PGS1 Rabbit Polyclonal Antibody
PGS1 Polyclonal Antibody |
ABP59893-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PGS1 protein at amino acid sequence of 110-190
- Applications tips:
|
Description: A polyclonal antibody for detection of PGS1 from Human, Mouse, Rat. This PGS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PGS1 protein at amino acid sequence of 110-190 |
PGS1 Polyclonal Antibody |
ABP59893-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PGS1 protein at amino acid sequence of 110-190
- Applications tips:
|
Description: A polyclonal antibody for detection of PGS1 from Human, Mouse, Rat. This PGS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PGS1 protein at amino acid sequence of 110-190 |
PGS1 Polyclonal Antibody |
ES11314-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PGS1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PGS1 Polyclonal Antibody |
ES11314-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PGS1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PGS1 Rabbit pAb |
A14308-100ul |
Abclonal |
100 ul |
EUR 308 |
PGS1 Rabbit pAb |
A14308-200ul |
Abclonal |
200 ul |
EUR 459 |
PGS1 Rabbit pAb |
A14308-20ul |
Abclonal |
20 ul |
EUR 183 |
PGS1 Rabbit pAb |
A14308-50ul |
Abclonal |
50 ul |
EUR 223 |
PGS1 Rabbit pAb |
A4309-100ul |
Abclonal |
100 ul |
EUR 308 |
PGS1 Rabbit pAb |
A4309-200ul |
Abclonal |
200 ul |
EUR 459 |
PGS1 Rabbit pAb |
A4309-20ul |
Abclonal |
20 ul |
Ask for price |
PGS1 Rabbit pAb |
A4309-50ul |
Abclonal |
50 ul |
Ask for price |
PGS1 Polyclonal Conjugated Antibody |
C28496 |
SAB |
100ul |
EUR 397 |
Polyclonal PGS1 Antibody (Center) |
APR09102G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PGS1 (Center). This antibody is tested and proven to work in the following applications: |
PGS1 antibody |
70R-19249 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PGS1 antibody |
PGS1 antibody |
70R-1011 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal PGS1 antibody raised against the C terminal of PGS1 |
PGS1 Antibody |
1-CSB-PA653479LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PGS1. Recognizes PGS1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
PGS1 Antibody |
1-CSB-PA017878GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PGS1. Recognizes PGS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF |
PGS1 antibody |
70R-5274 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PGS1 antibody raised against the C terminal of PGS1 |
PGS1 Polyclonal Antibody, HRP Conjugated |
A64891 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
PGS1 Polyclonal Antibody, FITC Conjugated |
A64892 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
PGS1 Polyclonal Antibody, Biotin Conjugated |
A64893 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
anti- PGS1 antibody |
FNab06367 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: phosphatidylglycerophosphate synthase 1
- Uniprot ID: Q32NB8
- Gene ID: 9489
- Research Area: Metabolism
|
Description: Antibody raised against PGS1 |
Anti-PGS1 antibody |
STJ192472 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PGS1 |
PGS1 siRNA |
20-abx928400 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PGS1 siRNA |
20-abx928401 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PGS1 |
YF-PA16343 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to PGS1 |
PGS1 Antibody, HRP conjugated |
1-CSB-PA653479LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PGS1. Recognizes PGS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PGS1 Antibody, FITC conjugated |
1-CSB-PA653479LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PGS1. Recognizes PGS1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PGS1 Antibody, Biotin conjugated |
1-CSB-PA653479LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PGS1. Recognizes PGS1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PGS1 Blocking Peptide |
33R-8255 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PGS1 antibody, catalog no. 70R-1011 |
PGS1 Blocking Peptide |
33R-7584 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PGS1 antibody, catalog no. 70R-5274 |
PGS1 cloning plasmid |
CSB-CL653479HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1344
- Sequence: atgaaggggcagataagagtagccaagaggcgggtcgtgatggcatccctctacctggggacaggtcctttggaacaggagctggtggactgcctggaaagtactctagaaaagtcactccaagcaaagtttccttcaaatctcaaggtctccattctcttagacttcacgcggg
- Show more
|
Description: A cloning plasmid for the PGS1 gene. |
Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody |
20-abx003202 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody |
abx029732-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody |
abx029732-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody |
abx236367-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody |
20-abx318570 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody (HRP) |
20-abx307175 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody (FITC) |
20-abx307176 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody (Biotin) |
20-abx307177 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse PGS1 shRNA Plasmid |
20-abx978234 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PGS1 Rabbit Polyclonal Antibody