PLOD2 Rabbit Polyclonal Antibody
 PLOD2 Polyclonal Antibody |
|
28422-100ul |
SAB |
100ul |
EUR 252 |
PLOD2 Polyclonal Antibody |
|
28422-50ul |
SAB |
50ul |
EUR 187 |
PLOD2 Polyclonal Antibody |
|
A63150 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
PLOD2 Polyclonal Antibody |
|
ABP59944-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PLOD2 from Human, Mouse, Rat. This PLOD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680 |
PLOD2 Polyclonal Antibody |
|
ABP59944-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PLOD2 from Human, Mouse, Rat. This PLOD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680 |
PLOD2 Polyclonal Antibody |
|
ABP59944-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PLOD2 from Human, Mouse, Rat. This PLOD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680 |
PLOD2 Polyclonal Antibody |
|
ES11324-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against PLOD2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PLOD2 Polyclonal Antibody |
|
ES11324-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against PLOD2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 PLOD2 Rabbit pAb |
|
A14045-100ul |
Abclonal |
100 ul |
EUR 308 |
PLOD2 Rabbit pAb |
|
A14045-200ul |
Abclonal |
200 ul |
EUR 459 |
PLOD2 Rabbit pAb |
|
A14045-20ul |
Abclonal |
20 ul |
EUR 183 |
PLOD2 Rabbit pAb |
|
A14045-50ul |
Abclonal |
50 ul |
EUR 223 |
PLOD2 Rabbit pAb |
|
A6946-100ul |
Abclonal |
100 ul |
EUR 308 |
PLOD2 Rabbit pAb |
|
A6946-200ul |
Abclonal |
200 ul |
EUR 459 |
PLOD2 Rabbit pAb |
|
A6946-20ul |
Abclonal |
20 ul |
EUR 183 |
PLOD2 Rabbit pAb |
|
A6946-50ul |
Abclonal |
50 ul |
EUR 223 |
 PLOD2 Polyclonal Conjugated Antibody |
|
C28422 |
SAB |
100ul |
EUR 397 |
PLOD2 Polyclonal Conjugated Antibody |
|
C30767 |
SAB |
100ul |
EUR 397 |
 PLOD2 antibody |
|
70R-19352 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal PLOD2 antibody |
 PLOD2 Antibody |
|
1-CSB-PA018200GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against PLOD2. Recognizes PLOD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
PLOD2 Antibody |
|
1-CSB-PA018200LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PLOD2. Recognizes PLOD2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
PLOD2 antibody |
|
70R-36602 |
Fitzgerald |
100 ug |
EUR 349 |
|
Description: Rabbit Polyclonal PLOD2 antibody |
PLOD2 antibody |
|
70R-5438 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal PLOD2 antibody raised against the middle region of PLOD2 |
) Polyclonal PLOD2 Antibody (C-term) |
|
APR10906G |
Leading Biology |
0.1ml |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLOD2 (C-term). This antibody is tested and proven to work in the following applications: |
 PLOD2 Polyclonal Antibody, HRP Conjugated |
|
A63151 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 PLOD2 Polyclonal Antibody, FITC Conjugated |
|
A63152 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 PLOD2 Polyclonal Antibody, Biotin Conjugated |
|
A63153 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 ELISA Kit) Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit |
|
DLR-PLOD2-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit |
|
DLR-PLOD2-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit |
|
RDR-PLOD2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit |
|
RDR-PLOD2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit |
|
RD-PLOD2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit |
|
RD-PLOD2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
 PLOD2-Specific Antibody |
|
DF12018 |
Affbiotech |
200ul |
EUR 304 |
|
Description: PLOD2-Specific antibody detects endogenous levels of PLOD2-Specific. |
PLOD2-Specific Antibody |
|
abx236552-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
 Anti-PLOD2 antibody |
|
STJ29026 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. |
Anti-PLOD2 antibody |
|
STJ115980 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. |
Anti-PLOD2 antibody |
|
STJ192482 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to PLOD2 |
 PLOD2 siRNA |
|
20-abx928976 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PLOD2 siRNA |
|
20-abx928977 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-PLOD2 |
|
YF-PA13829 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to PLOD2 |
anti-PLOD2 |
|
YF-PA13830 |
Abfrontier |
100 ul |
EUR 403 |
|
Description: Rabbit polyclonal to PLOD2 |
anti-PLOD2 |
|
YF-PA13831 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to PLOD2 |
 PLOD2 Antibody, HRP conjugated |
|
1-CSB-PA018200LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PLOD2. Recognizes PLOD2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 PLOD2 Antibody, FITC conjugated |
|
1-CSB-PA018200LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PLOD2. Recognizes PLOD2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 PLOD2 Antibody, Biotin conjugated |
|
1-CSB-PA018200LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PLOD2. Recognizes PLOD2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 anti- PLOD2-Specific antibody |
|
FNab06552 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:1000
- IP: 1:200-1:1000
- IHC: 1:100-1:400
- IF: 1:10-1:100
- Immunogen: procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
- Uniprot ID: O00469
- Research Area: Metabolism
|
|
Description: Antibody raised against PLOD2-Specific |
 PLOD2 Blocking Peptide |
|
33R-4019 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLOD2 antibody, catalog no. 70R-5438 |
 PLOD2 cloning plasmid |
|
CSB-CL018200HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2277
- Sequence: atggggggatgcacggtgaagcctcagctgctgctcctggcgctcgtcctccacccctggaatccctgtctgggtgcggactcggagaagccctcgagcatccccacagataaattattagtcataactgtagcaacaaaagaaagtgatggattccatcgatttatgcagtcag
- Show more
|
|
Description: A cloning plasmid for the PLOD2 gene. |
 PLOD2-Specific Blocking Peptide |
|
DF12018-BP |
Affbiotech |
1mg |
EUR 195 |
 Mouse PLOD2 shRNA Plasmid |
|
20-abx973717 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human PLOD2 shRNA Plasmid |
|
20-abx953591 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) PLOD2 Recombinant Protein (Human) |
|
RP023824 |
ABM |
100 ug |
Ask for price |
) PLOD2 Recombinant Protein (Mouse) |
|
RP162947 |
ABM |
100 ug |
Ask for price |
PLOD2 Recombinant Protein (Mouse) |
|
RP162950 |
ABM |
100 ug |
Ask for price |
PLOD2 Rabbit Polyclonal Antibody
