PILRB Rabbit Polyclonal Antibody

PILRB Rabbit Polyclonal Antibody

PILRB Polyclonal Antibody
ES11311-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PILRB from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PILRB Polyclonal Antibody
ES11311-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PILRB from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PILRB Antibody
36695-100ul 100ul
EUR 252

PILRB Antibody
1-CSB-PA140660
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

PILRB Antibody
1-CSB-PA890735LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PILRB Antibody
1-CSB-PA181515
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:20-1:100

PILRB antibody
70R-7227 50 ug
EUR 467
Description: Rabbit polyclonal PILRB antibody raised against the middle region of PILRB

Polyclonal PILRB antibody - middle region
AMM07195G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PILRB - middle region. This antibody is tested and proven to work in the following applications:

PILRB Polyclonal Antibody, HRP Conjugated
A68027 100 µg
EUR 570.55
Description: The best epigenetics products

PILRB Polyclonal Antibody, FITC Conjugated
A68028 100 µg
EUR 570.55
Description: kits suitable for this type of research

PILRB Polyclonal Antibody, Biotin Conjugated
A68029 100 µg
EUR 570.55
Description: fast delivery possible

PILRB Conjugated Antibody
C36695 100ul
EUR 397

Anti-PILRB antibody
STJ192469 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PILRB

PILRB siRNA
20-abx928639
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PILRB siRNA
20-abx928640
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PILRB Antibody, HRP conjugated
1-CSB-PA890735LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PILRB Antibody, FITC conjugated
1-CSB-PA890735LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PILRB Antibody, Biotin conjugated
1-CSB-PA890735LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PILRB Blocking Peptide
33R-4545 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PILRB antibody, catalog no. 70R-7227

PILRB cloning plasmid
CSB-CL890735HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 684
  • Sequence: atgggtcggcccctgctgctgcccctgctgctcctgctgcagccgccagcatttctgcagcctggtggctccacaggatctggtccaagctacctttatggggtcactcaaccaaaacacctctcagcctccatgggtggctctgtggaaatccccttctccttctattacccctg
  • Show more
Description: A cloning plasmid for the PILRB gene.

Human PILRB ELISA Kit
ELA-E13291h 96 Tests
EUR 824

PILRB ELISA KIT|Human
EF005352 96 Tests
EUR 689

Human PILRB ELISA KIT
ELI-45043h 96 Tests
EUR 824

Mouse Pilrb ELISA KIT
ELI-45044m 96 Tests
EUR 865

Human PILRB shRNA Plasmid
20-abx959319
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PILRB shRNA Plasmid
20-abx980322
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PILRB Recombinant Protein (Human)
RP023521 100 ug Ask for price

PILRB ORF Vector (Human) (pORF)
ORF007841 1.0 ug DNA
EUR 95

PILRB ELISA Kit (Mouse) (OKEH05560)
OKEH05560 96 Wells
EUR 779
Description: Description of target: Paired receptors consist of highly related activating and inhibitory receptors and are widely involved in the regulation of the immune system. PILRB is thought to act as a cellular signaling activating receptor that associates with ITAM-bearing adapter molecules on the cell surface. Seems to associate with DAP12 and is a receptor for CD99. May be involved in target cell recognition by natural killer cells and in activation of dendritic cells.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.09 ng/mL

PILRB ELISA Kit (Human) (OKEH02298)
OKEH02298 96 Wells
EUR 662
Description: Description of target: The paired immunoglobin-like type 2 receptors consist of highly related activating and inhibitory receptors that are involved in the regulation of many aspects of the immune system. The paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This gene encodes the activating member of the receptor pair and contains a truncated cytoplasmic tail relative to its inhibitory counterpart (PILRA), that has a long cytoplasmic tail with immunoreceptor tyrosine-based inhibitory (ITIM) motifs. This gene is thought to have arisen from a duplication of the inhibitory PILRA gene and evolved to acquire its activating function.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098 ng/mL

PILRB sgRNA CRISPR Lentivector set (Human)
K1651301 3 x 1.0 ug
EUR 339

Paired immunoglobulin-like type 2 receptor beta (PILRB) Antibody
20-abx339201
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Paired immunoglobulin-like type 2 receptor beta (PILRB) Antibody
20-abx339629
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody
20-abx301742
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PILRB sgRNA CRISPR Lentivector (Human) (Target 1)
K1651302 1.0 ug DNA
EUR 154

PILRB sgRNA CRISPR Lentivector (Human) (Target 2)
K1651303 1.0 ug DNA
EUR 154

PILRB sgRNA CRISPR Lentivector (Human) (Target 3)
K1651304 1.0 ug DNA
EUR 154

PILRB 3'UTR Luciferase Stable Cell Line
TU017973 1.0 ml
EUR 2333

PILRB 3'UTR GFP Stable Cell Line
TU067973 1.0 ml
EUR 2333

PILRB Protein Vector (Human) (pPB-C-His)
PV031361 500 ng
EUR 329

PILRB Protein Vector (Human) (pPB-N-His)
PV031362 500 ng
EUR 329

PILRB Protein Vector (Human) (pPM-C-HA)
PV031363 500 ng
EUR 329

PILRB Protein Vector (Human) (pPM-C-His)
PV031364 500 ng
EUR 329

Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody (HRP)
20-abx312147
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody (FITC)
20-abx312148
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody (Biotin)
20-abx312149
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

PILRB Rabbit Polyclonal Antibody