
셀타젠 Genetic Genotyping

PDYN Rabbit Polyclonal Antibody

PDYN Rabbit Polyclonal Antibody

PDYN Polyclonal Antibody

ABP59873-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250
  • Applications tips:
Description: A polyclonal antibody for detection of PDYN from Human, Mouse, Rat. This PDYN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250

PDYN Polyclonal Antibody

ABP59873-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250
  • Applications tips:
Description: A polyclonal antibody for detection of PDYN from Human, Mouse, Rat. This PDYN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDYN protein at amino acid sequence of 201-250

PDYN Polyclonal Antibody

ES11431-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PDYN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PDYN Polyclonal Antibody

ES11431-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PDYN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PDYN Rabbit pAb

A5830-100ul 100 ul
EUR 308

PDYN Rabbit pAb

A5830-200ul 200 ul
EUR 459

PDYN Rabbit pAb

A5830-20ul 20 ul
EUR 183

PDYN Rabbit pAb

A5830-50ul 50 ul
EUR 223

PDYN Polyclonal Conjugated Antibody

C30667 100ul
EUR 397

PDYN antibody

23050-100ul 100ul
EUR 390

PDYN antibody

70R-13546 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PDYN antibody

Pdyn antibody

70R-9818 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Pdyn antibody

Prodynorphin (PDYN) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prodynorphin (PDYN) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prodynorphin (PDYN) Antibody

abx412427-01ml 0.1 ml
EUR 578
  • Shipped within 1 week.

Anti-PDYN antibody

STJ28393 100 µl
EUR 277
Description: The protein encoded by this gene is a preproprotein that is proteolytically processed to form the secreted opioid peptides beta-neoendorphin, dynorphin, leu-enkephalin, rimorphin, and leumorphin. These peptides are ligands for the kappa-type of opioid receptor. Dynorphin is involved in modulating responses to several psychoactive substances, including cocaine. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene.

Anti-PDYN antibody

STJ192589 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PDYN

Pdyn/ Rat Pdyn ELISA Kit

ELI-03278r 96 Tests
EUR 886

Rabbit Proenkephalin B(PDYN) ELISA kit

E04P0838-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Proenkephalin B(PDYN) ELISA kit

E04P0838-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Proenkephalin B(PDYN) ELISA kit

E04P0838-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pdyn Blocking Peptide

33R-9191 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Pdyn antibody, catalog no. 70R-9818

PDYN cloning plasmid

CSB-CL017750HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Sequence: atggcctggcaggggctggtcctggctgcctgcctcctcatgttcccctccaccacagcggactgcctgtcgcggtgctccttgtgtgctgtaaagacccaggatggtcccaaacctatcaatcccctgatttgctccctgcaatgccaggctgccctgctgccctctgaggaatg
  • Show more
Description: A cloning plasmid for the PDYN gene.

Dynorphin A (Dyn1-17/PDYN) Antibody

abx412425-01ml 0.1 ml
EUR 578
  • Shipped within 1 week.

Dynorphin B (Dyn1-13/PDYN) Antibody

abx412426-01ml 0.1 ml
EUR 578
  • Shipped within 1 week.


ELA-E10214h 96 Tests
EUR 824


EF002075 96 Tests
EUR 689

Human PDYN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PDYN Recombinant Protein (Human)

RP023017 100 ug Ask for price

PDYN Recombinant Protein (Mouse)

RP161207 100 ug Ask for price

PDYN Recombinant Protein (Rat)

RP219965 100 ug Ask for price

Pdyn ORF Vector (Rat) (pORF)

ORF073323 1.0 ug DNA
EUR 506

PDYN ORF Vector (Human) (pORF)

ORF007673 1.0 ug DNA
EUR 95

Pdyn ORF Vector (Mouse) (pORF)

ORF053737 1.0 ug DNA
EUR 506

Human Prodynorphin(PDYN)ELISA Kit

QY-E01888 96T
EUR 361

PDYN ELISA Kit (Bovine) (OKEH07559)

OKEH07559 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

PDYN ELISA Kit (Pig) (OKEH07560)

OKEH07560 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

PDYN ELISA Kit (Rat) (OKEH03583)

OKEH03583 96 Wells
EUR 779
Description: Description of target: Leu-enkephalins compete with and mimic the effects of opiate drugs. They play a role in a number of physiologic functions, including pain perception and responses to stress. Dynorphin peptides differentially regulate the kappa opioid receptor. Dynorphin A(1-13) has a typical opiod activity, it is 700 times more potent than Leu-enkephalin. Leumorphin has a typical opiod activity and may have anti-apoptotic effect.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.7 pg/mL

Rat Proenkephalin-B(PDYN) ELISA kit

CSB-EL017750RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Proenkephalin-B (PDYN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Proenkephalin-B(PDYN) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Proenkephalin-B(PDYN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Proenkephalin B(PDYN) ELISA kit

E02P0838-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Proenkephalin B(PDYN) ELISA kit

E02P0838-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Proenkephalin B(PDYN) ELISA kit

E02P0838-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Proenkephalin B(PDYN) ELISA kit

E03P0838-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Proenkephalin B(PDYN) ELISA kit

E03P0838-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Proenkephalin B(PDYN) ELISA kit

E03P0838-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Proenkephalin B(PDYN) ELISA kit

E01P0838-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Proenkephalin B(PDYN) ELISA kit

E01P0838-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Proenkephalin B(PDYN) ELISA kit

E01P0838-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Proenkephalin B(PDYN) ELISA kit

E06P0838-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Proenkephalin B(PDYN) ELISA kit

E06P0838-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Proenkephalin B(PDYN) ELISA kit

E06P0838-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Proenkephalin-B (PDYN) ELISA Kit

abx256392-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Proenkephalin-B (PDYN) ELISA Kit

abx250393-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Dog Proenkephalin B(PDYN) ELISA kit

E08P0838-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Proenkephalin B(PDYN) ELISA kit

E08P0838-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Proenkephalin B(PDYN) ELISA kit

E08P0838-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Pdyn/ Proenkephalin-B ELISA Kit

E0745Ra 1 Kit
EUR 646

Pig Proenkephalin B(PDYN) ELISA kit

E07P0838-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Proenkephalin B(PDYN) ELISA kit

E07P0838-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Proenkephalin B(PDYN) ELISA kit

E07P0838-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PDYN/ Proenkephalin-B ELISA Kit

E1902Hu 1 Kit
EUR 605

Monkey Proenkephalin B(PDYN) ELISA kit

E09P0838-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Proenkephalin B(PDYN) ELISA kit

E09P0838-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Proenkephalin B(PDYN) ELISA kit

E09P0838-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PDYN(Proenkephalin-B) ELISA Kit

EH1143 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P01213
  • Alias: PDYN/Proenkephalin-B/Beta-neoendorphin-dynorphin/Preprodynorphin
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Porcine Proenkephalin- B, PDYN ELISA KIT

ELI-03279p 96 Tests
EUR 928

Mouse Proenkephalin- B, Pdyn ELISA KIT

ELI-03280m 96 Tests
EUR 865

Human Proenkephalin- B, PDYN ELISA KIT

ELI-03281h 96 Tests
EUR 824

Bovine Proenkephalin- B, PDYN ELISA KIT

ELI-03282b 96 Tests
EUR 928

Cow Proenkephalin-B (PDYN) ELISA Kit

abx514688-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Proenkephalin-B (PDYN) ELISA Kit

abx514690-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Pig Proenkephalin-B (PDYN) ELISA Kit

abx514691-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Pdyn(Proenkephalin-B) ELISA Kit

EM7991 96T
EUR 567.6
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: O35417
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml

Rat Pdyn(Proenkephalin-B) ELISA Kit

ER0414 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P06300
  • Alias: Pdyn/PDYN/Proenkephalin-B/Beta-neoendorphin-dynorphin/Preprodynorphin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.9pg/ml

Pdyn sgRNA CRISPR Lentivector set (Mouse)

K4928201 3 x 1.0 ug
EUR 339

Pdyn sgRNA CRISPR Lentivector set (Rat)

K6785801 3 x 1.0 ug
EUR 339

PDYN sgRNA CRISPR Lentivector set (Human)

K1624401 3 x 1.0 ug
EUR 339

Guinea pig Proenkephalin B(PDYN) ELISA kit

E05P0838-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Proenkephalin B(PDYN) ELISA kit

E05P0838-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Proenkephalin B(PDYN) ELISA kit

E05P0838-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant Human Proenkephalin-B/PDYN(C-6His)

C812-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Proenkephalin-B/PDYN(C-6His)

C812-1mg 1mg
EUR 2486
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Proenkephalin-B/PDYN(C-6His)

C812-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Proenkephalin-B/PDYN(C-6His)

C812-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

ELISA kit for Rat Proenkephalin-B (PDYN)

KTE100489-48T 48T
EUR 332
  • Prodynorphin is a opioid polypeptide hormone involved with chemical signal transduction and cell communication. The gene for prodynorphin is expressed in the endometrium and the striatum, and its gene map locus is 20pter-p12. Prodynorphin is a basic
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Proenkephalin-B (PDYN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Proenkephalin-B (PDYN)

KTE100489-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Prodynorphin is a opioid polypeptide hormone involved with chemical signal transduction and cell communication. The gene for prodynorphin is expressed in the endometrium and the striatum, and its gene map locus is 20pter-p12. Prodynorphin is a basic
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Proenkephalin-B (PDYN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Proenkephalin-B (PDYN)

KTE100489-96T 96T
EUR 539
  • Prodynorphin is a opioid polypeptide hormone involved with chemical signal transduction and cell communication. The gene for prodynorphin is expressed in the endometrium and the striatum, and its gene map locus is 20pter-p12. Prodynorphin is a basic
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Proenkephalin-B (PDYN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Pdyn sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4928202 1.0 ug DNA
EUR 154

Pdyn sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4928203 1.0 ug DNA
EUR 154

Pdyn sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4928204 1.0 ug DNA
EUR 154

Pdyn sgRNA CRISPR Lentivector (Rat) (Target 1)

K6785802 1.0 ug DNA
EUR 154

Pdyn sgRNA CRISPR Lentivector (Rat) (Target 2)

K6785803 1.0 ug DNA
EUR 154

Pdyn sgRNA CRISPR Lentivector (Rat) (Target 3)

K6785804 1.0 ug DNA
EUR 154

PDYN sgRNA CRISPR Lentivector (Human) (Target 1)

K1624402 1.0 ug DNA
EUR 154

PDYN sgRNA CRISPR Lentivector (Human) (Target 2)

K1624403 1.0 ug DNA
EUR 154

PDYN sgRNA CRISPR Lentivector (Human) (Target 3)

K1624404 1.0 ug DNA
EUR 154

PDYN Protein Vector (Rat) (pPB-C-His)

PV293290 500 ng
EUR 603

PDYN Protein Vector (Rat) (pPB-N-His)

PV293291 500 ng
EUR 603

PDYN Protein Vector (Rat) (pPM-C-HA)

PV293292 500 ng
EUR 603

PDYN Protein Vector (Rat) (pPM-C-His)

PV293293 500 ng
EUR 603

PDYN Protein Vector (Mouse) (pPB-C-His)

PV214946 500 ng
EUR 603

PDYN Protein Vector (Mouse) (pPB-N-His)

PV214947 500 ng
EUR 603

PDYN Protein Vector (Mouse) (pPM-C-HA)

PV214948 500 ng
EUR 603

PDYN Protein Vector (Mouse) (pPM-C-His)

PV214949 500 ng
EUR 603

PDYN Protein Vector (Human) (pPB-C-His)

PV030689 500 ng
EUR 329

PDYN Protein Vector (Human) (pPB-N-His)

PV030690 500 ng
EUR 329

PDYN Protein Vector (Human) (pPM-C-HA)

PV030691 500 ng
EUR 329

PDYN Protein Vector (Human) (pPM-C-His)

PV030692 500 ng
EUR 329

Pdyn 3'UTR Luciferase Stable Cell Line

TU116164 1.0 ml Ask for price

Pdyn 3'UTR GFP Stable Cell Line

TU166164 1.0 ml Ask for price

Pdyn 3'UTR Luciferase Stable Cell Line

TU216051 1.0 ml Ask for price

Pdyn 3'UTR GFP Stable Cell Line

TU266051 1.0 ml Ask for price

PDYN 3'UTR GFP Stable Cell Line

TU067698 1.0 ml
EUR 1521

PDYN 3'UTR Luciferase Stable Cell Line

TU017698 1.0 ml
EUR 1521

PDYN ELISA Kit (Human) : 96 Wells (OKEH02066)

OKEH02066 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene is a preproprotein that is proteolytically processed to form the secreted opioid peptides beta-neoendorphin, dynorphin, leu-enkephalin, rimorphin, and leumorphin. These peptides are ligands for the kappa-type of opioid receptor. Dynorphin is involved in modulating responses to several psychoactive substances, including cocaine. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 21 pg/mL

Pdyn ELISA Kit| Rat Proenkephalin-B ELISA Kit

EF017261 96 Tests
EUR 689

Pdyn ELISA Kit| Mouse Proenkephalin-B ELISA Kit

EF015939 96 Tests
EUR 689

PDYN ELISA Kit| Bovine Proenkephalin-B ELISA Kit

EF011786 96 Tests
EUR 689

PDYN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV657271 1.0 ug DNA
EUR 514

PDYN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV657275 1.0 ug DNA
EUR 514

PDYN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV657276 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

PDYN Rabbit Polyclonal Antibody