PHB2 Rabbit Polyclonal Antibody

PHB2 Rabbit Polyclonal Antibody

PHB2 Polyclonal Antibody
ABP59895-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PHB2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PHB2 from Human, Mouse, Rat. This PHB2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PHB2 protein

PHB2 Polyclonal Antibody
ES11135-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PHB2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PHB2 Polyclonal Antibody
ES11135-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PHB2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PHB2 Rabbit pAb
A4504-100ul 100 ul
EUR 308

PHB2 Rabbit pAb
A4504-200ul 200 ul
EUR 459

PHB2 Rabbit pAb
A4504-20ul 20 ul
EUR 183

PHB2 Rabbit pAb
A4504-50ul 50 ul
EUR 223

Polyclonal PHB2 Antibody (Y248)
AMM07120G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PHB2 (Y248). This antibody is tested and proven to work in the following applications:

Polyclonal PHB2 Antibody (Y128)
AMM07138G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PHB2 (Y128). This antibody is tested and proven to work in the following applications:

PHB2 Polyclonal Conjugated Antibody
C30576 100ul
EUR 397

PHB2 antibody
70R-19253 50 ul
EUR 435
Description: Rabbit polyclonal PHB2 antibody

PHB2 Antibody
39972-100ul 100ul
EUR 390

PHB2 Antibody
1-CSB-PA859937ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PHB2. Recognizes PHB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

PHB2 Antibody
1-CSB-PA017886GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PHB2. Recognizes PHB2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal REA (PHB2) Antibody (C-term)
AMM07563G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human REA (PHB2) (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal REA (PHB2) Antibody (N-term)
AMM08674G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human REA (PHB2) (N-term). This antibody is tested and proven to work in the following applications:

Phb2/ Rat Phb2 ELISA Kit
ELI-35696r 96 Tests
EUR 886

Anti-PHB2 antibody
STJ24978 100 µl
EUR 277

Anti-PHB2 antibody
STJ192293 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PHB2

PHB2 siRNA
20-abx903982
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PHB2 siRNA
20-abx928412
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PHB2 siRNA
20-abx928413
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal Prohibitin 2 / PHB2 Antibody (aa88-299)
AMM07340G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Prohibitin 2 / PHB2 (aa88-299). This antibody is tested and proven to work in the following applications:

Polyclonal Prohibitin 2 / PHB2 Antibody (C-Terminus)
AMM07341G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Prohibitin 2 / PHB2 (C-Terminus). This antibody is tested and proven to work in the following applications:

Prohibitin-2 (PHB2) Antibody
20-abx003375
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prohibitin 2 (PHB2) Antibody
20-abx114703
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prohibitin-2 (PHB2) Antibody
abx036458-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Prohibitin-2 (PHB2) Antibody
abx033286-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Prohibitin-2 (PHB2) Antibody
abx033286-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Prohibitin-2 (PHB2) Antibody
abx033287-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Prohibitin-2 (PHB2) Antibody
abx033287-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

prohibitin 2 (PHB2) Antibody
abx236801-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Prohibitin-2 (PHB2) Antibody
20-abx321652
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-REA/PHB2 Antibody
PA1951 100ug/vial
EUR 334

PHB2 cloning plasmid
CSB-CL859937HU-10ug 10ug
EUR 362
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 900
  • Sequence: atggcccagaacttgaaggacttggcgggacggctgcccgccgggccccggggcatgggcacggccctgaagctgttgctgggggccggcgccgtggcctacggtgtgcgcgaatctgtgttcaccgtggaaggcgggcacagagccatcttcttcaatcggatcggtggagtgca
  • Show more
Description: A cloning plasmid for the PHB2 gene.

Human Prohibitin-2 (PHB2) Antibody
33127-05111 150 ug
EUR 261

Human Prohibitin-2 (PHB2)
1-CSB-EP859937HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 60.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Prohibitin-2(PHB2) expressed in E.coli

PHB2 protein (His tag)
80R-2889 100 ug
EUR 349
Description: Purified recombinant PHB2 protein (His tag)

Prohibitin-2 (PHB2) Protein
20-abx261101
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Rat PHB2 shRNA Plasmid
20-abx987231
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PHB2 shRNA Plasmid
20-abx957758
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PHB2 shRNA Plasmid
20-abx969323
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-PHB2 Plasmid
PVT17047 2 ug
EUR 325

PHB2 Recombinant Protein (Human)
RP023278 100 ug Ask for price

PHB2 Recombinant Protein (Mouse)
RP161693 100 ug Ask for price

PHB2 Recombinant Protein (Rat)
RP220277 100 ug Ask for price

Human Prohibitin-2 (PHB2) Antibody (Biotin Conjugate)
33127-05121 150 ug
EUR 369

Phb2 ORF Vector (Rat) (pORF)
ORF073427 1.0 ug DNA
EUR 506

PHB2 ORF Vector (Human) (pORF)
ORF007760 1.0 ug DNA
EUR 95

Phb2 ORF Vector (Mouse) (pORF)
ORF053899 1.0 ug DNA
EUR 506

PHB2 ELISA Kit (Human) (OKEH07846)
OKEH07846 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08ng/mL

Human Prohibitin-2 (PHB2) AssayLite Antibody (FITC Conjugate)
33127-05141 150 ug
EUR 428

Human Prohibitin-2 (PHB2) AssayLite Antibody (RPE Conjugate)
33127-05151 150 ug
EUR 428

Human Prohibitin-2 (PHB2) AssayLite Antibody (APC Conjugate)
33127-05161 150 ug
EUR 428

Human Prohibitin-2 (PHB2) AssayLite Antibody (PerCP Conjugate)
33127-05171 150 ug
EUR 471

Human PHB2/ Prohibitin-2 ELISA Kit
E1926Hu 1 Kit
EUR 605

Human Prohibitin- 2, PHB2 ELISA KIT
ELI-15174h 96 Tests
EUR 824

Mouse Prohibitin- 2, Phb2 ELISA KIT
ELI-15278m 96 Tests
EUR 865

Chicken Prohibitin- 2, PHB2 ELISA KIT
ELI-20977c 96 Tests
EUR 928

Rat Prohibitin-2 (PHB2) ELISA Kit
abx391844-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Prohibitin-2 (PHB2) ELISA Kit
20-abx390301
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Bovine Prohibitin- 2, PHB2 ELISA KIT
ELI-38007b 96 Tests
EUR 928

Phb2 sgRNA CRISPR Lentivector set (Rat)
K6732001 3 x 1.0 ug
EUR 339

Phb2 sgRNA CRISPR Lentivector set (Mouse)
K3656701 3 x 1.0 ug
EUR 339

PHB2 sgRNA CRISPR Lentivector set (Human)
K1637601 3 x 1.0 ug
EUR 339

PHB2 Prohibitin 2 Human Recombinant Protein
PROTQ99623 Regular: 20ug
EUR 317
Description: PHB2 Human Recombinant produced in E. coli is a single polypeptide chain containing 322 amino acids (1-299) and having a molecular mass of 35.7kDa. PHB2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Prohibitin 2(PHB2)ELISA Kit
QY-E00055 96T
EUR 361

Phb2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6732002 1.0 ug DNA
EUR 154

Phb2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6732003 1.0 ug DNA
EUR 154

Phb2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6732004 1.0 ug DNA
EUR 154

Phb2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3656702 1.0 ug DNA
EUR 154

Phb2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3656703 1.0 ug DNA
EUR 154

Phb2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3656704 1.0 ug DNA
EUR 154

PHB2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1637602 1.0 ug DNA
EUR 154

PHB2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1637603 1.0 ug DNA
EUR 154

PHB2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1637604 1.0 ug DNA
EUR 154

PHB2 Protein Vector (Rat) (pPB-C-His)
PV293706 500 ng
EUR 603

PHB2 Protein Vector (Rat) (pPB-N-His)
PV293707 500 ng
EUR 603

PHB2 Protein Vector (Rat) (pPM-C-HA)
PV293708 500 ng
EUR 603

PHB2 Protein Vector (Rat) (pPM-C-His)
PV293709 500 ng
EUR 603

PHB2 Protein Vector (Human) (pPB-C-His)
PV031037 500 ng
EUR 329

PHB2 Protein Vector (Human) (pPB-N-His)
PV031038 500 ng
EUR 329

PHB2 Protein Vector (Human) (pPM-C-HA)
PV031039 500 ng
EUR 329

PHB2 Protein Vector (Human) (pPM-C-His)
PV031040 500 ng
EUR 329

PHB2 Protein Vector (Mouse) (pPB-C-His)
PV215594 500 ng
EUR 603

PHB2 Protein Vector (Mouse) (pPB-N-His)
PV215595 500 ng
EUR 603

PHB2 Protein Vector (Mouse) (pPM-C-HA)
PV215596 500 ng
EUR 603

PHB2 Protein Vector (Mouse) (pPM-C-His)
PV215597 500 ng
EUR 603

Phb2 3'UTR Luciferase Stable Cell Line
TU116276 1.0 ml Ask for price

Phb2 3'UTR GFP Stable Cell Line
TU166276 1.0 ml Ask for price

Phb2 3'UTR Luciferase Stable Cell Line
TU216157 1.0 ml Ask for price

Phb2 3'UTR GFP Stable Cell Line
TU266157 1.0 ml Ask for price

PHB2 3'UTR GFP Stable Cell Line
TU067833 1.0 ml
EUR 2333

PHB2 3'UTR Luciferase Stable Cell Line
TU017833 1.0 ml
EUR 2333

Phb2 ELISA Kit| Rat Prohibitin-2 ELISA Kit
EF019204 96 Tests
EUR 689

Phb2 ELISA Kit| Mouse Prohibitin-2 ELISA Kit
EF015941 96 Tests
EUR 689

PHB2 Rabbit Polyclonal Antibody