
셀타젠 Genetic Genotyping

OLIG3 Rabbit Polyclonal Antibody

OLIG3 Rabbit Polyclonal Antibody

OLIG3 Polyclonal Antibody

ABP59643-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human OLIG3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of OLIG3 from Human, Mouse. This OLIG3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OLIG3 protein

OLIG3 Polyclonal Antibody

ABP59643-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human OLIG3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of OLIG3 from Human, Mouse. This OLIG3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OLIG3 protein

OLIG3 Polyclonal Antibody

ABP59643-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human OLIG3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of OLIG3 from Human, Mouse. This OLIG3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OLIG3 protein

OLIG3 Polyclonal Antibody

28320-100ul 100ul
EUR 252

OLIG3 Polyclonal Antibody

28320-50ul 50ul
EUR 187

OLIG3 Rabbit pAb

A13715-100ul 100 ul
EUR 308

OLIG3 Rabbit pAb

A13715-200ul 200 ul
EUR 459

OLIG3 Rabbit pAb

A13715-20ul 20 ul
EUR 183

OLIG3 Rabbit pAb

A13715-50ul 50 ul
EUR 223

Polyclonal OLIG3 Antibody (Center)

AMM06898G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OLIG3 (Center). This antibody is tested and proven to work in the following applications:

OLIG3 Polyclonal Conjugated Antibody

C28320 100ul
EUR 397

OLIG3 Antibody

abx146016-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

OLIG3 antibody

70R-8453 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal OLIG3 antibody

Polyclonal OLIG3 Antibody (N-term)

AMM06899G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OLIG3 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Mouse Olig3 Antibody (Center)

AMM06455G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Olig3 (Center). This antibody is tested and proven to work in the following applications:

Anti-OLIG3 antibody

STJ192100 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to OLIG3

Anti-OLIG3 antibody

STJ115669 100 µl
EUR 277


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA22609 50 ul
EUR 363
Description: Mouse polyclonal to Olig3


YF-PA22610 50 ug
EUR 363
Description: Mouse polyclonal to Olig3

OLIG3 cloning plasmid

CSB-CL016330HU-10ug 10ug
EUR 339
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 819
  • Sequence: atgaattctgattcgagctctgtctccagcagagcttcatctccggacatggatgagatgtacctgagggaccaccaccaccgccaccaccaccaccaggagagccgtctcaactcggtctcgtccacgcagggcgatatgatgcagaagatgcccggggaaagcctctcgcgggc
  • Show more
Description: A cloning plasmid for the OLIG3 gene.

OLIG3 Blocking Peptide

33R-6266 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OLIG3 antibody, catalog no. 70R-8453

Mouse OLIG3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human OLIG3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OLIG3 Recombinant Protein (Human)

RP022117 100 ug Ask for price

OLIG3 Recombinant Protein (Rat)

RP215150 100 ug Ask for price

OLIG3 Recombinant Protein (Mouse)

RP159266 100 ug Ask for price

OLIG3 ORF Vector (Human) (pORF)

ORF007373 1.0 ug DNA
EUR 95

Olig3 ORF Vector (Rat) (pORF)

ORF071718 1.0 ug DNA
EUR 506

Olig3 ORF Vector (Mouse) (pORF)

ORF053090 1.0 ug DNA
EUR 506

OLIG3 sgRNA CRISPR Lentivector set (Human)

K1482101 3 x 1.0 ug
EUR 339

Olig3 sgRNA CRISPR Lentivector set (Mouse)

K4373501 3 x 1.0 ug
EUR 339

Olig3 sgRNA CRISPR Lentivector set (Rat)

K6524801 3 x 1.0 ug
EUR 339

OLIG3 Rabbit Polyclonal Antibody