PIP Rabbit Polyclonal Antibody

PIP Rabbit Polyclonal Antibody

PIP Polyclonal Antibody
ES11389-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PIP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Prolactin Induced Protein (PIP) ELISA Kit
DLR-PIP-Hu-48T	DL Develop	48T	EUR 554
Should the Human Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prolactin Induced Protein (PIP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit
DLR-PIP-Hu-96T	DL Develop	96T	EUR 725
Should the Human Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prolactin Induced Protein (PIP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Prolactin Induced Protein (PIP) ELISA Kit
DLR-PIP-Ra-48T	DL Develop	48T	EUR 590
Should the Rat Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Prolactin Induced Protein (PIP) in samples from serum, plasma or other biological fluids.

Rat Prolactin Induced Protein (PIP) ELISA Kit
DLR-PIP-Ra-96T	DL Develop	96T	EUR 774
Should the Rat Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Prolactin Induced Protein (PIP) in samples from serum, plasma or other biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit
RDR-PIP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Prolactin Induced Protein (PIP) ELISA Kit
RDR-PIP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Rat Prolactin Induced Protein (PIP) ELISA Kit
RDR-PIP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 631

Rat Prolactin Induced Protein (PIP) ELISA Kit
RDR-PIP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 880

Human Prolactin Induced Protein (PIP) ELISA Kit
RD-PIP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Prolactin Induced Protein (PIP) ELISA Kit
RD-PIP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Rat Prolactin Induced Protein (PIP) ELISA Kit
RD-PIP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 603

Rat Prolactin Induced Protein (PIP) ELISA Kit
RD-PIP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 840

PIP Rabbit pAb
A6394-100ul	Abclonal	100 ul	EUR 308

PIP Rabbit pAb
A6394-200ul	Abclonal	200 ul	EUR 459

PIP Rabbit pAb
A6394-20ul	Abclonal	20 ul	EUR 183

PIP Rabbit pAb
A6394-50ul	Abclonal	50 ul	EUR 223

PIP Polyclonal Antibody, HRP Conjugated
A55388	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

PIP Polyclonal Antibody, FITC Conjugated
A55389	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

PIP Polyclonal Antibody, Biotin Conjugated
A55390	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

PIP Antibody
36498-100ul	SAB	100ul	EUR 252

PIP antibody
38874-100ul	SAB	100ul	EUR 252

PIP Antibody
1-CSB-PA131180	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

PIP Antibody
1-CSB-PA697513	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

PIP Antibody
DF7933	Affbiotech	200ul	EUR 304
Description: PIP Antibody detects endogenous levels of total PIP.

PIP Antibody
1-CSB-PA018020GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

PIP Antibody
1-CSB-PA018020LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PIP Antibody
ABD7933	Lifescience Market	100 ug	EUR 438

PIP Antibody
ABD8001	Lifescience Market	100 ug	EUR 438

Rabbit PIP ELISA Kit
ERTP0017	Abclonal	96Tests	EUR 521

Polyclonal Goat Anti-GCDFP15 / PIP Antibody
APG00145G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GCDFP15 / PIP . This antibody is tested and proven to work in the following applications:

Polyclonal PIP / GCDFP-15 Antibody (Internal)
APG01019G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PIP / GCDFP-15 (Internal). This antibody is tested and proven to work in the following applications:

Human PIP Antibody
32081-05111	AssayPro	150 ug	EUR 261

Aquaporin PIP antibody
70R-33257	Fitzgerald	100 ug	EUR 435
Description: Rabbit polyclonal Aquaporin PIP antibody

Aquaporin PIP antibody
70R-33258	Fitzgerald	100 ug	EUR 349
Description: Rabbit polyclonal Aquaporin PIP antibody

Os-PIP Antibody
abx018466-100ul	Abbexa	100 ul	EUR 384
Shipped within 5-10 working days.

PIP Conjugated Antibody
C36498	SAB	100ul	EUR 397

Anti-PIP antibody
STJ28477	St John's Laboratory	100 µl	EUR 277

Anti-PIP antibody
STJ192547	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PIP

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human)
4-PAM035Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Glu146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP)

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse)
4-PAM035Mu01	Cloud-Clone	EUR 266.00 EUR 2813.00 EUR 694.00 EUR 337.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Asn146) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP)

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat)
4-PAM035Ra01	Cloud-Clone	EUR 275.00 EUR 2958.00 EUR 727.00 EUR 350.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1-Asn146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP)

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat)
4-PAM035Ra02	Cloud-Clone	EUR 275.00 EUR 2958.00 EUR 727.00 EUR 350.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Asn41~Thr139) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP)

PIP siRNA
20-abx904034	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PIP siRNA
20-abx928673	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PIP siRNA
20-abx928674	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PIP Antibody, HRP conjugated
1-CSB-PA018020LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIP Antibody, FITC conjugated
1-CSB-PA018020LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIP Antibody, Biotin conjugated
1-CSB-PA018020LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GCDFP-15 / PIP Antibody
abx233381-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Anti-GCDFP15 / PIP antibody
STJ70914	St John's Laboratory	100 µg	EUR 359

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), APC
4-PAM035Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Glu146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with APC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), Biotinylated
4-PAM035Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Glu146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with Biotin.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), Cy3
4-PAM035Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Glu146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with Cy3.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), FITC
4-PAM035Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Glu146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with FITC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), HRP
4-PAM035Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Glu146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with HRP.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), PE
4-PAM035Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Glu146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with PE.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), APC
4-PAM035Mu01-APC	Cloud-Clone	EUR 374.00 EUR 3689.00 EUR 1016.00 EUR 481.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Asn146) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with APC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), Biotinylated
4-PAM035Mu01-Biotin	Cloud-Clone	EUR 332.00 EUR 2763.00 EUR 803.00 EUR 411.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Asn146) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with Biotin.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), Cy3
4-PAM035Mu01-Cy3	Cloud-Clone	EUR 457.00 EUR 4877.00 EUR 1313.00 EUR 600.00 EUR 267.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Asn146) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with Cy3.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), FITC
4-PAM035Mu01-FITC	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Asn146) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with FITC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), HRP
4-PAM035Mu01-HRP	Cloud-Clone	EUR 341.00 EUR 3213.00 EUR 897.00 EUR 433.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Asn146) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with HRP.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), PE
4-PAM035Mu01-PE	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Asn146) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with PE.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), APC
4-PAM035Ra01-APC	Cloud-Clone	EUR 388.00 EUR 3887.00 EUR 1065.00 EUR 501.00 EUR 237.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1-Asn146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with APC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), Biotinylated
4-PAM035Ra01-Biotin	Cloud-Clone	EUR 343.00 EUR 2908.00 EUR 839.00 EUR 425.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1-Asn146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with Biotin.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), Cy3
4-PAM035Ra01-Cy3	Cloud-Clone	EUR 476.00 EUR 5141.00 EUR 1379.00 EUR 626.00 EUR 275.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1-Asn146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with Cy3.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), FITC
4-PAM035Ra01-FITC	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1-Asn146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with FITC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), HRP
4-PAM035Ra01-HRP	Cloud-Clone	EUR 353.00 EUR 3385.00 EUR 940.00 EUR 451.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1-Asn146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with HRP.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), PE
4-PAM035Ra01-PE	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1-Asn146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with PE.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), APC
4-PAM035Ra02-APC	Cloud-Clone	EUR 388.00 EUR 3887.00 EUR 1065.00 EUR 501.00 EUR 237.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Asn41~Thr139) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with APC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), Biotinylated
4-PAM035Ra02-Biotin	Cloud-Clone	EUR 343.00 EUR 2908.00 EUR 839.00 EUR 425.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Asn41~Thr139) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with Biotin.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), Cy3
4-PAM035Ra02-Cy3	Cloud-Clone	EUR 476.00 EUR 5141.00 EUR 1379.00 EUR 626.00 EUR 275.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Asn41~Thr139) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with Cy3.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), FITC
4-PAM035Ra02-FITC	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Asn41~Thr139) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with FITC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), HRP
4-PAM035Ra02-HRP	Cloud-Clone	EUR 353.00 EUR 3385.00 EUR 940.00 EUR 451.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Asn41~Thr139) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with HRP.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), PE
4-PAM035Ra02-PE	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Asn41~Thr139) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with PE.

Human PIP Antibody (Biotin Conjugate)
32081-05121	AssayPro	150 ug	EUR 369

Prolactin-Inducible Protein (PIP) Antibody
20-abx004889	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Prolactin-Inducible Protein (PIP) Antibody
abx217780-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Prolactin Induced Protein (PIP) Antibody
20-abx210246	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Prolactin Induced Protein (PIP) Antibody
20-abx210247	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Prolactin Induced Protein (PIP) Antibody
20-abx102473	Abbexa	EUR 467.00 EUR 133.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prolactin Induced Protein (PIP) Antibody
20-abx102474	Abbexa	EUR 481.00 EUR 133.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prolactin-Inducible Protein (PIP) Antibody
20-abx103058	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Prolactin Induced Protein (PIP) Antibody
20-abx128887	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prolactin Induced Protein (PIP) Antibody
20-abx131067	Abbexa	EUR 481.00 EUR 133.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prolactin Induced Protein (PIP) Antibody
20-abx174185	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Prolactin Induced Protein (PIP) Antibody
20-abx174186	Abbexa	EUR 982.00 EUR 495.00	1 mg 200 ug
Please enquire.

anti- GCDFP-15/PIP antibody
FNab03381	FN Test	100µg	EUR 585
Recommended dilution: IHC: 1:20-1:200 Immunogen: prolactin-induced protein Uniprot ID: P12273 Research Area: Cancer, Immunology
Description: Antibody raised against GCDFP-15/PIP

Anti-GCDFP-15/PIP antibody
PAab03381	Lifescience Market	100 ug	EUR 412

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), APC-Cy7
4-PAM035Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Glu146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with APC-Cy7.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), APC-Cy7
4-PAM035Mu01-APC-Cy7	Cloud-Clone	EUR 628.00 EUR 7258.00 EUR 1912.00 EUR 842.00 EUR 344.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1~Asn146) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with APC-Cy7.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), APC-Cy7
4-PAM035Ra01-APC-Cy7	Cloud-Clone	EUR 657.00 EUR 7654.00 EUR 2011.00 EUR 882.00 EUR 355.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Met1-Asn146) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with APC-Cy7.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), APC-Cy7
4-PAM035Ra02-APC-Cy7	Cloud-Clone	EUR 657.00 EUR 7654.00 EUR 2011.00 EUR 882.00 EUR 355.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PIP (Asn41~Thr139) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with APC-Cy7.

PIP Blocking Peptide
DF7933-BP	Affbiotech	1mg	EUR 195

PIP cloning plasmid
CSB-CL018020HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 441 Sequence: atgcgcttgctccagctcctgttcagggccagccctgccaccctgctcctggttctctgcctgcagttgggggccaacaaagctcaggacaacactcggaagatcataataaagaattttgacattcccaagtcagtacgtccaaatgacgaagtcactgcagtgcttgcagttca Show more
Description: A cloning plasmid for the PIP gene.

PIP Rabbit Polyclonal Antibody