PON3 Rabbit Polyclonal Antibody

PON3 Rabbit Polyclonal Antibody

PON3 Polyclonal Antibody
ABP59970-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PON3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PON3 from Human, Mouse, Rat. This PON3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON3 protein

PON3 Polyclonal Antibody
ABP59970-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PON3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PON3 from Human, Mouse, Rat. This PON3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON3 protein

PON3 Polyclonal Antibody
ES11115-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PON3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PON3 Polyclonal Antibody
ES11115-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PON3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Paraoxonase 3 (PON3) ELISA Kit
DLR-PON3-Hu-48T 48T
EUR 517
  • Should the Human Paraoxonase 3 (PON3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Paraoxonase 3 (PON3) in samples from serum, plasma or other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit
DLR-PON3-Hu-96T 96T
EUR 673
  • Should the Human Paraoxonase 3 (PON3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Paraoxonase 3 (PON3) in samples from serum, plasma or other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit
RDR-PON3-Hu-48Tests 48 Tests
EUR 544

Human Paraoxonase 3 (PON3) ELISA Kit
RDR-PON3-Hu-96Tests 96 Tests
EUR 756

Human Paraoxonase 3 (PON3) ELISA Kit
RD-PON3-Hu-48Tests 48 Tests
EUR 521

Human Paraoxonase 3 (PON3) ELISA Kit
RD-PON3-Hu-96Tests 96 Tests
EUR 723

PON3 Rabbit pAb
A16418-100ul 100 ul
EUR 308

PON3 Rabbit pAb
A16418-200ul 200 ul
EUR 459

PON3 Rabbit pAb
A16418-20ul 20 ul
EUR 183

PON3 Rabbit pAb
A16418-50ul 50 ul
EUR 223

PON3 Polyclonal Conjugated Antibody
C29835 100ul
EUR 397

PON3 antibody
10R-8555 100 ul
EUR 393
Description: Mouse monoclonal PON3 antibody

PON3 Antibody
39919-100ul 100ul
EUR 390

PON3 Antibody
1-CSB-PA614883LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

PON3 Antibody
DF8108 200ul
EUR 304
Description: PON3 Antibody detects endogenous levels of total PON3.

PON3 antibody
70R-6930 50 ug
EUR 467
Description: Rabbit polyclonal PON3 antibody raised against the middle region of PON3

PON3 antibody
70R-7456 50 ug
EUR 467
Description: Rabbit polyclonal PON3 antibody raised against the middle region of PON3

PON3 Antibody
ABD8108 100 ug
EUR 438

PON3 Antibody
ABD8148 100 ug
EUR 438

Polyclonal PON3 Antibody (N-term)
APR10907G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PON3 (N-term). This antibody is tested and proven to work in the following applications:

PON3 Polyclonal Antibody, HRP Conjugated
A68840 100 ?g
EUR 628.55
Description: reagents widely cited

PON3 Polyclonal Antibody, FITC Conjugated
A68841 100 ?g
EUR 628.55
Description: Ask the seller for details

PON3 Polyclonal Antibody, Biotin Conjugated
A68842 100 ?g
EUR 628.55
Description: The best epigenetics products

Paraoxonase 3 (PON3) Polyclonal Antibody (Human)
4-PAD178Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3)

Anti-PON3 antibody
STJ118858 100 µl
EUR 277

Anti-PON3 antibody
STJ192273 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PON3

Pon3/ Rat Pon3 ELISA Kit
ELI-12743r 96 Tests
EUR 886

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), APC
4-PAD178Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with APC.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), Biotinylated
4-PAD178Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with Biotin.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), Cy3
4-PAD178Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with Cy3.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), FITC
4-PAD178Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with FITC.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), HRP
4-PAD178Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with HRP.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), PE
4-PAD178Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with PE.

Rabbit Paraoxonase 3 (PON3) ELISA Kit
abx363833-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

PON3 siRNA
20-abx904139
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PON3 siRNA
20-abx929267
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PON3 siRNA
20-abx929268
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PON3
YF-PA13885 50 ug
EUR 363
Description: Mouse polyclonal to PON3

anti-PON3
YF-PA13886 100 ug
EUR 403
Description: Rabbit polyclonal to PON3

PON3 Antibody, HRP conjugated
1-CSB-PA614883LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PON3 Antibody, FITC conjugated
1-CSB-PA614883LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PON3 Antibody, Biotin conjugated
1-CSB-PA614883LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Paraoxonase 3 (PON3) Antibody
20-abx128083
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Paraoxonase 3 (PON3) Antibody
abx037062-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Paraoxonase 3 (PON3) Antibody
20-abx173952
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), APC-Cy7
4-PAD178Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with APC-Cy7.

PON3 Blocking Peptide
33R-2947 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PON3 antibody, catalog no. 70R-6930

PON3 Blocking Peptide
33R-7223 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PON3 antibody, catalog no. 70R-7456

PON3 Blocking Peptide
DF8108-BP 1mg
EUR 195

PON3 cloning plasmid
CSB-CL614883HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1065
  • Sequence: atggggaagctcgtggcgctggtcctgctgggggtcggcctgtccttagtcggggagatgttcctggcgtttagagaaagggtgaatgcctctcgagaagtggagccagtagaacctgaaaactgccaccttattgaggaacttgaaaatggctctgaagatattgatatacttc
  • Show more
Description: A cloning plasmid for the PON3 gene.

Rabbit Serum paraoxonase/lactonase 3, PON3 ELISA KIT
ELI-45533Ra 96 Tests
EUR 928

Serum Paraoxonase / Lactonase 3 (PON3) Antibody
abx034015-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serum Paraoxonase / Lactonase 3 (PON3) Antibody
abx034015-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serum Paraoxonase / Lactonase 3 (PON3) Antibody
20-abx334317
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Active Paraoxonase 3 (PON3)
4-APD178Hu01
  • EUR 942.24
  • EUR 355.00
  • EUR 3258.40
  • EUR 1152.80
  • EUR 2205.60
  • EUR 694.00
  • EUR 7996.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15166
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.2kDa
  • Isoelectric Point: 5.2
Description: Recombinant Human Paraoxonase 3 expressed in: E.coli

Human PON3 ELISA Kit
ELA-E10065h 96 Tests
EUR 824

PON3 ELISA KIT|Human
EF001831 96 Tests
EUR 689

Rat PON3 shRNA Plasmid
20-abx989703
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PON3 shRNA Plasmid
20-abx953649
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PON3 shRNA Plasmid
20-abx983070
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Paraoxonase 3 (PON3)
4-RPD178Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15166
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.2kDa
  • Isoelectric Point: 5.2
Description: Recombinant Human Paraoxonase 3 expressed in: E.coli

PON3 Recombinant Protein (Human)
RP024151 100 ug Ask for price

PON3 Recombinant Protein (Mouse)
RP163475 100 ug Ask for price

PON3 Recombinant Protein (Rat)
RP221435 100 ug Ask for price

Monoclonal PON3 Antibody (clone 5G11), Clone: 5G11
AMR09422G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human PON3 (clone 5G11). The antibodies are raised in Mouse and are from clone 5G11. This antibody is applicable in WB and IHC-P

Serum Paraoxonase / Lactonase 3 (PON3) Antibody (HRP)
20-abx337658
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Paraoxonase / Lactonase 3 (PON3) Antibody (FITC)
20-abx337659
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Paraoxonase / Lactonase 3 (PON3) Antibody (Biotin)
20-abx337660
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Paraoxonase 3 (PON3) Protein
20-abx166722
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

anti-PON3 (Paraoxonase 3) (5G11)
LF-MA0273 100 ul
EUR 334
Description: Mouse monoclonal to PON3 (Paraoxonase 3)

Pon3 ORF Vector (Rat) (pORF)
ORF073813 1.0 ug DNA
EUR 506

PON3 ORF Vector (Human) (pORF)
ORF008051 1.0 ug DNA
EUR 95

Pon3 ORF Vector (Mouse) (pORF)
ORF054493 1.0 ug DNA
EUR 506

PON3 ELISA Kit (Human) (OKAN06251)
OKAN06251 96 Wells
EUR 792
Description: Description of target: This gene is a member of the paraoxonase family and lies in a cluster on chromosome 7 with the other two family members. The encoded protein is secreted into the bloodstream and associates with high-density lipoprotein (HDL). The protein also rapidly hydrolyzes lactones and can inhibit the oxidation of low-density lipoprotein (LDL), a function that is believed to slow the initiation and progression of atherosclerosis. Alternatively spliced variants which encode different protein isoforms have been described; however, only one has been fully characterized.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 37 pg/mL

PON3 ELISA Kit (Human) (OKCD08407)
OKCD08407 96 Wells
EUR 975
Description: Description of target: This gene is a member of the paraoxonase family and lies in a cluster on chromosome 7 with the other two family members. The encoded protein is secreted into the bloodstream and associates with high-density lipoprotein (HDL). The protein also rapidly hydr;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 37pg/mL

PON3 ELISA Kit (Mouse) (OKEH05754)
OKEH05754 96 Wells
EUR 779
Description: Description of target: Has low activity towards the organophosphate paraxon and aromatic carboxylic acid esters. Rapidly hydrolyzes lactones such as statin prodrugs (e.g. lovastatin). Hydrolyzes aromatic lactones and 5- or 6-member ring lactones with aliphatic substituents but not simple lactones or those with polar substituents.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.161 ng/mL

PON3 ELISA Kit (Rat) (OKEH06258)
OKEH06258 96 Wells
EUR 779
Description: Description of target: Has low activity towards the organophosphate paraxon and aromatic carboxylic acid esters. Rapidly hydrolyzes lactones such as statin prodrugs (e.g. lovastatin). Hydrolyzes aromatic lactones and 5- or 6-member ring lactones with aliphatic substituents but not simple lactones or those with polar substituents.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.162 ng/mL

Human Paraoxonase 3 (PON3) CLIA Kit
abx196185-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Paraoxonase 3 (PON3) ELISA Kit
20-abx152644
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Paraoxonase 3 (PON3) ELISA Kit
abx250365-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Paraoxonase 3 (PON3) ELISA Kit
CSB-E15783h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Paraoxonase 3 (PON3) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Paraoxonase 3 (PON3) ELISA Kit
1-CSB-E15783h
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Paraoxonase 3 (PON3) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pig Paraoxonase 3 (PON3) ELISA Kit
abx360901-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Paraoxonase 3 (PON3) ELISA Kit
abx359115-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Paraoxonase 3 (PON3) ELISA Kit
abx355609-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Paraoxonase 3 (PON3) Protein (Active)
20-abx651428
  • EUR 1288.00
  • EUR 453.00
  • EUR 4351.00
  • EUR 1567.00
  • EUR 871.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Paraoxonase 3 (PON3) CLIA Kit
20-abx494123
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Pon3 sgRNA CRISPR Lentivector set (Mouse)
K5033301 3 x 1.0 ug
EUR 339

Pon3 sgRNA CRISPR Lentivector set (Rat)
K7196701 3 x 1.0 ug
EUR 339

PON3 sgRNA CRISPR Lentivector set (Human)
K1688001 3 x 1.0 ug
EUR 339

Human Paraoxonase 3 ELISA Kit (PON3)
RK02116 96 Tests
EUR 521

Human Paraoxonase 3 (PON3) ELISA Kit
SED178Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids.

PON3 Rabbit Polyclonal Antibody