CelltaGen
셀타젠 Genetic Genotyping

PON3 Rabbit Polyclonal Antibody

PON3 Polyclonal Antibody

ABP59970-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PON3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PON3 from Human, Mouse, Rat. This PON3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON3 protein

PON3 Polyclonal Antibody

ABP59970-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PON3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PON3 from Human, Mouse, Rat. This PON3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON3 protein

PON3 Polyclonal Antibody

ES11115-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PON3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PON3 Polyclonal Antibody

ES11115-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PON3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Paraoxonase 3 (PON3) ELISA Kit

DLR-PON3-Hu-48T 48T
EUR 517
  • Should the Human Paraoxonase 3 (PON3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Paraoxonase 3 (PON3) in samples from serum, plasma or other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit

DLR-PON3-Hu-96T 96T
EUR 673
  • Should the Human Paraoxonase 3 (PON3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Paraoxonase 3 (PON3) in samples from serum, plasma or other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit

RDR-PON3-Hu-48Tests 48 Tests
EUR 544

Human Paraoxonase 3 (PON3) ELISA Kit

RDR-PON3-Hu-96Tests 96 Tests
EUR 756

Human Paraoxonase 3 (PON3) ELISA Kit

RD-PON3-Hu-48Tests 48 Tests
EUR 521

Human Paraoxonase 3 (PON3) ELISA Kit

RD-PON3-Hu-96Tests 96 Tests
EUR 723

PON3 Rabbit pAb

A16418-100ul 100 ul
EUR 308

PON3 Rabbit pAb

A16418-200ul 200 ul
EUR 459

PON3 Rabbit pAb

A16418-20ul 20 ul
EUR 183

PON3 Rabbit pAb

A16418-50ul 50 ul
EUR 223

PON3 Polyclonal Conjugated Antibody

C29835 100ul
EUR 397

PON3 antibody

10R-8555 100 ul
EUR 393
Description: Mouse monoclonal PON3 antibody

PON3 Antibody

39919-100ul 100ul
EUR 390

PON3 Antibody

1-CSB-PA614883LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

PON3 Antibody

DF8108 200ul
EUR 304
Description: PON3 Antibody detects endogenous levels of total PON3.

PON3 antibody

70R-6930 50 ug
EUR 467
Description: Rabbit polyclonal PON3 antibody raised against the middle region of PON3

PON3 antibody

70R-7456 50 ug
EUR 467
Description: Rabbit polyclonal PON3 antibody raised against the middle region of PON3

PON3 Antibody

ABD8108 100 ug
EUR 438

PON3 Antibody

ABD8148 100 ug
EUR 438

Polyclonal PON3 Antibody (N-term)

APR10907G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PON3 (N-term). This antibody is tested and proven to work in the following applications:

PON3 Polyclonal Antibody, HRP Conjugated

A68840 100 ?g
EUR 628.55
Description: reagents widely cited

PON3 Polyclonal Antibody, FITC Conjugated

A68841 100 ?g
EUR 628.55
Description: Ask the seller for details

PON3 Polyclonal Antibody, Biotin Conjugated

A68842 100 ?g
EUR 628.55
Description: The best epigenetics products

Paraoxonase 3 (PON3) Polyclonal Antibody (Human)

4-PAD178Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3)

Anti-PON3 antibody

STJ118858 100 µl
EUR 277

Anti-PON3 antibody

STJ192273 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PON3

Pon3/ Rat Pon3 ELISA Kit

ELI-12743r 96 Tests
EUR 886

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), APC

4-PAD178Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with APC.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), Biotinylated

4-PAD178Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with Biotin.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), Cy3

4-PAD178Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with Cy3.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), FITC

4-PAD178Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with FITC.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), HRP

4-PAD178Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with HRP.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), PE

4-PAD178Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with PE.

Rabbit Paraoxonase 3 (PON3) ELISA Kit

abx363833-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

PON3 siRNA

20-abx904139
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PON3 siRNA

20-abx929267
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PON3 siRNA

20-abx929268
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PON3

YF-PA13885 50 ug
EUR 363
Description: Mouse polyclonal to PON3

anti-PON3

YF-PA13886 100 ug
EUR 403
Description: Rabbit polyclonal to PON3

PON3 Antibody, HRP conjugated

1-CSB-PA614883LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PON3 Antibody, FITC conjugated

1-CSB-PA614883LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PON3 Antibody, Biotin conjugated

1-CSB-PA614883LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Paraoxonase 3 (PON3) Antibody

20-abx128083
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Paraoxonase 3 (PON3) Antibody

abx037062-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Paraoxonase 3 (PON3) Antibody

20-abx173952
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), APC-Cy7

4-PAD178Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with APC-Cy7.

PON3 Blocking Peptide

33R-2947 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PON3 antibody, catalog no. 70R-6930

PON3 Blocking Peptide

33R-7223 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PON3 antibody, catalog no. 70R-7456

PON3 Blocking Peptide

DF8108-BP 1mg
EUR 195

PON3 cloning plasmid

CSB-CL614883HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1065
  • Sequence: atggggaagctcgtggcgctggtcctgctgggggtcggcctgtccttagtcggggagatgttcctggcgtttagagaaagggtgaatgcctctcgagaagtggagccagtagaacctgaaaactgccaccttattgaggaacttgaaaatggctctgaagatattgatatacttc
  • Show more
Description: A cloning plasmid for the PON3 gene.

Rabbit Serum paraoxonase/lactonase 3, PON3 ELISA KIT

ELI-45533Ra 96 Tests
EUR 928

Serum Paraoxonase / Lactonase 3 (PON3) Antibody

abx034015-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serum Paraoxonase / Lactonase 3 (PON3) Antibody

abx034015-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serum Paraoxonase / Lactonase 3 (PON3) Antibody

20-abx334317
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Active Paraoxonase 3 (PON3)

4-APD178Hu01
  • EUR 942.24
  • EUR 355.00
  • EUR 3258.40
  • EUR 1152.80
  • EUR 2205.60
  • EUR 694.00
  • EUR 7996.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15166
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.2kDa
  • Isoelectric Point: 5.2
Description: Recombinant Human Paraoxonase 3 expressed in: E.coli

Human PON3 ELISA Kit

ELA-E10065h 96 Tests
EUR 824

PON3 ELISA KIT|Human

EF001831 96 Tests
EUR 689

Rat PON3 shRNA Plasmid

20-abx989703
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PON3 shRNA Plasmid

20-abx953649
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PON3 shRNA Plasmid

20-abx983070
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Paraoxonase 3 (PON3)

4-RPD178Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15166
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.2kDa
  • Isoelectric Point: 5.2
Description: Recombinant Human Paraoxonase 3 expressed in: E.coli

PON3 Recombinant Protein (Human)

RP024151 100 ug Ask for price

PON3 Recombinant Protein (Mouse)

RP163475 100 ug Ask for price

PON3 Recombinant Protein (Rat)

RP221435 100 ug Ask for price

Monoclonal PON3 Antibody (clone 5G11), Clone: 5G11

AMR09422G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human PON3 (clone 5G11). The antibodies are raised in Mouse and are from clone 5G11. This antibody is applicable in WB and IHC-P

Serum Paraoxonase / Lactonase 3 (PON3) Antibody (HRP)

20-abx337658
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Paraoxonase / Lactonase 3 (PON3) Antibody (FITC)

20-abx337659
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Paraoxonase / Lactonase 3 (PON3) Antibody (Biotin)

20-abx337660
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Paraoxonase 3 (PON3) Protein

20-abx166722
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

anti-PON3 (Paraoxonase 3) (5G11)

LF-MA0273 100 ul
EUR 334
Description: Mouse monoclonal to PON3 (Paraoxonase 3)

Pon3 ORF Vector (Rat) (pORF)

ORF073813 1.0 ug DNA
EUR 506

PON3 ORF Vector (Human) (pORF)

ORF008051 1.0 ug DNA
EUR 95

Pon3 ORF Vector (Mouse) (pORF)

ORF054493 1.0 ug DNA
EUR 506

PON3 ELISA Kit (Human) (OKAN06251)

OKAN06251 96 Wells
EUR 792
Description: Description of target: This gene is a member of the paraoxonase family and lies in a cluster on chromosome 7 with the other two family members. The encoded protein is secreted into the bloodstream and associates with high-density lipoprotein (HDL). The protein also rapidly hydrolyzes lactones and can inhibit the oxidation of low-density lipoprotein (LDL), a function that is believed to slow the initiation and progression of atherosclerosis. Alternatively spliced variants which encode different protein isoforms have been described; however, only one has been fully characterized.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 37 pg/mL

PON3 ELISA Kit (Human) (OKCD08407)

OKCD08407 96 Wells
EUR 975
Description: Description of target: This gene is a member of the paraoxonase family and lies in a cluster on chromosome 7 with the other two family members. The encoded protein is secreted into the bloodstream and associates with high-density lipoprotein (HDL). The protein also rapidly hydr;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 37pg/mL

PON3 ELISA Kit (Mouse) (OKEH05754)

OKEH05754 96 Wells
EUR 779
Description: Description of target: Has low activity towards the organophosphate paraxon and aromatic carboxylic acid esters. Rapidly hydrolyzes lactones such as statin prodrugs (e.g. lovastatin). Hydrolyzes aromatic lactones and 5- or 6-member ring lactones with aliphatic substituents but not simple lactones or those with polar substituents.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.161 ng/mL

PON3 ELISA Kit (Rat) (OKEH06258)

OKEH06258 96 Wells
EUR 779
Description: Description of target: Has low activity towards the organophosphate paraxon and aromatic carboxylic acid esters. Rapidly hydrolyzes lactones such as statin prodrugs (e.g. lovastatin). Hydrolyzes aromatic lactones and 5- or 6-member ring lactones with aliphatic substituents but not simple lactones or those with polar substituents.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.162 ng/mL

Human Paraoxonase 3 (PON3) CLIA Kit

abx196185-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Paraoxonase 3 (PON3) ELISA Kit

20-abx152644
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Paraoxonase 3 (PON3) ELISA Kit

abx250365-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Paraoxonase 3 (PON3) ELISA Kit

CSB-E15783h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Paraoxonase 3 (PON3) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Paraoxonase 3 (PON3) ELISA Kit

1-CSB-E15783h
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Paraoxonase 3 (PON3) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pig Paraoxonase 3 (PON3) ELISA Kit

abx360901-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Paraoxonase 3 (PON3) ELISA Kit

abx359115-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Paraoxonase 3 (PON3) ELISA Kit

abx355609-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Paraoxonase 3 (PON3) Protein (Active)

20-abx651428
  • EUR 1288.00
  • EUR 453.00
  • EUR 4351.00
  • EUR 1567.00
  • EUR 871.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Paraoxonase 3 (PON3) CLIA Kit

20-abx494123
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Pon3 sgRNA CRISPR Lentivector set (Mouse)

K5033301 3 x 1.0 ug
EUR 339

Pon3 sgRNA CRISPR Lentivector set (Rat)

K7196701 3 x 1.0 ug
EUR 339

PON3 sgRNA CRISPR Lentivector set (Human)

K1688001 3 x 1.0 ug
EUR 339

Human Paraoxonase 3 ELISA Kit (PON3)

RK02116 96 Tests
EUR 521

Human Paraoxonase 3 (PON3) ELISA Kit

SED178Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit

SED178Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit

SED178Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit

SED178Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit

4-SED178Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Paraoxonase 3 elisa. Alternative names of the recognized antigen: Serum paraoxonase/lactonase 3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Paraoxonase 3 (PON3) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

CLIA kit for Human PON3 (Paraoxonase 3)

E-CL-H1380 1 plate of 96 wells
EUR 584
  • Gentaur's PON3 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human PON3 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human PON3 (Paraoxonase 3) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human PON3 (Paraoxonase 3)

E-EL-H2374 1 plate of 96 wells
EUR 534
  • Gentaur's PON3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PON3. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PON3 (Paraoxonase 3) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human PON3 (Paraoxonase 3)

ELK3696 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Paraoxonase 3 (PON3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Paraoxonase 3
  • Show more
Description: A sandwich ELISA kit for detection of Paraoxonase 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Paraoxonase 3 (PON3) ELISA Kit

abx357805-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pon3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5033302 1.0 ug DNA
EUR 154

Pon3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5033303 1.0 ug DNA
EUR 154

Pon3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5033304 1.0 ug DNA
EUR 154

ELISA kit for Human Paraoxonase 3 (PON3)

KTE61197-48T 48T
EUR 332
  • Members of the paraoxonase (EC 3.1.1.2) gene family, such as PON3, encode high density lipoprotein (HDL)-related glycoproteins with multienzymatic properties. (Lu et al., 2006).Lu et al. (2006) cloned PON3 from a fetal liver cDNA library. The deduced
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Paraoxonase 3 (PON3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Paraoxonase 3 (PON3)

KTE61197-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Members of the paraoxonase (EC 3.1.1.2) gene family, such as PON3, encode high density lipoprotein (HDL)-related glycoproteins with multienzymatic properties. (Lu et al., 2006).Lu et al. (2006) cloned PON3 from a fetal liver cDNA library. The deduced
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Paraoxonase 3 (PON3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Paraoxonase 3 (PON3)

KTE61197-96T 96T
EUR 539
  • Members of the paraoxonase (EC 3.1.1.2) gene family, such as PON3, encode high density lipoprotein (HDL)-related glycoproteins with multienzymatic properties. (Lu et al., 2006).Lu et al. (2006) cloned PON3 from a fetal liver cDNA library. The deduced
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Paraoxonase 3 (PON3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Pon3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7196702 1.0 ug DNA
EUR 154

Pon3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7196703 1.0 ug DNA
EUR 154

Pon3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7196704 1.0 ug DNA
EUR 154

PON3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1688002 1.0 ug DNA
EUR 154

PON3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1688003 1.0 ug DNA
EUR 154

PON3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1688004 1.0 ug DNA
EUR 154

PON3 Protein Vector (Rat) (pPB-C-His)

PV295250 500 ng
EUR 603

PON3 Protein Vector (Rat) (pPB-N-His)

PV295251 500 ng
EUR 603

PON3 Protein Vector (Rat) (pPM-C-HA)

PV295252 500 ng
EUR 603

PON3 Protein Vector (Rat) (pPM-C-His)

PV295253 500 ng
EUR 603

PON3 Protein Vector (Human) (pPB-C-His)

PV032201 500 ng
EUR 329

PON3 Protein Vector (Human) (pPB-N-His)

PV032202 500 ng
EUR 329

PON3 Protein Vector (Human) (pPM-C-HA)

PV032203 500 ng
EUR 329

PON3 Protein Vector (Human) (pPM-C-His)

PV032204 500 ng
EUR 329

PON3 Protein Vector (Mouse) (pPB-C-His)

PV217970 500 ng
EUR 603

PON3 Protein Vector (Mouse) (pPB-N-His)

PV217971 500 ng
EUR 603

PON3 Protein Vector (Mouse) (pPM-C-HA)

PV217972 500 ng
EUR 603

PON3 Protein Vector (Mouse) (pPM-C-His)

PV217973 500 ng
EUR 603

Pon3 3'UTR Luciferase Stable Cell Line

TU116713 1.0 ml Ask for price

Pon3 3'UTR GFP Stable Cell Line

TU166713 1.0 ml Ask for price

Pon3 3'UTR Luciferase Stable Cell Line

TU216558 1.0 ml Ask for price

Pon3 3'UTR GFP Stable Cell Line

TU266558 1.0 ml Ask for price

PON3 3'UTR GFP Stable Cell Line

TU068470 1.0 ml
EUR 1394

PON3 3'UTR Luciferase Stable Cell Line

TU018470 1.0 ml
EUR 1394

PON3 ELISA Kit (Human) : 96 Wells (OKEH02046)

OKEH02046 96 Wells
EUR 779
Description: Description of target: This gene is a member of the paraoxonase family and lies in a cluster on chromosome 7 with the other two family members. The encoded protein is secreted into the bloodstream and associates with high-density lipoprotein (HDL). The protein also rapidly hydrolyzes lactones and can inhibit the oxidation of low-density lipoprotein (LDL), a function that is believed to slow the initiation and progression of atherosclerosis. Alternatively spliced variants which encode different protein isoforms have been described; however, only one has been fully characterized. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody

ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody

ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody

ABP57575-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

PON3 Rabbit Polyclonal Antibody