PILRB Rabbit Polyclonal Antibody

PILRB Polyclonal Antibody
ABP59916-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PILRB protein at amino acid sequence of 170-250 Applications tips:
Description: A polyclonal antibody for detection of PILRB from Human, Mouse. This PILRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PILRB protein at amino acid sequence of 170-250

PILRB Polyclonal Antibody
A68026	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

PILRB antibody
70R-7227	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PILRB antibody raised against the middle region of PILRB

PILRB Antibody
36695-100ul	SAB	100ul	EUR 252

PILRB Antibody
1-CSB-PA890735LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PILRB Antibody
1-CSB-PA140660	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

PILRB Antibody
1-CSB-PA181515	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:20-1:100

Polyclonal PILRB antibody - middle region
AMM07195G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PILRB - middle region. This antibody is tested and proven to work in the following applications:

PILRB Polyclonal Antibody, HRP Conjugated
A68027	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

PILRB Polyclonal Antibody, FITC Conjugated
A68028	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

PILRB Polyclonal Antibody, Biotin Conjugated
A68029	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

PILRB Conjugated Antibody
C36695	SAB	100ul	EUR 397

Anti-PILRB antibody
STJ192469	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PILRB

PILRB siRNA
20-abx928639	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PILRB siRNA
20-abx928640	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PILRB Antibody, HRP conjugated
1-CSB-PA890735LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PILRB Antibody, FITC conjugated
1-CSB-PA890735LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PILRB Antibody, Biotin conjugated
1-CSB-PA890735LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PILRB Blocking Peptide
33R-4545	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PILRB antibody, catalog no. 70R-7227

PILRB cloning plasmid
CSB-CL890735HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 684 Sequence: atgggtcggcccctgctgctgcccctgctgctcctgctgcagccgccagcatttctgcagcctggtggctccacaggatctggtccaagctacctttatggggtcactcaaccaaaacacctctcagcctccatgggtggctctgtggaaatccccttctccttctattacccctg Show more
Description: A cloning plasmid for the PILRB gene.

Mouse PILRB shRNA Plasmid
20-abx980322	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PILRB ELISA Kit
ELA-E13291h	Lifescience Market	96 Tests	EUR 824

PILRB ELISA KIT|Human
EF005352	Lifescience Market	96 Tests	EUR 689

Human PILRB ELISA KIT
ELI-45043h	Lifescience Market	96 Tests	EUR 824

Mouse Pilrb ELISA KIT
ELI-45044m	Lifescience Market	96 Tests	EUR 865

Human PILRB shRNA Plasmid
20-abx959319	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PILRB Recombinant Protein (Human)
RP023521	ABM	100 ug	Ask for price

PILRB ORF Vector (Human) (pORF)
ORF007841	ABM	1.0 ug DNA	EUR 95

PILRB ELISA Kit (Human) (OKEH02298)
OKEH02298	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: The paired immunoglobin-like type 2 receptors consist of highly related activating and inhibitory receptors that are involved in the regulation of many aspects of the immune system. The paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This gene encodes the activating member of the receptor pair and contains a truncated cytoplasmic tail relative to its inhibitory counterpart (PILRA), that has a long cytoplasmic tail with immunoreceptor tyrosine-based inhibitory (ITIM) motifs. This gene is thought to have arisen from a duplication of the inhibitory PILRA gene and evolved to acquire its activating function.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098 ng/mL

PILRB ELISA Kit (Mouse) (OKEH05560)
OKEH05560	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Paired receptors consist of highly related activating and inhibitory receptors and are widely involved in the regulation of the immune system. PILRB is thought to act as a cellular signaling activating receptor that associates with ITAM-bearing adapter molecules on the cell surface. Seems to associate with DAP12 and is a receptor for CD99. May be involved in target cell recognition by natural killer cells and in activation of dendritic cells.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.09 ng/mL

PILRB sgRNA CRISPR Lentivector set (Human)
K1651301	ABM	3 x 1.0 ug	EUR 339

Paired immunoglobulin-like type 2 receptor beta (PILRB) Antibody
20-abx339201	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Paired immunoglobulin-like type 2 receptor beta (PILRB) Antibody
20-abx339629	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody
20-abx301742	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PILRB sgRNA CRISPR Lentivector (Human) (Target 1)
K1651302	ABM	1.0 ug DNA	EUR 154

PILRB sgRNA CRISPR Lentivector (Human) (Target 2)
K1651303	ABM	1.0 ug DNA	EUR 154

PILRB sgRNA CRISPR Lentivector (Human) (Target 3)
K1651304	ABM	1.0 ug DNA	EUR 154

PILRB Protein Vector (Human) (pPB-C-His)
PV031361	ABM	500 ng	EUR 329

PILRB Protein Vector (Human) (pPB-N-His)
PV031362	ABM	500 ng	EUR 329

PILRB Protein Vector (Human) (pPM-C-HA)
PV031363	ABM	500 ng	EUR 329

PILRB Protein Vector (Human) (pPM-C-His)
PV031364	ABM	500 ng	EUR 329

PILRB 3'UTR Luciferase Stable Cell Line
TU017973	ABM	1.0 ml	EUR 2333

PILRB 3'UTR GFP Stable Cell Line
TU067973	ABM	1.0 ml	EUR 2333

Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody (HRP)
20-abx312147	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody (FITC)
20-abx312148	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody (Biotin)
20-abx312149	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PILRB Rabbit Polyclonal Antibody