PDYN Rabbit Polyclonal Antibody
 PDYN Polyclonal Antibody |
|
ABP59873-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PDYN from Human, Mouse, Rat. This PDYN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250 |
PDYN Polyclonal Antibody |
|
ABP59873-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PDYN from Human, Mouse, Rat. This PDYN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250 |
PDYN Polyclonal Antibody |
|
ES11431-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against PDYN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PDYN Polyclonal Antibody |
|
ES11431-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against PDYN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 PDYN Rabbit pAb |
|
A5830-100ul |
Abclonal |
100 ul |
EUR 308 |
PDYN Rabbit pAb |
|
A5830-200ul |
Abclonal |
200 ul |
EUR 459 |
PDYN Rabbit pAb |
|
A5830-20ul |
Abclonal |
20 ul |
EUR 183 |
PDYN Rabbit pAb |
|
A5830-50ul |
Abclonal |
50 ul |
EUR 223 |
 PDYN Polyclonal Conjugated Antibody |
|
C30667 |
SAB |
100ul |
EUR 397 |
 PDYN antibody |
|
23050-100ul |
SAB |
100ul |
EUR 390 |
PDYN antibody |
|
70R-13546 |
Fitzgerald |
100 ul |
EUR 457 |
|
Description: Affinity purified Rabbit polyclonal PDYN antibody |
 Pdyn antibody |
|
70R-9818 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal Pdyn antibody |
 Antibody) Prodynorphin (PDYN) Antibody |
|
20-abx006315 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Prodynorphin (PDYN) Antibody |
|
20-abx142135 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Prodynorphin (PDYN) Antibody |
|
abx412427-01ml |
Abbexa |
0.1 ml |
EUR 578 |
|
|
 Anti-PDYN antibody |
|
STJ28393 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is a preproprotein that is proteolytically processed to form the secreted opioid peptides beta-neoendorphin, dynorphin, leu-enkephalin, rimorphin, and leumorphin. These peptides are ligands for the kappa-type of opioid receptor. Dynorphin is involved in modulating responses to several psychoactive substances, including cocaine. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. |
Anti-PDYN antibody |
|
STJ192589 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to PDYN |
 ELISA kit) Rabbit Proenkephalin B(PDYN) ELISA kit |
|
E04P0838-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Proenkephalin B(PDYN) ELISA kit |
|
E04P0838-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Proenkephalin B(PDYN) ELISA kit |
|
E04P0838-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Pdyn Blocking Peptide |
|
33R-9191 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Pdyn antibody, catalog no. 70R-9818 |
 PDYN cloning plasmid |
|
CSB-CL017750HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 765
- Sequence: atggcctggcaggggctggtcctggctgcctgcctcctcatgttcccctccaccacagcggactgcctgtcgcggtgctccttgtgtgctgtaaagacccaggatggtcccaaacctatcaatcccctgatttgctccctgcaatgccaggctgccctgctgccctctgaggaatg
- Show more
|
|
Description: A cloning plasmid for the PDYN gene. |
 Antibody) Dynorphin A (Dyn1-17/PDYN) Antibody |
|
abx412425-01ml |
Abbexa |
0.1 ml |
EUR 578 |
|
|
 Antibody) Dynorphin B (Dyn1-13/PDYN) Antibody |
|
abx412426-01ml |
Abbexa |
0.1 ml |
EUR 578 |
|
|
 Human PDYN shRNA Plasmid |
|
20-abx953452 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) PDYN Recombinant Protein (Human) |
|
RP023017 |
ABM |
100 ug |
Ask for price |
) PDYN Recombinant Protein (Mouse) |
|
RP161207 |
ABM |
100 ug |
Ask for price |
) PDYN Recombinant Protein (Rat) |
|
RP219965 |
ABM |
100 ug |
Ask for price |
 (pORF)) Pdyn ORF Vector (Rat) (pORF) |
|
ORF073323 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) PDYN ORF Vector (Human) (pORF) |
|
ORF007673 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Pdyn ORF Vector (Mouse) (pORF) |
|
ORF053737 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKEH07559)) PDYN ELISA Kit (Bovine) (OKEH07559) |
|
OKEH07559 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
|
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
 (OKEH07560)) PDYN ELISA Kit (Pig) (OKEH07560) |
|
OKEH07560 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
|
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
 (OKEH03583)) PDYN ELISA Kit (Rat) (OKEH03583) |
|
OKEH03583 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
|
Description: Description of target: Leu-enkephalins compete with and mimic the effects of opiate drugs. They play a role in a number of physiologic functions, including pain perception and responses to stress. Dynorphin peptides differentially regulate the kappa opioid receptor. Dynorphin A(1-13) has a typical opiod activity, it is 700 times more potent than Leu-enkephalin. Leumorphin has a typical opiod activity and may have anti-apoptotic effect.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.7 pg/mL |
 ELISA kit) Rat Proenkephalin-B(PDYN) ELISA kit |
|
CSB-EL017750RA-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Rat Proenkephalin-B (PDYN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Rat Proenkephalin-B(PDYN) ELISA kit |
|
1-CSB-EL017750RA |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Rat Proenkephalin-B(PDYN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 ELISA kit) Rat Proenkephalin B(PDYN) ELISA kit |
|
E02P0838-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Proenkephalin B(PDYN) ELISA kit |
|
E02P0838-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Proenkephalin B(PDYN) ELISA kit |
|
E02P0838-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Mouse Proenkephalin B(PDYN) ELISA kit |
|
E03P0838-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Proenkephalin B(PDYN) ELISA kit |
|
E03P0838-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Proenkephalin B(PDYN) ELISA kit |
|
E03P0838-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Human Proenkephalin B(PDYN) ELISA kit |
|
E01P0838-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Proenkephalin B(PDYN) ELISA kit |
|
E01P0838-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Proenkephalin B(PDYN) ELISA kit |
|
E01P0838-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Goat Proenkephalin B(PDYN) ELISA kit |
|
E06P0838-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Proenkephalin B(PDYN) ELISA kit |
|
E06P0838-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Proenkephalin B(PDYN) ELISA kit |
|
E06P0838-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA Kit) Rat Proenkephalin-B (PDYN) ELISA Kit |
|
abx256392-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Human Proenkephalin-B (PDYN) ELISA Kit |
|
abx250393-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA kit) Dog Proenkephalin B(PDYN) ELISA kit |
|
E08P0838-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Proenkephalin B(PDYN) ELISA kit |
|
E08P0838-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Proenkephalin B(PDYN) ELISA kit |
|
E08P0838-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Rat Pdyn/ Proenkephalin-B ELISA Kit |
|
E0745Ra |
Sunlong |
1 Kit |
EUR 646 |
 ELISA kit) Pig Proenkephalin B(PDYN) ELISA kit |
|
E07P0838-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Proenkephalin B(PDYN) ELISA kit |
|
E07P0838-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Proenkephalin B(PDYN) ELISA kit |
|
E07P0838-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Human PDYN/ Proenkephalin-B ELISA Kit |
|
E1902Hu |
Sunlong |
1 Kit |
EUR 605 |
 ELISA kit) Monkey Proenkephalin B(PDYN) ELISA kit |
|
E09P0838-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Proenkephalin B(PDYN) ELISA kit |
|
E09P0838-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Proenkephalin B(PDYN) ELISA kit |
|
E09P0838-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA Kit) Human PDYN(Proenkephalin-B) ELISA Kit |
|
EH1143 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: P01213
- Alias: PDYN/Proenkephalin-B/Beta-neoendorphin-dynorphin/Preprodynorphin
|
|
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml |
 ELISA Kit) Cow Proenkephalin-B (PDYN) ELISA Kit |
|
abx514688-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Proenkephalin-B (PDYN) ELISA Kit |
|
abx514690-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Pig Proenkephalin-B (PDYN) ELISA Kit |
|
abx514691-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Pdyn(Proenkephalin-B) ELISA Kit |
|
EM7991 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 31.25-2000 pg/ml
- Uniprot ID: O35417
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml |
 ELISA Kit) Rat Pdyn(Proenkephalin-B) ELISA Kit |
|
ER0414 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: P06300
- Alias: Pdyn/PDYN/Proenkephalin-B/Beta-neoendorphin-dynorphin/Preprodynorphin
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.9pg/ml |
) Pdyn sgRNA CRISPR Lentivector set (Mouse) |
|
K4928201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Pdyn sgRNA CRISPR Lentivector set (Rat) |
|
K6785801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) PDYN sgRNA CRISPR Lentivector set (Human) |
|
K1624401 |
ABM |
3 x 1.0 ug |
EUR 339 |
 ELISA kit) Guinea pig Proenkephalin B(PDYN) ELISA kit |
|
E05P0838-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Proenkephalin B(PDYN) ELISA kit |
|
E05P0838-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Proenkephalin B(PDYN) ELISA kit |
|
E05P0838-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
) Recombinant Human Proenkephalin-B/PDYN(C-6His) |
|
C812-10ug |
Novoprotein |
10ug |
EUR 202 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4. |
Recombinant Human Proenkephalin-B/PDYN(C-6His) |
|
C812-1mg |
Novoprotein |
1mg |
EUR 2486 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4. |
Recombinant Human Proenkephalin-B/PDYN(C-6His) |
|
C812-500ug |
Novoprotein |
500ug |
EUR 1613 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4. |
Recombinant Human Proenkephalin-B/PDYN(C-6His) |
|
C812-50ug |
Novoprotein |
50ug |
EUR 496 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4. |
) ELISA kit for Rat Proenkephalin-B (PDYN) |
|
KTE100489-48T |
Abbkine |
48T |
EUR 332 |
- Prodynorphin is a opioid polypeptide hormone involved with chemical signal transduction and cell communication. The gene for prodynorphin is expressed in the endometrium and the striatum, and its gene map locus is 20pter-p12. Prodynorphin is a basic
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Proenkephalin-B (PDYN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Proenkephalin-B (PDYN) |
|
KTE100489-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Prodynorphin is a opioid polypeptide hormone involved with chemical signal transduction and cell communication. The gene for prodynorphin is expressed in the endometrium and the striatum, and its gene map locus is 20pter-p12. Prodynorphin is a basic
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Proenkephalin-B (PDYN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Proenkephalin-B (PDYN) |
|
KTE100489-96T |
Abbkine |
96T |
EUR 539 |
- Prodynorphin is a opioid polypeptide hormone involved with chemical signal transduction and cell communication. The gene for prodynorphin is expressed in the endometrium and the striatum, and its gene map locus is 20pter-p12. Prodynorphin is a basic
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Proenkephalin-B (PDYN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 (Target 1)) Pdyn sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4928202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Pdyn sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4928203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Pdyn sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4928204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Pdyn sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6785802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Pdyn sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6785803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Pdyn sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6785804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) PDYN sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1624402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) PDYN sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1624403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) PDYN sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1624404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) PDYN Protein Vector (Rat) (pPB-C-His) |
|
PV293290 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) PDYN Protein Vector (Rat) (pPB-N-His) |
|
PV293291 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) PDYN Protein Vector (Rat) (pPM-C-HA) |
|
PV293292 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) PDYN Protein Vector (Rat) (pPM-C-His) |
|
PV293293 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) PDYN Protein Vector (Mouse) (pPB-C-His) |
|
PV214946 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) PDYN Protein Vector (Mouse) (pPB-N-His) |
|
PV214947 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) PDYN Protein Vector (Mouse) (pPM-C-HA) |
|
PV214948 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) PDYN Protein Vector (Mouse) (pPM-C-His) |
|
PV214949 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) PDYN Protein Vector (Human) (pPB-C-His) |
|
PV030689 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) PDYN Protein Vector (Human) (pPB-N-His) |
|
PV030690 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) PDYN Protein Vector (Human) (pPM-C-HA) |
|
PV030691 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) PDYN Protein Vector (Human) (pPM-C-His) |
|
PV030692 |
ABM |
500 ng |
EUR 329 |
 Pdyn 3'UTR Luciferase Stable Cell Line |
|
TU116164 |
ABM |
1.0 ml |
Ask for price |
 Pdyn 3'UTR GFP Stable Cell Line |
|
TU166164 |
ABM |
1.0 ml |
Ask for price |
Pdyn 3'UTR Luciferase Stable Cell Line |
|
TU216051 |
ABM |
1.0 ml |
Ask for price |
Pdyn 3'UTR GFP Stable Cell Line |
|
TU266051 |
ABM |
1.0 ml |
Ask for price |
 PDYN 3'UTR GFP Stable Cell Line |
|
TU067698 |
ABM |
1.0 ml |
EUR 1521 |
 PDYN 3'UTR Luciferase Stable Cell Line |
|
TU017698 |
ABM |
1.0 ml |
EUR 1521 |
 : 96 Wells (OKEH02066)) PDYN ELISA Kit (Human) : 96 Wells (OKEH02066) |
|
OKEH02066 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: The protein encoded by this gene is a preproprotein that is proteolytically processed to form the secreted opioid peptides beta-neoendorphin, dynorphin, leu-enkephalin, rimorphin, and leumorphin. These peptides are ligands for the kappa-type of opioid receptor. Dynorphin is involved in modulating responses to several psychoactive substances, including cocaine. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 21 pg/mL |
 Pdyn ELISA Kit| Rat Proenkephalin-B ELISA Kit |
|
EF017261 |
Lifescience Market |
96 Tests |
EUR 689 |
 Pdyn ELISA Kit| Mouse Proenkephalin-B ELISA Kit |
|
EF015939 |
Lifescience Market |
96 Tests |
EUR 689 |
 PDYN ELISA Kit| Bovine Proenkephalin-B ELISA Kit |
|
EF011786 |
Lifescience Market |
96 Tests |
EUR 689 |
 (CMV) (pLenti-GIII-CMV)) PDYN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV657271 |
ABM |
1.0 ug DNA |
EUR 514 |
 (UbC) (pLenti-GIII-UbC)) PDYN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV657275 |
ABM |
1.0 ug DNA |
EUR 514 |
 (EF1a) (pLenti-GIII-EF1a)) PDYN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV657276 |
ABM |
1.0 ug DNA |
EUR 514 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
PDYN Rabbit Polyclonal Antibody
ELISA Kit)
