OLR1 Rabbit Polyclonal Antibody
OLR1 Polyclonal Antibody |
ES11225-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against OLR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
OLR1 Polyclonal Antibody |
ES11225-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against OLR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
OLR1 Rabbit pAb |
A12060-100ul |
Abclonal |
100 ul |
EUR 308 |
OLR1 Rabbit pAb |
A12060-200ul |
Abclonal |
200 ul |
EUR 459 |
OLR1 Rabbit pAb |
A12060-20ul |
Abclonal |
20 ul |
EUR 183 |
OLR1 Rabbit pAb |
A12060-50ul |
Abclonal |
50 ul |
EUR 223 |
OLR1 Rabbit pAb |
A1639-100ul |
Abclonal |
100 ul |
EUR 308 |
OLR1 Rabbit pAb |
A1639-200ul |
Abclonal |
200 ul |
EUR 459 |
OLR1 Rabbit pAb |
A1639-20ul |
Abclonal |
20 ul |
EUR 183 |
OLR1 Rabbit pAb |
A1639-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal OLR1 Antibody (Center) |
APR08857G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OLR1 (Center). This antibody is tested and proven to work in the following applications: |
OLR1 antibody |
70R-1739 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal OLR1 antibody |
OLR1 antibody |
70R-19041 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal OLR1 antibody |
OLR1 Antibody |
32359-100ul |
SAB |
100ul |
EUR 252 |
OLR1 Antibody |
1-CSB-PA133010 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
OLR1 Antibody |
DF6522 |
Affbiotech |
200ul |
EUR 304 |
Description: OLR1 Antibody detects endogenous levels of total OLR1. |
OLR1 Antibody |
1-CSB-PA556674 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
OLR1 Antibody |
1-CSB-PA280628 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200 |
OLR1 Antibody |
1-CSB-PA016331GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
OLR1 Antibody |
1-CSB-PA016331LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:1000-1:2000, IF:1:50-1:500 |
OLR1 Antibody |
1-CSB-PA187613 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
OLR1 Antibody |
1-CSB-PA212407 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:10-1:50 |
OLR1 Polyclonal Antibody, Biotin Conjugated |
A53029 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
OLR1 Polyclonal Antibody, FITC Conjugated |
A53030 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
OLR1 Polyclonal Antibody, HRP Conjugated |
A53031 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
OLR1 ELISA Kit (Rabbit) (OKCD01607) |
OKCD01607 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Receptor that mediates the recognition, internalization and degradation of oxidatively modified low density lipoprotein (oxLDL) by vascular endothelial cells. OxLDL is a marker of atherosclerosis that induces vascular endothelial cell activation and dysfunction, resulting in pro-inflammatory responses, pro-oxidative conditions and apoptosis. Its association with oxLDL induces the activation of NF-kappa-B through an increased production of intracellular reactive oxygen and a variety of pro-atherogenic cellular responses including a reduction of nitric oxide (NO) release, monocyte adhesion and apoptosis. In addition to binding oxLDL, it acts as a receptor for the HSP70 protein involved in antigen cross-presentation to naive T-cells in dendritic cells, thereby participating in cell-mediated antigen cross-presentation. Also involved in inflammatory process, by acting as a leukocyte-adhesion molecule at the vascular interface in endotoxin-induced inflammation. Also acts as a receptor for advanced glycation end (AGE) products, activated platelets, monocytes, apoptotic cells and both Gram-negative and Gram-positive bacteria.;Species reactivity: Rabbit;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 24 pg/mL |
OLR1 Conjugated Antibody |
C32359 |
SAB |
100ul |
EUR 397 |
anti- OLR1 antibody |
FNab05990 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: oxidized low density lipoprotein (lectin-like) receptor 1
- Uniprot ID: P78380
- Gene ID: 4973
- Research Area: Immunology, Cardiovascular, Metabolism
|
Description: Antibody raised against OLR1 |
Anti-OLR1 antibody |
STJ24865 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a low density lipoprotein receptor that belongs to the C-type lectin superfamily. This gene is regulated through the cyclic AMP signaling pathway. The encoded protein binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of this gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease. Alternate splicing results in multiple transcript variants. |
Anti-OLR1 antibody |
STJ113959 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a low density lipoprotein receptor that belongs to the C-type lectin superfamily. This gene is regulated through the cyclic AMP signaling pathway. The encoded protein binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of this gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease. Alternate splicing results in multiple transcript variants. |
Anti-OLR1 antibody |
STJ192383 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to OLR1 |
OLR1 protein |
30R-2084 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Recombinant human OLR1 protein |
OLR1 siRNA |
20-abx903747 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OLR1 siRNA |
20-abx926927 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OLR1 siRNA |
20-abx926928 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OLR1 Antibody, HRP conjugated |
1-CSB-PA016331LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
OLR1 Antibody, FITC conjugated |
1-CSB-PA016331LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
OLR1 Antibody, Biotin conjugated |
1-CSB-PA016331LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against OLR1. Recognizes OLR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
OLR1 Blocking Peptide |
33R-7471 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OLR1 antibody, catalog no. 70R-1739 |
OLR1 Blocking Peptide |
DF6522-BP |
Affbiotech |
1mg |
EUR 195 |
OLR1 cloning plasmid |
CSB-CL016331HU-10ug |
Cusabio |
10ug |
EUR 339 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 822
- Sequence: atgacttttgatgacctaaagatccagactgtgaaggaccagcctgatgagaagtcaaatggaaaaaaagctaaaggtcttcagtttctttactctccatggtggtgcctggctgctgcgactctaggggtcctttgcctgggattagtagtgaccattatggtgctgggcatgca
- Show more
|
Description: A cloning plasmid for the OLR1 gene. |
Anti-LOX-1/OLR1 Antibody |
A00760-1 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-LOX 1/Olr1 Antibody |
A00760-2 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-LOX 1/Olr1 Antibody |
A00760-3 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-LOX 1/OLR1 Antibody |
PA1832 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-LOX 1/OLR1 Antibody |
PA1833 |
BosterBio |
100ug/vial |
EUR 294 |
Rat OLR1 shRNA Plasmid |
20-abx987537 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human OLR1 shRNA Plasmid |
20-abx953299 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse OLR1 shRNA Plasmid |
20-abx979878 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
OLR1 Recombinant Protein (Human) |
RP022120 |
ABM |
100 ug |
Ask for price |
OLR1 Recombinant Protein (Mouse) |
RP159269 |
ABM |
100 ug |
Ask for price |
OLR1 Recombinant Protein (Rat) |
RP215153 |
ABM |
100 ug |
Ask for price |
Rat OLR1 ELISA Kit |
STJ150190 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of OxLDL in Rat serum, plasma and other biological fluids |
Mouse OLR1 ELISA Kit |
STJ150267 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of OxLDL in Mouse serum, plasma and other biological fluids |
Rabbit Oxidized low- density lipoprotein receptor 1, OLR1 ELISA |
ELI-05975Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Monoclonal OLR1 Antibody (monoclonal) (M08), Clone: 2C9 |
APR08858G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human OLR1 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 2C9. This antibody is applicable in E |
Rabbit Oxidized low density lipoprotein receptor 1(OLR1) ELISA kit |
E04O0743-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Oxidized low density lipoprotein receptor 1(OLR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Oxidized low density lipoprotein receptor 1(OLR1) ELISA kit |
E04O0743-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Oxidized low density lipoprotein receptor 1(OLR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Oxidized low density lipoprotein receptor 1(OLR1) ELISA kit |
E04O0743-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Oxidized low density lipoprotein receptor 1(OLR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Oxidized low density lipoprotein receptor 1 (OLR1) ELISA Kit |
abx257038-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Olr1 ORF Vector (Rat) (pORF) |
ORF071719 |
ABM |
1.0 ug DNA |
EUR 95 |
OLR1 ORF Vector (Human) (pORF) |
ORF007374 |
ABM |
1.0 ug DNA |
EUR 95 |
Olr1 ORF Vector (Mouse) (pORF) |
ORF053091 |
ABM |
1.0 ug DNA |
EUR 506 |
OLR1 ELISA Kit (Human) (OKAN05040) |
OKAN05040 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a low density lipoprotein receptor that belongs to the C-type lectin superfamily. This gene is regulated through the cyclic AMP signaling pathway. The encoded protein binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of this gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL |
OLR1 ELISA Kit (Mouse) (OKAN06013) |
OKAN06013 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.4 pg/mL |
OLR1 ELISA Kit (Bovine) (OKCD07737) |
OKCD07737 |
Aviva Systems Biology |
96 Wells |
EUR 1105 |
Description: Description of target: Receptor that mediates the recognition, internalization and degradation of oxidatively modified low density lipoprotein (oxLDL) by vascular endothelial cells. OxLDL is a marker of atherosclerosis that induces vascular endothelial cell activation and dysfunction, resulting in pro-inflammatory responses, pro-oxidative conditions and apoptosis. Its association with oxLDL induces the activation of NF-kappa-B through an increased production of intracellular reactive oxygen and a variety of pro-atherogenic cellular responses including a reduction of nitric oxide (NO) release, monocyte adhesion and apoptosis. In addition to binding oxLDL, it acts as a receptor for the HSP70 protein involved in antigen cross-presentation to naive T-cells in dendritic cells, thereby participating in cell-mediated antigen cross-presentation. Also involved in inflammatory process, by acting as a leukocyte-adhesion molecule at the vascular interface in endotoxin-induced inflammation. Also acts as a receptor for advanced glycation end (AGE) products, activated platelets, monocytes, apoptotic cells and both Gram-negative and Gram-positive bacteria.;Species reactivity: Bovine;Application: ELISA;Assay info: ;Sensitivity: < 13.2pg/mL |
OLR1 ELISA Kit (Human) (OKCD07738) |
OKCD07738 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: OLR1 is a receptor protein which belongs to the C-type lectin superfamily. OLR1 binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of its gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL |
OLR1 ELISA Kit (Mouse) (OKCD07739) |
OKCD07739 |
Aviva Systems Biology |
96 Wells |
EUR 531 |
Description: Description of target: Oxidized low-density lipoprotein receptor 1 (Ox-LDL receptor 1) also known as lectin-type oxidized LDL receptor 1 (LOX-1) is a protein that in humans is encoded by the OLR1 gene. It belongs to the C-type lectin superfamily. The LOX1 gene is mapped to to 12p13-p12. The protein has got the amino acids of 363. It can be detected in various tissues, highly expressed in placenta. This protein may be involved in the regulation of Fas-induced apoptosis and play a role as a scavenger receptor. The standards of this kit are recombinant mouse LOX-1 (R60-I363), with molecular weight of 36.3kDa.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 5.4pg/mL |
OLR1 ELISA Kit (Rat) (OKCD07740) |
OKCD07740 |
Aviva Systems Biology |
96 Wells |
EUR 1001 |
Description: Description of target: receptor for oxidized low-density lipoprotein that may be involved in pathogenesis of hypertension as well as atherosclerosis.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 22.5pg/mL |
Oxidized low density lipoprotein receptor 1 (OLR1) Antibody |
20-abx212330 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Oxidized Low Density Lipoprotein Receptor 1 (OLR1) Antibody |
20-abx114291 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Oxidized Low Density Lipoprotein Receptor 1 (OLR1) Antibody |
20-abx126293 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Oxidized Low Density Lipoprotein Receptor 1 (OLR1) Antibody |
20-abx142115 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Oxidized Low Density Lipoprotein Receptor 1 (OLR1) Antibody |
abx034133-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Oxidized Low Density Lipoprotein Receptor 1 (OLR1) Antibody |
abx034133-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Oxidized low density lipoprotein receptor 1 (OLR1) Antibody |
20-abx339341 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Oxidized low density lipoprotein receptor 1 (OLR1) Antibody |
20-abx339342 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Oxidized low density lipoprotein receptor 1 (OLR1) Antibody |
20-abx339556 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Oxidized low density lipoprotein receptor 1 (OLR1) Antibody |
20-abx339858 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Oxidized Low Density Lipoprotein Receptor 1 (OLR1) Antibody |
abx235990-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Oxidized Low Density Lipoprotein Receptor 1 (OLR1) Antibody |
20-abx001381 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Olr1 sgRNA CRISPR Lentivector set (Rat) |
K7033701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Olr1 sgRNA CRISPR Lentivector set (Mouse) |
K4413501 |
ABM |
3 x 1.0 ug |
EUR 339 |
OLR1 sgRNA CRISPR Lentivector set (Human) |
K1482201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human LOX-1 /OLR1 ELISA kit |
LF-EK50789 |
Abfrontier |
1×96T |
EUR 648 |
OLR1 Rabbit Polyclonal Antibody