PILRB Rabbit Polyclonal Antibody
PILRB Polyclonal Antibody |
ABP59916-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PILRB protein at amino acid sequence of 170-250
- Applications tips:
|
Description: A polyclonal antibody for detection of PILRB from Human, Mouse. This PILRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PILRB protein at amino acid sequence of 170-250 |
PILRB Polyclonal Antibody |
A68026 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
PILRB antibody |
70R-7227 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PILRB antibody raised against the middle region of PILRB |
PILRB Antibody |
36695-100ul |
SAB |
100ul |
EUR 252 |
PILRB Antibody |
1-CSB-PA890735LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
PILRB Antibody |
1-CSB-PA140660 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
PILRB Antibody |
1-CSB-PA181515 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:20-1:100 |
Polyclonal PILRB antibody - middle region |
AMM07195G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PILRB - middle region. This antibody is tested and proven to work in the following applications: |
PILRB Polyclonal Antibody, HRP Conjugated |
A68027 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
PILRB Polyclonal Antibody, FITC Conjugated |
A68028 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
PILRB Polyclonal Antibody, Biotin Conjugated |
A68029 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
PILRB Conjugated Antibody |
C36695 |
SAB |
100ul |
EUR 397 |
Anti-PILRB antibody |
STJ192469 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PILRB |
PILRB siRNA |
20-abx928639 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PILRB siRNA |
20-abx928640 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PILRB Antibody, HRP conjugated |
1-CSB-PA890735LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PILRB Antibody, FITC conjugated |
1-CSB-PA890735LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PILRB Antibody, Biotin conjugated |
1-CSB-PA890735LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PILRB Blocking Peptide |
33R-4545 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PILRB antibody, catalog no. 70R-7227 |
PILRB cloning plasmid |
CSB-CL890735HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 684
- Sequence: atgggtcggcccctgctgctgcccctgctgctcctgctgcagccgccagcatttctgcagcctggtggctccacaggatctggtccaagctacctttatggggtcactcaaccaaaacacctctcagcctccatgggtggctctgtggaaatccccttctccttctattacccctg
- Show more
|
Description: A cloning plasmid for the PILRB gene. |
Mouse PILRB shRNA Plasmid |
20-abx980322 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PILRB shRNA Plasmid |
20-abx959319 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PILRB Recombinant Protein (Human) |
RP023521 |
ABM |
100 ug |
Ask for price |
PILRB ORF Vector (Human) (pORF) |
ORF007841 |
ABM |
1.0 ug DNA |
EUR 95 |
PILRB ELISA Kit (Human) (OKEH02298) |
OKEH02298 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: The paired immunoglobin-like type 2 receptors consist of highly related activating and inhibitory receptors that are involved in the regulation of many aspects of the immune system. The paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This gene encodes the activating member of the receptor pair and contains a truncated cytoplasmic tail relative to its inhibitory counterpart (PILRA), that has a long cytoplasmic tail with immunoreceptor tyrosine-based inhibitory (ITIM) motifs. This gene is thought to have arisen from a duplication of the inhibitory PILRA gene and evolved to acquire its activating function.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098 ng/mL |
PILRB ELISA Kit (Mouse) (OKEH05560) |
OKEH05560 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Paired receptors consist of highly related activating and inhibitory receptors and are widely involved in the regulation of the immune system. PILRB is thought to act as a cellular signaling activating receptor that associates with ITAM-bearing adapter molecules on the cell surface. Seems to associate with DAP12 and is a receptor for CD99. May be involved in target cell recognition by natural killer cells and in activation of dendritic cells.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.09 ng/mL |
PILRB sgRNA CRISPR Lentivector set (Human) |
K1651301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Paired immunoglobulin-like type 2 receptor beta (PILRB) Antibody |
20-abx339201 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Paired immunoglobulin-like type 2 receptor beta (PILRB) Antibody |
20-abx339629 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody |
20-abx301742 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PILRB sgRNA CRISPR Lentivector (Human) (Target 1) |
K1651302 |
ABM |
1.0 ug DNA |
EUR 154 |
PILRB sgRNA CRISPR Lentivector (Human) (Target 2) |
K1651303 |
ABM |
1.0 ug DNA |
EUR 154 |
PILRB sgRNA CRISPR Lentivector (Human) (Target 3) |
K1651304 |
ABM |
1.0 ug DNA |
EUR 154 |
PILRB Protein Vector (Human) (pPB-C-His) |
PV031361 |
ABM |
500 ng |
EUR 329 |
PILRB Protein Vector (Human) (pPB-N-His) |
PV031362 |
ABM |
500 ng |
EUR 329 |
PILRB Protein Vector (Human) (pPM-C-HA) |
PV031363 |
ABM |
500 ng |
EUR 329 |
PILRB Protein Vector (Human) (pPM-C-His) |
PV031364 |
ABM |
500 ng |
EUR 329 |
PILRB 3'UTR Luciferase Stable Cell Line |
TU017973 |
ABM |
1.0 ml |
EUR 2333 |
PILRB 3'UTR GFP Stable Cell Line |
TU067973 |
ABM |
1.0 ml |
EUR 2333 |
Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody (HRP) |
20-abx312147 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody (FITC) |
20-abx312148 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody (Biotin) |
20-abx312149 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
PILRB Rabbit Polyclonal Antibody