OLIG3 Rabbit Polyclonal Antibody
OLIG3 Polyclonal Antibody |
ABP59643-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human OLIG3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of OLIG3 from Human, Mouse. This OLIG3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OLIG3 protein |
OLIG3 Polyclonal Antibody |
ABP59643-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human OLIG3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of OLIG3 from Human, Mouse. This OLIG3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OLIG3 protein |
OLIG3 Polyclonal Antibody |
ABP59643-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human OLIG3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of OLIG3 from Human, Mouse. This OLIG3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OLIG3 protein |
OLIG3 Polyclonal Antibody |
28320-100ul |
SAB |
100ul |
EUR 252 |
OLIG3 Polyclonal Antibody |
28320-50ul |
SAB |
50ul |
EUR 187 |
OLIG3 Rabbit pAb |
A13715-100ul |
Abclonal |
100 ul |
EUR 308 |
OLIG3 Rabbit pAb |
A13715-200ul |
Abclonal |
200 ul |
EUR 459 |
OLIG3 Rabbit pAb |
A13715-20ul |
Abclonal |
20 ul |
EUR 183 |
OLIG3 Rabbit pAb |
A13715-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal OLIG3 Antibody (Center) |
AMM06898G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OLIG3 (Center). This antibody is tested and proven to work in the following applications: |
OLIG3 Polyclonal Conjugated Antibody |
C28320 |
SAB |
100ul |
EUR 397 |
OLIG3 Antibody |
abx146016-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
OLIG3 antibody |
70R-8453 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal OLIG3 antibody |
Polyclonal OLIG3 Antibody (N-term) |
AMM06899G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OLIG3 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal Mouse Olig3 Antibody (Center) |
AMM06455G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Olig3 (Center). This antibody is tested and proven to work in the following applications: |
Anti-OLIG3 antibody |
STJ192100 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to OLIG3 |
OLIG3 siRNA |
20-abx926918 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OLIG3 siRNA |
20-abx926919 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-Olig3 |
YF-PA22609 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to Olig3 |
anti-Olig3 |
YF-PA22610 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Olig3 |
OLIG3 cloning plasmid |
CSB-CL016330HU-10ug |
Cusabio |
10ug |
EUR 339 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 819
- Sequence: atgaattctgattcgagctctgtctccagcagagcttcatctccggacatggatgagatgtacctgagggaccaccaccaccgccaccaccaccaccaggagagccgtctcaactcggtctcgtccacgcagggcgatatgatgcagaagatgcccggggaaagcctctcgcgggc
- Show more
|
Description: A cloning plasmid for the OLIG3 gene. |
OLIG3 Blocking Peptide |
33R-6266 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OLIG3 antibody, catalog no. 70R-8453 |
Mouse OLIG3 shRNA Plasmid |
20-abx979297 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human OLIG3 shRNA Plasmid |
20-abx966062 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
OLIG3 Recombinant Protein (Human) |
RP022117 |
ABM |
100 ug |
Ask for price |
OLIG3 Recombinant Protein (Rat) |
RP215150 |
ABM |
100 ug |
Ask for price |
OLIG3 Recombinant Protein (Mouse) |
RP159266 |
ABM |
100 ug |
Ask for price |
OLIG3 ORF Vector (Human) (pORF) |
ORF007373 |
ABM |
1.0 ug DNA |
EUR 95 |
Olig3 ORF Vector (Rat) (pORF) |
ORF071718 |
ABM |
1.0 ug DNA |
EUR 506 |
Olig3 ORF Vector (Mouse) (pORF) |
ORF053090 |
ABM |
1.0 ug DNA |
EUR 506 |
OLIG3 sgRNA CRISPR Lentivector set (Human) |
K1482101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Olig3 sgRNA CRISPR Lentivector set (Mouse) |
K4373501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Olig3 sgRNA CRISPR Lentivector set (Rat) |
K6524801 |
ABM |
3 x 1.0 ug |
EUR 339 |
OLIG3 Rabbit Polyclonal Antibody