셀타젠 Genetic Genotyping

OLR1 Rabbit Polyclonal Antibody

OLR1 Polyclonal Antibody

ES11225-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against OLR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

OLR1 Polyclonal Antibody

ES11225-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against OLR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

OLR1 Rabbit pAb

A12060-100ul 100 ul
EUR 308

OLR1 Rabbit pAb

A12060-200ul 200 ul
EUR 459

OLR1 Rabbit pAb

A12060-20ul 20 ul
EUR 183

OLR1 Rabbit pAb

A12060-50ul 50 ul
EUR 223

OLR1 Rabbit pAb

A1639-100ul 100 ul
EUR 308

OLR1 Rabbit pAb

A1639-200ul 200 ul
EUR 459

OLR1 Rabbit pAb

A1639-20ul 20 ul
EUR 183

OLR1 Rabbit pAb

A1639-50ul 50 ul
EUR 223

Polyclonal OLR1 Antibody (Center)

APR08857G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OLR1 (Center). This antibody is tested and proven to work in the following applications:

OLR1 antibody

70R-1739 100 ug
EUR 377
Description: Rabbit polyclonal OLR1 antibody

OLR1 antibody

70R-19041 50 ul
EUR 435
Description: Rabbit polyclonal OLR1 antibody

OLR1 Antibody

32359-100ul 100ul
EUR 252

OLR1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

OLR1 Antibody

DF6522 200ul
EUR 304
Description: OLR1 Antibody detects endogenous levels of total OLR1.

OLR1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

OLR1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

OLR1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

OLR1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:1000-1:2000, IF:1:50-1:500

OLR1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

OLR1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:10-1:50

OLR1 Antibody

ABD6522 100 ug
EUR 438

OLR1 Polyclonal Antibody, Biotin Conjugated

A53029 100 µg
EUR 570.55
Description: The best epigenetics products

OLR1 Polyclonal Antibody, FITC Conjugated

A53030 100 µg
EUR 570.55
Description: kits suitable for this type of research

OLR1 Polyclonal Antibody, HRP Conjugated

A53031 100 µg
EUR 570.55
Description: fast delivery possible

OLR1 ELISA Kit (Rabbit) (OKCD01607)

OKCD01607 96 Wells
EUR 857
Description: Description of target: Receptor that mediates the recognition, internalization and degradation of oxidatively modified low density lipoprotein (oxLDL) by vascular endothelial cells. OxLDL is a marker of atherosclerosis that induces vascular endothelial cell activation and dysfunction, resulting in pro-inflammatory responses, pro-oxidative conditions and apoptosis. Its association with oxLDL induces the activation of NF-kappa-B through an increased production of intracellular reactive oxygen and a variety of pro-atherogenic cellular responses including a reduction of nitric oxide (NO) release, monocyte adhesion and apoptosis. In addition to binding oxLDL, it acts as a receptor for the HSP70 protein involved in antigen cross-presentation to naive T-cells in dendritic cells, thereby participating in cell-mediated antigen cross-presentation. Also involved in inflammatory process, by acting as a leukocyte-adhesion molecule at the vascular interface in endotoxin-induced inflammation. Also acts as a receptor for advanced glycation end (AGE) products, activated platelets, monocytes, apoptotic cells and both Gram-negative and Gram-positive bacteria.;Species reactivity: Rabbit;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 24 pg/mL

OLR1 Conjugated Antibody

C32359 100ul
EUR 397

anti- OLR1 antibody

FNab05990 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: oxidized low density lipoprotein (lectin-like) receptor 1
  • Uniprot ID: P78380
  • Gene ID: 4973
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against OLR1

Anti-OLR1 antibody

PAab05990 100 ug
EUR 412

Anti-OLR1 antibody

STJ24865 100 µl
EUR 277
Description: This gene encodes a low density lipoprotein receptor that belongs to the C-type lectin superfamily. This gene is regulated through the cyclic AMP signaling pathway. The encoded protein binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of this gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease. Alternate splicing results in multiple transcript variants.

Anti-OLR1 antibody

STJ113959 100 µl
EUR 277
Description: This gene encodes a low density lipoprotein receptor that belongs to the C-type lectin superfamily. This gene is regulated through the cyclic AMP signaling pathway. The encoded protein binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of this gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease. Alternate splicing results in multiple transcript variants.

Anti-OLR1 antibody

STJ192383 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to OLR1

OLR1 protein

30R-2084 100 ug
EUR 322
Description: Recombinant human OLR1 protein


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OLR1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

OLR1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

OLR1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

OLR1 Blocking Peptide

33R-7471 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OLR1 antibody, catalog no. 70R-1739

OLR1 Blocking Peptide

DF6522-BP 1mg
EUR 195

OLR1 cloning plasmid

CSB-CL016331HU-10ug 10ug
EUR 339
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 822
  • Sequence: atgacttttgatgacctaaagatccagactgtgaaggaccagcctgatgagaagtcaaatggaaaaaaagctaaaggtcttcagtttctttactctccatggtggtgcctggctgctgcgactctaggggtcctttgcctgggattagtagtgaccattatggtgctgggcatgca
  • Show more
Description: A cloning plasmid for the OLR1 gene.

Anti-LOX-1/OLR1 Antibody

A00760-1 100ug/vial
EUR 294

Anti-LOX 1/Olr1 Antibody

A00760-2 100ug/vial
EUR 294

Anti-LOX 1/Olr1 Antibody

A00760-3 100ug/vial
EUR 334

Anti-LOX 1/OLR1 Antibody

PA1832 100ug/vial
EUR 294

Anti-LOX 1/OLR1 Antibody

PA1833 100ug/vial
EUR 294

Human OLR1 ELISA Kit

ELA-E1859h 96 Tests
EUR 824

Mouse Olr1 ELISA Kit

ELI-05974m 96 Tests
EUR 865

Rat OLR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human OLR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse OLR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pcDNA3.1-Olr1-Myc Plasmid

PVTB50030-2a 2 ug
EUR 356

OLR1 Recombinant Protein (Human)

RP022120 100 ug Ask for price

OLR1 Recombinant Protein (Mouse)

RP159269 100 ug Ask for price

OLR1 Recombinant Protein (Rat)

RP215153 100 ug Ask for price


STJ150190 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of OxLDL in Rat serum, plasma and other biological fluids

Mouse OLR1 ELISA Kit

STJ150267 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of OxLDL in Mouse serum, plasma and other biological fluids

Rabbit Oxidized low- density lipoprotein receptor 1, OLR1 ELISA

ELI-05975Ra 96 Tests
EUR 928

Monoclonal OLR1 Antibody (monoclonal) (M08), Clone: 2C9

APR08858G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human OLR1 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 2C9. This antibody is applicable in E

Rabbit Oxidized low density lipoprotein receptor 1(OLR1) ELISA kit

E04O0743-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Oxidized low density lipoprotein receptor 1(OLR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Oxidized low density lipoprotein receptor 1(OLR1) ELISA kit

E04O0743-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Oxidized low density lipoprotein receptor 1(OLR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Oxidized low density lipoprotein receptor 1(OLR1) ELISA kit

E04O0743-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Oxidized low density lipoprotein receptor 1(OLR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Oxidized low density lipoprotein receptor 1 (OLR1) ELISA Kit

abx257038-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Olr1 ORF Vector (Rat) (pORF)

ORF071719 1.0 ug DNA
EUR 95

OLR1 ORF Vector (Human) (pORF)

ORF007374 1.0 ug DNA
EUR 95

Olr1 ORF Vector (Mouse) (pORF)

ORF053091 1.0 ug DNA
EUR 506

pECMV-Olr1-m-FLAG Plasmid

PVT15662 2 ug
EUR 325

OLR1 ELISA Kit (Human) (OKAN05040)

OKAN05040 96 Wells
EUR 792
Description: Description of target: This gene encodes a low density lipoprotein receptor that belongs to the C-type lectin superfamily. This gene is regulated through the cyclic AMP signaling pathway. The encoded protein binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of this gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

OLR1 ELISA Kit (Mouse) (OKAN06013)

OKAN06013 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.4 pg/mL

OLR1 ELISA Kit (Bovine) (OKCD07737)

OKCD07737 96 Wells
EUR 1105
Description: Description of target: Receptor that mediates the recognition, internalization and degradation of oxidatively modified low density lipoprotein (oxLDL) by vascular endothelial cells. OxLDL is a marker of atherosclerosis that induces vascular endothelial cell activation and dysfunction, resulting in pro-inflammatory responses, pro-oxidative conditions and apoptosis. Its association with oxLDL induces the activation of NF-kappa-B through an increased production of intracellular reactive oxygen and a variety of pro-atherogenic cellular responses including a reduction of nitric oxide (NO) release, monocyte adhesion and apoptosis. In addition to binding oxLDL, it acts as a receptor for the HSP70 protein involved in antigen cross-presentation to naive T-cells in dendritic cells, thereby participating in cell-mediated antigen cross-presentation. Also involved in inflammatory process, by acting as a leukocyte-adhesion molecule at the vascular interface in endotoxin-induced inflammation. Also acts as a receptor for advanced glycation end (AGE) products, activated platelets, monocytes, apoptotic cells and both Gram-negative and Gram-positive bacteria.;Species reactivity: Bovine;Application: ELISA;Assay info: ;Sensitivity: < 13.2pg/mL

OLR1 ELISA Kit (Human) (OKCD07738)

OKCD07738 96 Wells
EUR 936
Description: Description of target: OLR1 is a receptor protein which belongs to the C-type lectin superfamily. OLR1 binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of its gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

OLR1 ELISA Kit (Mouse) (OKCD07739)

OKCD07739 96 Wells
EUR 531
Description: Description of target: Oxidized low-density lipoprotein receptor 1 (Ox-LDL receptor 1) also known as lectin-type oxidized LDL receptor 1 (LOX-1) is a protein that in humans is encoded by the OLR1 gene. It belongs to the C-type lectin superfamily. The LOX1 gene is mapped to to 12p13-p12. The protein has got the amino acids of 363. It can be detected in various tissues, highly expressed in placenta. This protein may be involved in the regulation of Fas-induced apoptosis and play a role as a scavenger receptor. The standards of this kit are recombinant mouse LOX-1 (R60-I363), with molecular weight of 36.3kDa.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 5.4pg/mL

OLR1 ELISA Kit (Rat) (OKCD07740)

OKCD07740 96 Wells
EUR 1001
Description: Description of target: receptor for oxidized low-density lipoprotein that may be involved in pathogenesis of hypertension as well as atherosclerosis.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 22.5pg/mL

Oxidized low density lipoprotein receptor 1 (OLR1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Oxidized Low Density Lipoprotein Receptor 1 (OLR1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Oxidized Low Density Lipoprotein Receptor 1 (OLR1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Oxidized Low Density Lipoprotein Receptor 1 (OLR1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Oxidized Low Density Lipoprotein Receptor 1 (OLR1) Antibody

abx034133-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Oxidized Low Density Lipoprotein Receptor 1 (OLR1) Antibody

abx034133-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Oxidized low density lipoprotein receptor 1 (OLR1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Oxidized low density lipoprotein receptor 1 (OLR1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Oxidized low density lipoprotein receptor 1 (OLR1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Oxidized low density lipoprotein receptor 1 (OLR1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Oxidized Low Density Lipoprotein Receptor 1 (OLR1) Antibody

abx235990-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Oxidized Low Density Lipoprotein Receptor 1 (OLR1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Olr1 sgRNA CRISPR Lentivector set (Rat)

K7033701 3 x 1.0 ug
EUR 339

Olr1 sgRNA CRISPR Lentivector set (Mouse)

K4413501 3 x 1.0 ug
EUR 339

OLR1 sgRNA CRISPR Lentivector set (Human)

K1482201 3 x 1.0 ug
EUR 339

Human LOX-1 /OLR1 ELISA kit

LF-EK50789 1×96T
EUR 648

OLR1 Rabbit Polyclonal Antibody