CelltaGen
셀타젠 Genetic Genotyping

PILRB Rabbit Polyclonal Antibody

PILRB Polyclonal Antibody

ABP59916-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PILRB protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of PILRB from Human, Mouse. This PILRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PILRB protein at amino acid sequence of 170-250

PILRB Polyclonal Antibody

A68026 100 µg
EUR 570.55
Description: Ask the seller for details

PILRB antibody

70R-7227 50 ug
EUR 467
Description: Rabbit polyclonal PILRB antibody raised against the middle region of PILRB

PILRB Antibody

36695-100ul 100ul
EUR 252

PILRB Antibody

1-CSB-PA890735LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PILRB Antibody

1-CSB-PA140660
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

PILRB Antibody

1-CSB-PA181515
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:20-1:100

Polyclonal PILRB antibody - middle region

AMM07195G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PILRB - middle region. This antibody is tested and proven to work in the following applications:

PILRB Polyclonal Antibody, HRP Conjugated

A68027 100 µg
EUR 570.55
Description: The best epigenetics products

PILRB Polyclonal Antibody, FITC Conjugated

A68028 100 µg
EUR 570.55
Description: kits suitable for this type of research

PILRB Polyclonal Antibody, Biotin Conjugated

A68029 100 µg
EUR 570.55
Description: fast delivery possible

PILRB Conjugated Antibody

C36695 100ul
EUR 397

Anti-PILRB antibody

STJ192469 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PILRB

PILRB siRNA

20-abx928639
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PILRB siRNA

20-abx928640
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PILRB Antibody, HRP conjugated

1-CSB-PA890735LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PILRB Antibody, FITC conjugated

1-CSB-PA890735LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PILRB Antibody, Biotin conjugated

1-CSB-PA890735LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PILRB Blocking Peptide

33R-4545 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PILRB antibody, catalog no. 70R-7227

PILRB cloning plasmid

CSB-CL890735HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 684
  • Sequence: atgggtcggcccctgctgctgcccctgctgctcctgctgcagccgccagcatttctgcagcctggtggctccacaggatctggtccaagctacctttatggggtcactcaaccaaaacacctctcagcctccatgggtggctctgtggaaatccccttctccttctattacccctg
  • Show more
Description: A cloning plasmid for the PILRB gene.

Mouse PILRB shRNA Plasmid

20-abx980322
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PILRB ELISA Kit

ELA-E13291h 96 Tests
EUR 824

PILRB ELISA KIT|Human

EF005352 96 Tests
EUR 689

Human PILRB ELISA KIT

ELI-45043h 96 Tests
EUR 824

Mouse Pilrb ELISA KIT

ELI-45044m 96 Tests
EUR 865

Human PILRB shRNA Plasmid

20-abx959319
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PILRB Recombinant Protein (Human)

RP023521 100 ug Ask for price

PILRB ORF Vector (Human) (pORF)

ORF007841 1.0 ug DNA
EUR 95

PILRB sgRNA CRISPR Lentivector set (Human)

K1651301 3 x 1.0 ug
EUR 339

Paired immunoglobulin-like type 2 receptor beta (PILRB) Antibody

20-abx339201
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Paired immunoglobulin-like type 2 receptor beta (PILRB) Antibody

20-abx339629
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody

20-abx301742
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PILRB sgRNA CRISPR Lentivector (Human) (Target 1)

K1651302 1.0 ug DNA
EUR 154

PILRB sgRNA CRISPR Lentivector (Human) (Target 2)

K1651303 1.0 ug DNA
EUR 154

PILRB sgRNA CRISPR Lentivector (Human) (Target 3)

K1651304 1.0 ug DNA
EUR 154

PILRB Protein Vector (Human) (pPB-C-His)

PV031361 500 ng
EUR 329

PILRB Protein Vector (Human) (pPB-N-His)

PV031362 500 ng
EUR 329

PILRB Protein Vector (Human) (pPM-C-HA)

PV031363 500 ng
EUR 329

PILRB Protein Vector (Human) (pPM-C-His)

PV031364 500 ng
EUR 329

PILRB 3'UTR Luciferase Stable Cell Line

TU017973 1.0 ml
EUR 2333

PILRB 3'UTR GFP Stable Cell Line

TU067973 1.0 ml
EUR 2333

Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody (HRP)

20-abx312147
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody (FITC)

20-abx312148
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody (Biotin)

20-abx312149
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PILRB Rabbit Polyclonal Antibody