CelltaGen
셀타젠 Genetic Genotyping

PLOD2 Rabbit Polyclonal Antibody

PLOD2 Polyclonal Antibody

ABP59944-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680
  • Applications tips:
Description: A polyclonal antibody for detection of PLOD2 from Human, Mouse, Rat. This PLOD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680

PLOD2 Polyclonal Antibody

ABP59944-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680
  • Applications tips:
Description: A polyclonal antibody for detection of PLOD2 from Human, Mouse, Rat. This PLOD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680

PLOD2 Polyclonal Antibody

ABP59944-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680
  • Applications tips:
Description: A polyclonal antibody for detection of PLOD2 from Human, Mouse, Rat. This PLOD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLOD2 protein at amino acid sequence of 600-680

PLOD2 Polyclonal Antibody

A63150 100 µg
EUR 570.55
Description: The best epigenetics products

PLOD2 Polyclonal Antibody

30767-100ul 100ul
EUR 252

PLOD2 Polyclonal Antibody

30767-50ul 50ul
EUR 187

PLOD2 Polyclonal Antibody

28422-100ul 100ul
EUR 252

PLOD2 Polyclonal Antibody

28422-50ul 50ul
EUR 187

PLOD2 Rabbit pAb

A14045-100ul 100 ul
EUR 308

PLOD2 Rabbit pAb

A14045-200ul 200 ul
EUR 459

PLOD2 Rabbit pAb

A14045-20ul 20 ul
EUR 183

PLOD2 Rabbit pAb

A14045-50ul 50 ul
EUR 223

PLOD2 Rabbit pAb

A6946-100ul 100 ul
EUR 308

PLOD2 Rabbit pAb

A6946-200ul 200 ul
EUR 459

PLOD2 Rabbit pAb

A6946-20ul 20 ul
EUR 183

PLOD2 Rabbit pAb

A6946-50ul 50 ul
EUR 223

PLOD2 Polyclonal Conjugated Antibody

C30767 100ul
EUR 397

PLOD2 Polyclonal Conjugated Antibody

C28422 100ul
EUR 397

PLOD2 antibody

70R-5438 50 ug
EUR 467
Description: Rabbit polyclonal PLOD2 antibody raised against the middle region of PLOD2

PLOD2 antibody

70R-36602 100 ug
EUR 349
Description: Rabbit Polyclonal PLOD2 antibody

PLOD2 antibody

70R-19352 50 ul
EUR 435
Description: Rabbit polyclonal PLOD2 antibody

PLOD2 Antibody

1-CSB-PA018200GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PLOD2. Recognizes PLOD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PLOD2 Antibody

1-CSB-PA018200LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLOD2. Recognizes PLOD2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

Polyclonal PLOD2 Antibody (C-term)

APR10906G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLOD2 (C-term). This antibody is tested and proven to work in the following applications:

PLOD2 Polyclonal Antibody, HRP Conjugated

A63151 100 µg
EUR 570.55
Description: kits suitable for this type of research

PLOD2 Polyclonal Antibody, FITC Conjugated

A63152 100 µg
EUR 570.55
Description: fast delivery possible

PLOD2 Polyclonal Antibody, Biotin Conjugated

A63153 100 µg
EUR 570.55
Description: reagents widely cited

Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit

DLR-PLOD2-Hu-48T 48T
EUR 517
  • Should the Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit

DLR-PLOD2-Hu-96T 96T
EUR 673
  • Should the Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit

RD-PLOD2-Hu-48Tests 48 Tests
EUR 521

Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit

RD-PLOD2-Hu-96Tests 96 Tests
EUR 723

Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit

RDR-PLOD2-Hu-48Tests 48 Tests
EUR 544

Human Procollagen Lysine-2-Oxoglutarate-5-Dioxygenase 2 (PLOD2) ELISA Kit

RDR-PLOD2-Hu-96Tests 96 Tests
EUR 756

PLOD2-Specific Antibody

abx236552-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

PLOD2-Specific Antibody

DF12018 200ul
EUR 304
Description: PLOD2-Specific antibody detects endogenous levels of PLOD2-Specific.

Anti-PLOD2 antibody

STJ29026 100 µl
EUR 277
Description: The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-PLOD2 antibody

STJ192482 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PLOD2

Anti-PLOD2 antibody

STJ115980 100 µl
EUR 277
Description: The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms.

Plod2/ Rat Plod2 ELISA Kit

ELI-15340r 96 Tests
EUR 886

PLOD2 siRNA

20-abx928976
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PLOD2 siRNA

20-abx928977
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PLOD2

YF-PA13829 50 ug
EUR 363
Description: Mouse polyclonal to PLOD2

anti-PLOD2

YF-PA13830 100 ul
EUR 403
Description: Rabbit polyclonal to PLOD2

anti-PLOD2

YF-PA13831 100 ug
EUR 403
Description: Rabbit polyclonal to PLOD2

anti- PLOD2-Specific antibody

FNab06552 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:200-1:1000
  • IHC: 1:100-1:400
  • IF: 1:10-1:100
  • Immunogen: procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
  • Uniprot ID: O00469
  • Research Area: Metabolism
Description: Antibody raised against PLOD2-Specific

PLOD2 Antibody, HRP conjugated

1-CSB-PA018200LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLOD2. Recognizes PLOD2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PLOD2 Antibody, FITC conjugated

1-CSB-PA018200LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLOD2. Recognizes PLOD2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PLOD2 Antibody, Biotin conjugated

1-CSB-PA018200LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLOD2. Recognizes PLOD2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-PLOD2-Specific antibody

PAab06552 100 ug
EUR 355

PLOD2 cloning plasmid

CSB-CL018200HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2277
  • Sequence: atggggggatgcacggtgaagcctcagctgctgctcctggcgctcgtcctccacccctggaatccctgtctgggtgcggactcggagaagccctcgagcatccccacagataaattattagtcataactgtagcaacaaaagaaagtgatggattccatcgatttatgcagtcag
  • Show more
Description: A cloning plasmid for the PLOD2 gene.

PLOD2 Blocking Peptide

33R-4019 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLOD2 antibody, catalog no. 70R-5438

Mouse PLOD2 shRNA Plasmid

20-abx973717
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PLOD2 ELISA KIT

ELI-15339h 96 Tests
EUR 824

PLOD2 ELISA KIT|Human

EF001867 96 Tests
EUR 689

Mouse Plod2 ELISA KIT

ELI-38055m 96 Tests
EUR 865

Human PLOD2 shRNA Plasmid

20-abx953591
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PLOD2-Specific Blocking Peptide

DF12018-BP 1mg
EUR 195

PLOD2 Recombinant Protein (Human)

RP023824 100 ug Ask for price

PLOD2 Recombinant Protein (Rat)

RP221033 100 ug Ask for price

PLOD2 Recombinant Protein (Rat)

RP221036 100 ug Ask for price

PLOD2 Rabbit Polyclonal Antibody