셀타젠 Genetic Genotyping

PON3 Rabbit Polyclonal Antibody

PON3 Polyclonal Antibody

ABP59970-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PON3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PON3 from Human, Mouse, Rat. This PON3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PON3 protein

PON3 Polyclonal Antibody

A68839 100 ?g
EUR 628.55
Description: fast delivery possible

PON3 Polyclonal Antibody

29835-100ul 100ul
EUR 252

PON3 Polyclonal Antibody

29835-50ul 50ul
EUR 187

Human Paraoxonase 3 (PON3) ELISA Kit

DLR-PON3-Hu-48T 48T
EUR 517
  • Should the Human Paraoxonase 3 (PON3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Paraoxonase 3 (PON3) in samples from serum, plasma or other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit

DLR-PON3-Hu-96T 96T
EUR 673
  • Should the Human Paraoxonase 3 (PON3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Paraoxonase 3 (PON3) in samples from serum, plasma or other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit

RD-PON3-Hu-48Tests 48 Tests
EUR 521

Human Paraoxonase 3 (PON3) ELISA Kit

RD-PON3-Hu-96Tests 96 Tests
EUR 723

Human Paraoxonase 3 (PON3) ELISA Kit

RDR-PON3-Hu-48Tests 48 Tests
EUR 544

Human Paraoxonase 3 (PON3) ELISA Kit

RDR-PON3-Hu-96Tests 96 Tests
EUR 756

PON3 Rabbit pAb

A16418-100ul 100 ul
EUR 308

PON3 Rabbit pAb

A16418-200ul 200 ul
EUR 459

PON3 Rabbit pAb

A16418-20ul 20 ul
EUR 183

PON3 Rabbit pAb

A16418-50ul 50 ul
EUR 223

PON3 Polyclonal Conjugated Antibody

C29835 100ul
EUR 397

PON3 antibody

70R-6930 50 ug
EUR 467
Description: Rabbit polyclonal PON3 antibody raised against the middle region of PON3

PON3 antibody

70R-7456 50 ug
EUR 467
Description: Rabbit polyclonal PON3 antibody raised against the middle region of PON3

PON3 Antibody

ABD8108 100 ug
EUR 438

PON3 Antibody

ABD8148 100 ug
EUR 438

PON3 Antibody

39919-100ul 100ul
EUR 390

PON3 antibody

10R-8555 100 ul
EUR 393
Description: Mouse monoclonal PON3 antibody

PON3 Antibody

DF8108 200ul
EUR 304
Description: PON3 Antibody detects endogenous levels of total PON3.

PON3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

Polyclonal PON3 Antibody (N-term)

APR10907G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PON3 (N-term). This antibody is tested and proven to work in the following applications:

PON3 Polyclonal Antibody, HRP Conjugated

A68840 100 ?g
EUR 628.55
Description: reagents widely cited

PON3 Polyclonal Antibody, FITC Conjugated

A68841 100 ?g
EUR 628.55
Description: Ask the seller for details

PON3 Polyclonal Antibody, Biotin Conjugated

A68842 100 ?g
EUR 628.55
Description: The best epigenetics products

Paraoxonase 3 (PON3) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3)

Anti-PON3 antibody

STJ118858 100 µl
EUR 277

Anti-PON3 antibody

STJ192273 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PON3

Pon3/ Rat Pon3 ELISA Kit

ELI-12743r 96 Tests
EUR 886

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with APC.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with Biotin.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with Cy3.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with FITC.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with HRP.

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with PE.

Rabbit Paraoxonase 3 (PON3) ELISA Kit

abx363833-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA13885 50 ug
EUR 363
Description: Mouse polyclonal to PON3


YF-PA13886 100 ug
EUR 403
Description: Rabbit polyclonal to PON3

Paraoxonase 3 (PON3) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Paraoxonase 3 (PON3) Antibody

abx037062-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Paraoxonase 3 (PON3) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

PON3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PON3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PON3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PON3. Recognizes PON3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Paraoxonase 3 (PON3) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PON3 (Gly2~Leu354)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Paraoxonase 3 (PON3). This antibody is labeled with APC-Cy7.

PON3 cloning plasmid

CSB-CL614883HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1065
  • Sequence: atggggaagctcgtggcgctggtcctgctgggggtcggcctgtccttagtcggggagatgttcctggcgtttagagaaagggtgaatgcctctcgagaagtggagccagtagaacctgaaaactgccaccttattgaggaacttgaaaatggctctgaagatattgatatacttc
  • Show more
Description: A cloning plasmid for the PON3 gene.

PON3 Blocking Peptide

33R-2947 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PON3 antibody, catalog no. 70R-6930

PON3 Blocking Peptide

33R-7223 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PON3 antibody, catalog no. 70R-7456

PON3 Blocking Peptide

DF8108-BP 1mg
EUR 195

Rabbit Serum paraoxonase/lactonase 3, PON3 ELISA KIT

ELI-45533Ra 96 Tests
EUR 928

Serum Paraoxonase / Lactonase 3 (PON3) Antibody

abx034015-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serum Paraoxonase / Lactonase 3 (PON3) Antibody

abx034015-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serum Paraoxonase / Lactonase 3 (PON3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Active Paraoxonase 3 (PON3)

  • EUR 942.24
  • EUR 355.00
  • EUR 3258.40
  • EUR 1152.80
  • EUR 2205.60
  • EUR 694.00
  • EUR 7996.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15166
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.2kDa
  • Isoelectric Point: 5.2
Description: Recombinant Human Paraoxonase 3 expressed in: E.coli

Rat PON3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PON3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PON3 ELISA Kit

ELA-E10065h 96 Tests
EUR 824


EF001831 96 Tests
EUR 689

Human PON3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Paraoxonase 3 (PON3)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15166
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.2kDa
  • Isoelectric Point: 5.2
Description: Recombinant Human Paraoxonase 3 expressed in: E.coli

PON3 Recombinant Protein (Human)

RP024151 100 ug Ask for price

PON3 Recombinant Protein (Rat)

RP221435 100 ug Ask for price

PON3 Recombinant Protein (Mouse)

RP163475 100 ug Ask for price

Monoclonal PON3 Antibody (clone 5G11), Clone: 5G11

AMR09422G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human PON3 (clone 5G11). The antibodies are raised in Mouse and are from clone 5G11. This antibody is applicable in WB and IHC-P

Serum Paraoxonase / Lactonase 3 (PON3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Paraoxonase / Lactonase 3 (PON3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Paraoxonase / Lactonase 3 (PON3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Paraoxonase 3 (PON3) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

PON3 ORF Vector (Human) (pORF)

ORF008051 1.0 ug DNA
EUR 95

anti-PON3 (Paraoxonase 3) (5G11)

LF-MA0273 100 ul
EUR 334
Description: Mouse monoclonal to PON3 (Paraoxonase 3)

Pon3 ORF Vector (Rat) (pORF)

ORF073813 1.0 ug DNA
EUR 506

Pon3 ORF Vector (Mouse) (pORF)

ORF054493 1.0 ug DNA
EUR 506

Pig Paraoxonase 3 (PON3) ELISA Kit

abx360901-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Paraoxonase 3 (PON3) Protein (Active)

  • EUR 1288.00
  • EUR 453.00
  • EUR 4351.00
  • EUR 1567.00
  • EUR 871.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Paraoxonase 3 (PON3) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Paraoxonase 3 (PON3) CLIA Kit

abx196185-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Paraoxonase 3 (PON3) ELISA Kit

abx359115-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Paraoxonase 3 (PON3) ELISA Kit

abx355609-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Paraoxonase 3 (PON3) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Paraoxonase 3 (PON3) ELISA Kit

abx250365-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

PON3 sgRNA CRISPR Lentivector set (Human)

K1688001 3 x 1.0 ug
EUR 339

Human Paraoxonase 3 (PON3) ELISA Kit

CSB-E15783h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Paraoxonase 3 (PON3) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Paraoxonase 3 (PON3) ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Paraoxonase 3 (PON3) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pon3 sgRNA CRISPR Lentivector set (Mouse)

K5033301 3 x 1.0 ug
EUR 339

Pon3 sgRNA CRISPR Lentivector set (Rat)

K7196701 3 x 1.0 ug
EUR 339

Human Paraoxonase 3 ELISA Kit (PON3)

RK02116 96 Tests
EUR 521

Human Paraoxonase 3 (PON3) ELISA Kit

SED178Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit

SED178Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit

SED178Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit

SED178Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Paraoxonase 3 (PON3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Paraoxonase 3 (PON3) in serum, plasma and other biological fluids.

Human Paraoxonase 3 (PON3) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Paraoxonase 3 elisa. Alternative names of the recognized antigen: Serum paraoxonase/lactonase 3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Paraoxonase 3 (PON3) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human PON3 (Paraoxonase 3)

E-EL-H2374 1 plate of 96 wells
EUR 534
  • Gentaur's PON3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PON3. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PON3 (Paraoxonase 3) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human PON3 (Paraoxonase 3)

ELK3696 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Paraoxonase 3 (PON3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Paraoxonase 3
  • Show more
Description: A sandwich ELISA kit for detection of Paraoxonase 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Paraoxonase 3 (PON3) ELISA Kit

abx357805-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

PON3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1688002 1.0 ug DNA
EUR 154

PON3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1688003 1.0 ug DNA
EUR 154

PON3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1688004 1.0 ug DNA
EUR 154

CLIA kit for Human PON3 (Paraoxonase 3)

E-CL-H1380 1 plate of 96 wells
EUR 584
  • Gentaur's PON3 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human PON3 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human PON3 (Paraoxonase 3) in samples from Serum, Plasma, Cell supernatant

Pon3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5033302 1.0 ug DNA
EUR 154

Pon3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5033303 1.0 ug DNA
EUR 154

Pon3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5033304 1.0 ug DNA
EUR 154

Pon3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7196702 1.0 ug DNA
EUR 154

Pon3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7196703 1.0 ug DNA
EUR 154

Pon3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7196704 1.0 ug DNA
EUR 154

ELISA kit for Human Paraoxonase 3 (PON3)

KTE61197-48T 48T
EUR 332
  • Members of the paraoxonase (EC gene family, such as PON3, encode high density lipoprotein (HDL)-related glycoproteins with multienzymatic properties. (Lu et al., 2006).Lu et al. (2006) cloned PON3 from a fetal liver cDNA library. The deduced
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Paraoxonase 3 (PON3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Paraoxonase 3 (PON3)

KTE61197-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Members of the paraoxonase (EC gene family, such as PON3, encode high density lipoprotein (HDL)-related glycoproteins with multienzymatic properties. (Lu et al., 2006).Lu et al. (2006) cloned PON3 from a fetal liver cDNA library. The deduced
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Paraoxonase 3 (PON3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Paraoxonase 3 (PON3)

KTE61197-96T 96T
EUR 539
  • Members of the paraoxonase (EC gene family, such as PON3, encode high density lipoprotein (HDL)-related glycoproteins with multienzymatic properties. (Lu et al., 2006).Lu et al. (2006) cloned PON3 from a fetal liver cDNA library. The deduced
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Paraoxonase 3 (PON3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PON3 Protein Vector (Human) (pPB-C-His)

PV032201 500 ng
EUR 329

PON3 Protein Vector (Human) (pPB-N-His)

PV032202 500 ng
EUR 329

PON3 Protein Vector (Human) (pPM-C-HA)

PV032203 500 ng
EUR 329

PON3 Protein Vector (Human) (pPM-C-His)

PV032204 500 ng
EUR 329

PON3 Protein Vector (Mouse) (pPB-C-His)

PV217970 500 ng
EUR 603

PON3 Protein Vector (Mouse) (pPB-N-His)

PV217971 500 ng
EUR 603

PON3 Protein Vector (Mouse) (pPM-C-HA)

PV217972 500 ng
EUR 603

PON3 Protein Vector (Mouse) (pPM-C-His)

PV217973 500 ng
EUR 603

PON3 Protein Vector (Rat) (pPB-C-His)

PV295250 500 ng
EUR 603

PON3 Protein Vector (Rat) (pPB-N-His)

PV295251 500 ng
EUR 603

PON3 Protein Vector (Rat) (pPM-C-HA)

PV295252 500 ng
EUR 603

PON3 Protein Vector (Rat) (pPM-C-His)

PV295253 500 ng
EUR 603

Pon3 3'UTR GFP Stable Cell Line

TU166713 1.0 ml Ask for price

PON3 3'UTR Luciferase Stable Cell Line

TU018470 1.0 ml
EUR 1394

Pon3 3'UTR Luciferase Stable Cell Line

TU116713 1.0 ml Ask for price

PON3 3'UTR GFP Stable Cell Line

TU068470 1.0 ml
EUR 1394

Pon3 3'UTR GFP Stable Cell Line

TU266558 1.0 ml Ask for price

Pon3 3'UTR Luciferase Stable Cell Line

TU216558 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

PON3 Rabbit Polyclonal Antibody