PON2 Rabbit Polyclonal Antibody

PON2 Polyclonal Antibody
ABP59969-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human PON2 protein Applications tips:
Description: A polyclonal antibody for detection of PON2 from Human, Mouse, Rat. This PON2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON2 protein

PON2 Polyclonal Antibody
ABP59969-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human PON2 protein Applications tips:
Description: A polyclonal antibody for detection of PON2 from Human, Mouse, Rat. This PON2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON2 protein

PON2 Polyclonal Antibody
ABP59969-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PON2 protein Applications tips:
Description: A polyclonal antibody for detection of PON2 from Human, Mouse, Rat. This PON2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON2 protein

Human Paraoxonase 2 (PON2) ELISA Kit
DLR-PON2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Paraoxonase 2 (PON2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Paraoxonase 2 (PON2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Paraoxonase 2 (PON2) ELISA Kit
DLR-PON2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Paraoxonase 2 (PON2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Paraoxonase 2 (PON2) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Paraoxonase 2 (PON2) ELISA Kit
DLR-PON2-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Paraoxonase 2 (PON2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Paraoxonase 2 (PON2) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Paraoxonase 2 (PON2) ELISA Kit
DLR-PON2-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Paraoxonase 2 (PON2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Paraoxonase 2 (PON2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Paraoxonase 2 (PON2) ELISA Kit
RD-PON2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Paraoxonase 2 (PON2) ELISA Kit
RD-PON2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Paraoxonase 2 (PON2) ELISA Kit
RD-PON2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Paraoxonase 2 (PON2) ELISA Kit
RD-PON2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Paraoxonase 2 (PON2) ELISA Kit
RDR-PON2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Paraoxonase 2 (PON2) ELISA Kit
RDR-PON2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Paraoxonase 2 (PON2) ELISA Kit
RDR-PON2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Paraoxonase 2 (PON2) ELISA Kit
RDR-PON2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

PON2 Rabbit pAb
A1646-100ul	Abclonal	100 ul	EUR 308

PON2 Rabbit pAb
A1646-200ul	Abclonal	200 ul	EUR 459

PON2 Rabbit pAb
A1646-20ul	Abclonal	20 ul	EUR 183

PON2 Rabbit pAb
A1646-50ul	Abclonal	50 ul	EUR 223

PON2 Rabbit pAb
A14048-100ul	Abclonal	100 ul	EUR 308

PON2 Rabbit pAb
A14048-200ul	Abclonal	200 ul	EUR 459

PON2 Rabbit pAb
A14048-20ul	Abclonal	20 ul	EUR 183

PON2 Rabbit pAb
A14048-50ul	Abclonal	50 ul	EUR 223

Polyclonal PON2 Antibody (Center)
AMR09439G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PON2 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal PON2 Antibody (N-term)
AMR09421G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PON2 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal PON2 Antibody (internal region)
AMR09440G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PON2 (internal region). This antibody is tested and proven to work in the following applications:

Paraoxonase 2 (PON2) polyclonal antibody
ABP-PAB-11651	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

PON2 Antibody
ABD6527	Lifescience Market	100 ug	EUR 438

PON2 Antibody
49891-100ul	SAB	100ul	EUR 333

PON2 Antibody
49891-50ul	SAB	50ul	EUR 239

PON2 antibody
10R-8628	Fitzgerald	100 ul	EUR 393
Description: Mouse monoclonal PON2 antibody

PON2 Antibody
32364-100ul	SAB	100ul	EUR 252

PON2 antibody
22565-100ul	SAB	100ul	EUR 390

PON2 antibody
70R-19420	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PON2 antibody

PON2 antibody
70R-12772	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal PON2 antibody

PON2 Antibody
DF6527	Affbiotech	200ul	EUR 304
Description: PON2 Antibody detects endogenous levels of total PON2.

PON2 Antibody
1-CSB-PA613586LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON2. Recognizes PON2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

PON2 Antibody
1-CSB-PA018370GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PON2. Recognizes PON2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

PON2 Antibody
CSB-PA018370KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PON2. Recognizes PON2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PON2 Antibody
CSB-PA018370KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PON2. Recognizes PON2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

Paraoxonase 2 (PON2) Polyclonal Antibody (Human)
4-PAD177Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON2 (Met1~Leu354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 2 (PON2)

Paraoxonase 2 (PON2) Polyclonal Antibody (Mouse)
4-PAD177Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON2 (Met4~Arg289) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Paraoxonase 2 (PON2)

[KO Validated] PON2 Rabbit pAb
A19852-100ul	Abclonal	100 ul	EUR 410

[KO Validated] PON2 Rabbit pAb
A19852-200ul	Abclonal	200 ul	EUR 571

[KO Validated] PON2 Rabbit pAb
A19852-20ul	Abclonal	20 ul	EUR 221

[KO Validated] PON2 Rabbit pAb
A19852-50ul	Abclonal	50 ul	EUR 287

[KO Validated] PON2 Rabbit pAb
A19853-100ul	Abclonal	100 ul	EUR 410

[KO Validated] PON2 Rabbit pAb
A19853-200ul	Abclonal	200 ul	EUR 571

[KO Validated] PON2 Rabbit pAb
A19853-20ul	Abclonal	20 ul	EUR 221

[KO Validated] PON2 Rabbit pAb
A19853-50ul	Abclonal	50 ul	EUR 287

PON2 Conjugated Antibody
C49891	SAB	100ul	EUR 397

PON2 Conjugated Antibody
C32364	SAB	100ul	EUR 397

anti- PON2 antibody
FNab06639	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:200 - 1:2000 IHC: 1:50 - 1:200 Immunogen: paraoxonase 2 Uniprot ID: Q15165 Gene ID: 5445 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against PON2

Anti-PON2 Antibody
PB9779	BosterBio	100ug/vial	EUR 294

Anti-PON2 antibody
PAab06639	Lifescience Market	100 ug	EUR 412

Anti-PON2 Antibody
PA2254	BosterBio	100ug/vial	EUR 294

Anti-PON2 antibody
STJ73119	St John's Laboratory	100 µg	EUR 359

Anti-PON2 antibody
STJ72145	St John's Laboratory	100 µg	EUR 359

Anti-PON2 antibody
STJ11100728	St John's Laboratory	100 µl	EUR 413
Description: This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-PON2 antibody
STJ11100729	St John's Laboratory	100 µl	EUR 413
Description: This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-PON2 antibody
STJ25057	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-PON2 antibody
STJ192303	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PON2

Anti-PON2 antibody
STJ115983	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described.

Pon2/ Rat Pon2 ELISA Kit
ELI-15363r	Lifescience Market	96 Tests	EUR 886

Polyclonal Goat Anti-PON2 Antibody (internal region)
AMM05095G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-PON2 (internal region). This antibody is tested and proven to work in the following applications:

Paraoxonase 2 (PON2) Polyclonal Antibody (Human), APC
4-PAD177Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON2 (Met1~Leu354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 2 (PON2). This antibody is labeled with APC.

Paraoxonase 2 (PON2) Polyclonal Antibody (Human), Biotinylated
4-PAD177Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON2 (Met1~Leu354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 2 (PON2). This antibody is labeled with Biotin.

Paraoxonase 2 (PON2) Polyclonal Antibody (Human), Cy3
4-PAD177Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON2 (Met1~Leu354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 2 (PON2). This antibody is labeled with Cy3.

Paraoxonase 2 (PON2) Polyclonal Antibody (Human), FITC
4-PAD177Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON2 (Met1~Leu354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 2 (PON2). This antibody is labeled with FITC.

Paraoxonase 2 (PON2) Polyclonal Antibody (Human), HRP
4-PAD177Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON2 (Met1~Leu354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 2 (PON2). This antibody is labeled with HRP.

Paraoxonase 2 (PON2) Polyclonal Antibody (Human), PE
4-PAD177Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON2 (Met1~Leu354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 2 (PON2). This antibody is labeled with PE.

Paraoxonase 2 (PON2) Polyclonal Antibody (Mouse), APC
4-PAD177Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON2 (Met4~Arg289) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Paraoxonase 2 (PON2). This antibody is labeled with APC.

Paraoxonase 2 (PON2) Polyclonal Antibody (Mouse), Biotinylated
4-PAD177Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON2 (Met4~Arg289) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Paraoxonase 2 (PON2). This antibody is labeled with Biotin.

Paraoxonase 2 (PON2) Polyclonal Antibody (Mouse), Cy3
4-PAD177Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON2 (Met4~Arg289) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Paraoxonase 2 (PON2). This antibody is labeled with Cy3.

Paraoxonase 2 (PON2) Polyclonal Antibody (Mouse), FITC
4-PAD177Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON2 (Met4~Arg289) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Paraoxonase 2 (PON2). This antibody is labeled with FITC.

Paraoxonase 2 (PON2) Polyclonal Antibody (Mouse), HRP
4-PAD177Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON2 (Met4~Arg289) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Paraoxonase 2 (PON2). This antibody is labeled with HRP.

Paraoxonase 2 (PON2) Polyclonal Antibody (Mouse), PE
4-PAD177Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON2 (Met4~Arg289) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Paraoxonase 2 (PON2). This antibody is labeled with PE.

PON2 siRNA
20-abx904138	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PON2 siRNA
20-abx929265	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PON2 siRNA
20-abx929266	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-PON2
YF-PA24423	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to PON2

Paraoxonase 2 (PON2) Antibody
20-abx128082	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Paraoxonase 2 (PON2) Antibody
20-abx129485	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Paraoxonase 2 (PON2) Antibody
20-abx173951	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Paraoxonase 2 (PON2) Antibody
20-abx177913	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

PON2 Antibody, HRP conjugated
1-CSB-PA613586LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON2. Recognizes PON2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PON2 Antibody, FITC conjugated
1-CSB-PA613586LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON2. Recognizes PON2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PON2 Antibody, Biotin conjugated
1-CSB-PA613586LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON2. Recognizes PON2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Paraoxonase 2 (PON2) Polyclonal Antibody (Human), APC-Cy7
4-PAD177Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON2 (Met1~Leu354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 2 (PON2). This antibody is labeled with APC-Cy7.

Paraoxonase 2 (PON2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAD177Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PON2 (Met4~Arg289) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Paraoxonase 2 (PON2). This antibody is labeled with APC-Cy7.

PON2 cloning plasmid
CSB-CL613586HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 660 Sequence: atggggcggctggtggctgtgggcttgctggggatcgcgctggcgctcctgggcgagaggcttctggcactcagaaatcgacttaaagcctccagagaagtagaatctgtagaccttccacactgccacctgattaaaggaattgaagctggctctgaagatattgacatacttcc Show more
Description: A cloning plasmid for the PON2 gene.

PON2 Blocking Peptide
DF6527-BP	Affbiotech	1mg	EUR 195

anti-PON2 (AF3E6)
LF-MA0349	Abfrontier	100 ul	EUR 334
Description: Mouse monoclonal to PON2

Rabbit Serum paraoxonase/arylesterase 2(PON2) ELISA kit
E04S0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serum paraoxonase/arylesterase 2(PON2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Serum paraoxonase/arylesterase 2(PON2) ELISA kit
E04S0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serum paraoxonase/arylesterase 2(PON2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Serum paraoxonase/arylesterase 2(PON2) ELISA kit
E04S0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serum paraoxonase/arylesterase 2(PON2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Serum Paraoxonase/arylesterase 2 (PON2) Antibody
abx117133-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Serum Paraoxonase/arylesterase 2 (PON2) Antibody
20-abx001386	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Serum Paraoxonase/arylesterase 2 (PON2) Antibody
20-abx142155	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Serum Paraoxonase/arylesterase 2 (PON2) Antibody
abx036896-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Serum Paraoxonase/arylesterase 2 (PON2) Antibody
abx032607-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Serum Paraoxonase/arylesterase 2 (PON2) Antibody
abx032607-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Serum Paraoxonase/arylesterase 2 (PON2) Antibody
abx027111-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Serum Paraoxonase/arylesterase 2 (PON2) Antibody
abx027111-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Serum Paraoxonase/arylesterase 2 (PON2) Antibody
abx431888-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Serum Paraoxonase/arylesterase 2 (PON2) Antibody
abx431928-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Serum Paraoxonase/arylesterase 2 (PON2) Antibody
abx236639-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Serum Paraoxonase/arylesterase 2 (PON2) Antibody
20-abx301069	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Active Paraoxonase 2 (PON2)
4-APD177Hu01	Cloud-Clone	EUR 777.38 EUR 311.00 EUR 2640.16 EUR 946.72 EUR 1793.44 EUR 583.00 EUR 6450.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q15165 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): Inquire Isoelectric Point: 5.3
Description: Recombinant Human Active Paraoxonase 2 (PON2) expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Rat PON2 shRNA Plasmid
20-abx988831	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PON2 shRNA Plasmid
20-abx983602	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PON2 ELISA Kit
ELA-E10064h	Lifescience Market	96 Tests	EUR 824

PON2 ELISA KIT|Human
EF001822	Lifescience Market	96 Tests	EUR 689

Canine PON2 ELISA KIT
ELI-45532d	Lifescience Market	96 Tests	EUR 928

Human PON2 shRNA Plasmid
20-abx953648	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Paraoxonase 2 (PoN2)
4-RPD177Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q15165 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 43.1kDa Isoelectric Point: Inquire
Description: Recombinant Human Paraoxonase 2 expressed in: E.coli

Recombinant Paraoxonase 2 (PON2)
4-RPD177Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q62086 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 35.7kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Paraoxonase 2 expressed in: E.coli

PON2 Recombinant Protein (Human)
RP024148	ABM	100 ug	Ask for price

PON2 Recombinant Protein (Rat)
RP221432	ABM	100 ug	Ask for price

PON2 Recombinant Protein (Mouse)
RP163472	ABM	100 ug	Ask for price

Serum Paraoxonase/arylesterase 2 (PON2) Antibody (HRP)
20-abx316191	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Paraoxonase/arylesterase 2 (PON2) Antibody (FITC)
20-abx316192	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Paraoxonase/arylesterase 2 (PON2) Antibody (Biotin)
20-abx316193	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse Paraoxonase 2 (PON2) Protein
20-abx167355	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Paraoxonase 2 (PoN2) Protein
20-abx166714	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

PON2 ORF Vector (Human) (pORF)
ORF008050	ABM	1.0 ug DNA	EUR 95

Pon2 ORF Vector (Rat) (pORF)
ORF073812	ABM	1.0 ug DNA	EUR 506

Pon2 ORF Vector (Mouse) (pORF)
ORF054492	ABM	1.0 ug DNA	EUR 95

PON2 ELISA Kit (Human) (OKAN06250)
OKAN06250	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.27 ng/mL

PON2 ELISA Kit (Mouse) (OKCD02815)
OKCD02815	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Capable of hydrolyzing lactones and a number of aromatic carboxylic acid esters. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.052 ng/mL

PON2 ELISA Kit (Human) (OKCD08406)
OKCD08406	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Recombinant Human Paraoxonase-2;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.32ng/mL

PON2 ELISA Kit (Rat) (OKEH03580)
OKEH03580	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Capable of hydrolyzing lactones and a number of aromatic carboxylic acid esters.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL

PON2 ELISA Kit (Mouse) (OKEH07118)
OKEH07118	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Capable of hydrolyzing lactones and a number of aromatic carboxylic acid esters.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.081 ng/mL

PON2 ELISA Kit (Bovine) (OKEH07519)
OKEH07519	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

PON2 ELISA Kit (Chicken) (OKEH07520)
OKEH07520	Aviva Systems Biology	96 Wells	EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

PON2 ELISA Kit (Dog) (OKEH07521)
OKEH07521	Aviva Systems Biology	96 Wells	EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Human Paraoxonase 2 (PON2) Protein (Active)
20-abx655794	Abbexa	EUR 1066.00 EUR 398.00 EUR 3530.00 EUR 1288.00 EUR 732.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Paraoxonase 2 (PON2) ELISA Kit
20-abx154505	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Paraoxonase 2 (PON2) ELISA Kit
20-abx152643	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Paraoxonase 2 (PON2) CLIA Kit
20-abx494121	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Paraoxonase 2 (PON2) CLIA Kit
20-abx494122	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Paraoxonase 2 (PON2) ELISA Kit
abx250364-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

PON2 sgRNA CRISPR Lentivector set (Human)
K1687901	ABM	3 x 1.0 ug	EUR 339

Pon2 sgRNA CRISPR Lentivector set (Mouse)
K4170601	ABM	3 x 1.0 ug	EUR 339

Pon2 sgRNA CRISPR Lentivector set (Rat)
K6745701	ABM	3 x 1.0 ug	EUR 339

Human Paraoxonase 2 ELISA Kit (PON2)
RK02115	Abclonal	96 Tests	EUR 521

Human Paraoxonase 2(PON2)ELISA Kit
QY-E03755	Qayee Biotechnology	96T	EUR 361

PON2 Paraoxonase-2 Human Recombinant Protein
PROTQ15165	BosterBio	Regular: 10ug	EUR 317
Description: Paraoxonase-2 Human Recombinant is expressed in E. Coli having a molecular weight of 43.5 kDa and fused to an amino terminal hexahistidine tag.;The PON2 purified by proprietary chromatographic techniques.

Human Paraoxonase 2 (PON2) ELISA Kit
SED177Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 2 (PON2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 2 (PON2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Paraoxonase 2 (PON2) ELISA Kit
SED177Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 2 (PON2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 2 (PON2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Paraoxonase 2 (PON2) ELISA Kit
SED177Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 2 (PON2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 2 (PON2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Paraoxonase 2 (PON2) ELISA Kit
SED177Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 2 (PON2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 2 (PON2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Paraoxonase 2 (PON2) ELISA Kit
4-SED177Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Paraoxonase 2 elisa. Alternative names of the recognized antigen: Serum Paraoxonase/Arylesterase 2 Paraoxonase Nirs Aromatic esterase 2 Serum aryldialkylphosphatase 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Paraoxonase 2 (PON2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Paraoxonase 2 (PON2) ELISA Kit
SED177Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Paraoxonase 2 (PON2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Paraoxonase 2 (PON2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Paraoxonase 2 (PON2) ELISA Kit
SED177Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Paraoxonase 2 (PON2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Paraoxonase 2 (PON2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Paraoxonase 2 (PON2) ELISA Kit
SED177Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Paraoxonase 2 (PON2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Paraoxonase 2 (PON2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Paraoxonase 2 (PON2) ELISA Kit
SED177Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Paraoxonase 2 (PON2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Paraoxonase 2 (PON2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Paraoxonase 2 (PON2) ELISA Kit
4-SED177Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Paraoxonase 2 elisa. Alternative names of the recognized antigen: Serum Paraoxonase/Arylesterase 2 Paraoxonase Nirs Aromatic esterase 2 Serum aryldialkylphosphatase 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Paraoxonase 2 (PON2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

PON2 Rabbit Polyclonal Antibody