PON3 Rabbit Polyclonal Antibody
 PON3 Polyclonal Antibody |
|
ABP59970-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PON3 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PON3 from Human, Mouse, Rat. This PON3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON3 protein |
PON3 Polyclonal Antibody |
|
A68839 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: fast delivery possible |
PON3 Polyclonal Antibody |
|
29835-100ul |
SAB |
100ul |
EUR 252 |
PON3 Polyclonal Antibody |
|
29835-50ul |
SAB |
50ul |
EUR 187 |
 ELISA Kit) Human Paraoxonase 3 (PON3) ELISA Kit |
|
DLR-PON3-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Paraoxonase 3 (PON3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Paraoxonase 3 (PON3) in samples from serum, plasma or other biological fluids. |
Human Paraoxonase 3 (PON3) ELISA Kit |
|
DLR-PON3-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Paraoxonase 3 (PON3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Paraoxonase 3 (PON3) in samples from serum, plasma or other biological fluids. |
Human Paraoxonase 3 (PON3) ELISA Kit |
|
RD-PON3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Paraoxonase 3 (PON3) ELISA Kit |
|
RD-PON3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Paraoxonase 3 (PON3) ELISA Kit |
|
RDR-PON3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Paraoxonase 3 (PON3) ELISA Kit |
|
RDR-PON3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
 PON3 Rabbit pAb |
|
A16418-100ul |
Abclonal |
100 ul |
EUR 308 |
PON3 Rabbit pAb |
|
A16418-200ul |
Abclonal |
200 ul |
EUR 459 |
PON3 Rabbit pAb |
|
A16418-20ul |
Abclonal |
20 ul |
EUR 183 |
PON3 Rabbit pAb |
|
A16418-50ul |
Abclonal |
50 ul |
EUR 223 |
 PON3 Polyclonal Conjugated Antibody |
|
C29835 |
SAB |
100ul |
EUR 397 |
 PON3 antibody |
|
70R-6930 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal PON3 antibody raised against the middle region of PON3 |
PON3 antibody |
|
70R-7456 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal PON3 antibody raised against the middle region of PON3 |
 PON3 Antibody |
|
39919-100ul |
SAB |
100ul |
EUR 390 |
PON3 antibody |
|
10R-8555 |
Fitzgerald |
100 ul |
EUR 393 |
|
Description: Mouse monoclonal PON3 antibody |
PON3 Antibody |
|
DF8108 |
Affbiotech |
200ul |
EUR 304 |
|
Description: PON3 Antibody detects endogenous levels of total PON3. |
PON3 Antibody |
|
1-CSB-PA614883LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500 |
) Polyclonal PON3 Antibody (N-term) |
|
APR10907G |
Leading Biology |
0.1ml |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PON3 (N-term). This antibody is tested and proven to work in the following applications: |
 PON3 Polyclonal Antibody, HRP Conjugated |
|
A68840 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: reagents widely cited |
 PON3 Polyclonal Antibody, FITC Conjugated |
|
A68841 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: Ask the seller for details |
 PON3 Polyclonal Antibody, Biotin Conjugated |
|
A68842 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: The best epigenetics products |
 Polyclonal Antibody (Human)) Paraoxonase 3 (PON3) Polyclonal Antibody (Human) |
|
4-PAD178Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON3 (Gly2~Leu354)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3) |
 Anti-PON3 antibody |
|
STJ192273 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to PON3 |
 Polyclonal Antibody (Human), APC) Paraoxonase 3 (PON3) Polyclonal Antibody (Human), APC |
|
4-PAD178Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON3 (Gly2~Leu354)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Paraoxonase 3 (PON3) Polyclonal Antibody (Human), Biotinylated |
|
4-PAD178Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON3 (Gly2~Leu354)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Paraoxonase 3 (PON3) Polyclonal Antibody (Human), Cy3 |
|
4-PAD178Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON3 (Gly2~Leu354)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Paraoxonase 3 (PON3) Polyclonal Antibody (Human), FITC |
|
4-PAD178Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON3 (Gly2~Leu354)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Paraoxonase 3 (PON3) Polyclonal Antibody (Human), HRP |
|
4-PAD178Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON3 (Gly2~Leu354)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Paraoxonase 3 (PON3) Polyclonal Antibody (Human), PE |
|
4-PAD178Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON3 (Gly2~Leu354)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with PE. |
 ELISA Kit) Rabbit Paraoxonase 3 (PON3) ELISA Kit |
|
abx363833-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 PON3 siRNA |
|
20-abx904139 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PON3 siRNA |
|
20-abx929267 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PON3 siRNA |
|
20-abx929268 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-PON3 |
|
YF-PA13885 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to PON3 |
anti-PON3 |
|
YF-PA13886 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to PON3 |
 Antibody) Paraoxonase 3 (PON3) Antibody |
|
20-abx128083 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Paraoxonase 3 (PON3) Antibody |
|
abx037062-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Paraoxonase 3 (PON3) Antibody |
|
20-abx173952 |
Abbexa |
|
|
|
|
 PON3 Antibody, HRP conjugated |
|
1-CSB-PA614883LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 PON3 Antibody, FITC conjugated |
|
1-CSB-PA614883LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 PON3 Antibody, Biotin conjugated |
|
1-CSB-PA614883LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Polyclonal Antibody (Human), APC-Cy7) Paraoxonase 3 (PON3) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAD178Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PON3 (Gly2~Leu354)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with APC-Cy7. |
 PON3 cloning plasmid |
|
CSB-CL614883HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1065
- Sequence: atggggaagctcgtggcgctggtcctgctgggggtcggcctgtccttagtcggggagatgttcctggcgtttagagaaagggtgaatgcctctcgagaagtggagccagtagaacctgaaaactgccaccttattgaggaacttgaaaatggctctgaagatattgatatacttc
- Show more
|
|
Description: A cloning plasmid for the PON3 gene. |
 PON3 Blocking Peptide |
|
33R-2947 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PON3 antibody, catalog no. 70R-6930 |
PON3 Blocking Peptide |
|
33R-7223 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PON3 antibody, catalog no. 70R-7456 |
PON3 Blocking Peptide |
|
DF8108-BP |
Affbiotech |
1mg |
EUR 195 |
 Rabbit Serum paraoxonase/lactonase 3, PON3 ELISA KIT |
|
ELI-45533Ra |
Lifescience Market |
96 Tests |
EUR 928 |
 Antibody) Serum Paraoxonase / Lactonase 3 (PON3) Antibody |
|
abx034015-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serum Paraoxonase / Lactonase 3 (PON3) Antibody |
|
abx034015-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serum Paraoxonase / Lactonase 3 (PON3) Antibody |
|
20-abx334317 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) Active Paraoxonase 3 (PON3) |
|
4-APD178Hu01 |
Cloud-Clone |
-
EUR 942.24
-
EUR 355.00
-
EUR 3258.40
-
EUR 1152.80
-
EUR 2205.60
-
EUR 694.00
-
EUR 7996.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q15166
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 43.2kDa
- Isoelectric Point: 5.2
|
|
Description: Recombinant Human Paraoxonase 3 expressed in: E.coli |
 Rat PON3 shRNA Plasmid |
|
20-abx989703 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse PON3 shRNA Plasmid |
|
20-abx983070 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human PON3 shRNA Plasmid |
|
20-abx953649 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) Recombinant Paraoxonase 3 (PON3) |
|
4-RPD178Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q15166
- Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 43.2kDa
- Isoelectric Point: 5.2
|
|
Description: Recombinant Human Paraoxonase 3 expressed in: E.coli |
) PON3 Recombinant Protein (Human) |
|
RP024151 |
ABM |
100 ug |
Ask for price |
) PON3 Recombinant Protein (Rat) |
|
RP221435 |
ABM |
100 ug |
Ask for price |
) PON3 Recombinant Protein (Mouse) |
|
RP163475 |
ABM |
100 ug |
Ask for price |
, Clone: 5G11) Monoclonal PON3 Antibody (clone 5G11), Clone: 5G11 |
|
AMR09422G |
Leading Biology |
0.05ml |
EUR 484 |
|
Description: A Monoclonal antibody against Human PON3 (clone 5G11). The antibodies are raised in Mouse and are from clone 5G11. This antibody is applicable in WB and IHC-P |
 Antibody (HRP)) Serum Paraoxonase / Lactonase 3 (PON3) Antibody (HRP) |
|
20-abx337658 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Serum Paraoxonase / Lactonase 3 (PON3) Antibody (FITC) |
|
20-abx337659 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Serum Paraoxonase / Lactonase 3 (PON3) Antibody (Biotin) |
|
20-abx337660 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Protein) Human Paraoxonase 3 (PON3) Protein |
|
20-abx166722 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 (pORF)) PON3 ORF Vector (Human) (pORF) |
|
ORF008051 |
ABM |
1.0 ug DNA |
EUR 95 |
 (5G11)) anti-PON3 (Paraoxonase 3) (5G11) |
|
LF-MA0273 |
Abfrontier |
100 ul |
EUR 334 |
|
Description: Mouse monoclonal to PON3 (Paraoxonase 3) |
 (pORF)) Pon3 ORF Vector (Rat) (pORF) |
|
ORF073813 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Pon3 ORF Vector (Mouse) (pORF) |
|
ORF054493 |
ABM |
1.0 ug DNA |
EUR 506 |
 ELISA Kit) Pig Paraoxonase 3 (PON3) ELISA Kit |
|
abx360901-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 Protein (Active)) Human Paraoxonase 3 (PON3) Protein (Active) |
|
20-abx651428 |
Abbexa |
-
EUR 1288.00
-
EUR 453.00
-
EUR 4351.00
-
EUR 1567.00
-
EUR 871.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Paraoxonase 3 (PON3) ELISA Kit |
|
20-abx152644 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 CLIA Kit) Human Paraoxonase 3 (PON3) CLIA Kit |
|
abx196185-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Monkey Paraoxonase 3 (PON3) ELISA Kit |
|
abx359115-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Chicken Paraoxonase 3 (PON3) ELISA Kit |
|
abx355609-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Paraoxonase 3 (PON3) CLIA Kit |
|
20-abx494123 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
Human Paraoxonase 3 (PON3) ELISA Kit |
|
abx250365-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
) PON3 sgRNA CRISPR Lentivector set (Human) |
|
K1688001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Paraoxonase 3 (PON3) ELISA Kit |
|
CSB-E15783h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Paraoxonase 3 (PON3) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Paraoxonase 3 (PON3) ELISA Kit |
|
1-CSB-E15783h |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Paraoxonase 3 (PON3) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
) Pon3 sgRNA CRISPR Lentivector set (Mouse) |
|
K5033301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Pon3 sgRNA CRISPR Lentivector set (Rat) |
|
K7196701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Human Paraoxonase 3 ELISA Kit (PON3) |
|
RK02116 |
Abclonal |
96 Tests |
EUR 521 |
Human Paraoxonase 3 (PON3) ELISA Kit |
|
SED178Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids. |
Human Paraoxonase 3 (PON3) ELISA Kit |
|
SED178Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids. |
Human Paraoxonase 3 (PON3) ELISA Kit |
|
SED178Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids. |
Human Paraoxonase 3 (PON3) ELISA Kit |
|
SED178Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids. |
Human Paraoxonase 3 (PON3) ELISA Kit |
|
4-SED178Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Paraoxonase 3 elisa. Alternative names of the recognized antigen: Serum paraoxonase/lactonase 3
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Paraoxonase 3 (PON3) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
) ELISA kit for Human PON3 (Paraoxonase 3) |
|
E-EL-H2374 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's PON3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PON3. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
|
Description: A sandwich ELISA kit for quantitative measurement of Human PON3 (Paraoxonase 3) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human PON3 (Paraoxonase 3) |
|
ELK3696 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Paraoxonase 3 (PON3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Paraoxonase 3
- Show more
|
|
Description: A sandwich ELISA kit for detection of Paraoxonase 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 ELISA Kit) Guinea pig Paraoxonase 3 (PON3) ELISA Kit |
|
abx357805-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 (Target 1)) PON3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1688002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) PON3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1688003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) PON3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1688004 |
ABM |
1.0 ug DNA |
EUR 154 |
) CLIA kit for Human PON3 (Paraoxonase 3) |
|
E-CL-H1380 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's PON3 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human PON3 . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
|
Description: A sandwich CLIA kit for quantitative measurement of Human PON3 (Paraoxonase 3) in samples from Serum, Plasma, Cell supernatant |
 (Target 1)) Pon3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K5033302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Pon3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K5033303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Pon3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K5033304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Pon3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7196702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Pon3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7196703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Pon3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7196704 |
ABM |
1.0 ug DNA |
EUR 154 |
) ELISA kit for Human Paraoxonase 3 (PON3) |
|
KTE61197-48T |
Abbkine |
48T |
EUR 332 |
- Members of the paraoxonase (EC 3.1.1.2) gene family, such as PON3, encode high density lipoprotein (HDL)-related glycoproteins with multienzymatic properties. (Lu et al., 2006).Lu et al. (2006) cloned PON3 from a fetal liver cDNA library. The deduced
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Paraoxonase 3 (PON3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Paraoxonase 3 (PON3) |
|
KTE61197-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Members of the paraoxonase (EC 3.1.1.2) gene family, such as PON3, encode high density lipoprotein (HDL)-related glycoproteins with multienzymatic properties. (Lu et al., 2006).Lu et al. (2006) cloned PON3 from a fetal liver cDNA library. The deduced
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Paraoxonase 3 (PON3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Paraoxonase 3 (PON3) |
|
KTE61197-96T |
Abbkine |
96T |
EUR 539 |
- Members of the paraoxonase (EC 3.1.1.2) gene family, such as PON3, encode high density lipoprotein (HDL)-related glycoproteins with multienzymatic properties. (Lu et al., 2006).Lu et al. (2006) cloned PON3 from a fetal liver cDNA library. The deduced
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Paraoxonase 3 (PON3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 (pPB-C-His)) PON3 Protein Vector (Human) (pPB-C-His) |
|
PV032201 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) PON3 Protein Vector (Human) (pPB-N-His) |
|
PV032202 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) PON3 Protein Vector (Human) (pPM-C-HA) |
|
PV032203 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) PON3 Protein Vector (Human) (pPM-C-His) |
|
PV032204 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) PON3 Protein Vector (Mouse) (pPB-C-His) |
|
PV217970 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) PON3 Protein Vector (Mouse) (pPB-N-His) |
|
PV217971 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) PON3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV217972 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) PON3 Protein Vector (Mouse) (pPM-C-His) |
|
PV217973 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) PON3 Protein Vector (Rat) (pPB-C-His) |
|
PV295250 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) PON3 Protein Vector (Rat) (pPB-N-His) |
|
PV295251 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) PON3 Protein Vector (Rat) (pPM-C-HA) |
|
PV295252 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) PON3 Protein Vector (Rat) (pPM-C-His) |
|
PV295253 |
ABM |
500 ng |
EUR 603 |
 Pon3 3'UTR GFP Stable Cell Line |
|
TU166713 |
ABM |
1.0 ml |
Ask for price |
 PON3 3'UTR Luciferase Stable Cell Line |
|
TU018470 |
ABM |
1.0 ml |
EUR 1394 |
 Pon3 3'UTR Luciferase Stable Cell Line |
|
TU116713 |
ABM |
1.0 ml |
Ask for price |
 PON3 3'UTR GFP Stable Cell Line |
|
TU068470 |
ABM |
1.0 ml |
EUR 1394 |
Pon3 3'UTR GFP Stable Cell Line |
|
TU266558 |
ABM |
1.0 ml |
Ask for price |
Pon3 3'UTR Luciferase Stable Cell Line |
|
TU216558 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
PON3 Rabbit Polyclonal Antibody
