mouse)

K4512801 3 x 1.0 ug
EUR 339

Human neuregulin-4 (NRG4) ELISA kit

CSB-EL016080HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human neuregulin-4 (NRG4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human neuregulin-4 (NRG4) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human neuregulin-4 (NRG4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse neuregulin-4 (NRG4) ELISA kit

CSB-EL016080MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse neuregulin-4 (NRG4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse neuregulin-4 (NRG4) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse neuregulin-4 (NRG4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Nrg4 sgRNA CRISPR Lentivector set (Rat)

K6740101 3 x 1.0 ug
EUR 339

Human Neuregulin 4 (NRG4) ELISA Kit

SEC174Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuregulin 4 (NRG4) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Neuregulin 4 (NRG4) ELISA Kit

SEC174Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuregulin 4 (NRG4) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Neuregulin 4 (NRG4) ELISA Kit

SEC174Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuregulin 4 (NRG4) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Neuregulin 4 (NRG4) ELISA Kit

SEC174Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuregulin 4 (NRG4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuregulin 4 (NRG4) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

NRG4 Rabbit Polyclonal Antibody