PPM1B Rabbit Polyclonal Antibody
PPM1B Polyclonal Antibody |
ABP59983-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PPM1B protein at amino acid sequence of 310-390
- Applications tips:
|
Description: A polyclonal antibody for detection of PPM1B from Human, Mouse, Rat. This PPM1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PPM1B protein at amino acid sequence of 310-390 |
PPM1B Polyclonal Antibody |
ABP59983-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PPM1B protein at amino acid sequence of 310-390
- Applications tips:
|
Description: A polyclonal antibody for detection of PPM1B from Human, Mouse, Rat. This PPM1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PPM1B protein at amino acid sequence of 310-390 |
PPM1B Polyclonal Antibody |
ABP59983-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PPM1B protein at amino acid sequence of 310-390
- Applications tips:
|
Description: A polyclonal antibody for detection of PPM1B from Human, Mouse, Rat. This PPM1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PPM1B protein at amino acid sequence of 310-390 |
PPM1B antibody |
70R-2682 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PPM1B antibody |
PPM1B Antibody |
47357-100ul |
SAB |
100ul |
EUR 252 |
PPM1B antibody |
10R-1090 |
Fitzgerald |
100 ul |
EUR 316 |
Description: Mouse monoclonal PPM1B antibody |
PPM1B antibody |
10R-5376 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal PPM1B antibody |
PPM1B antibody |
10R-5377 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal PPM1B antibody |
PPM1B antibody |
10R-5378 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal PPM1B antibody |
PPM1B antibody |
10R-5379 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal PPM1B antibody |
PPM1B antibody |
10R-5380 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal PPM1B antibody |
PPM1B antibody |
10R-5381 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal PPM1B antibody |
PPM1B antibody |
70R-19459 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PPM1B antibody |
PPM1B Antibody |
1-CSB-PA018490GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against PPM1B. Recognizes PPM1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
PPM1B Conjugated Antibody |
C47357 |
SAB |
100ul |
EUR 397 |
anti- PPM1B antibody |
FNab06685 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: protein phosphatase 1B(formerly 2C), magnesium-dependent, beta isoform
- Uniprot ID: O75688
- Gene ID: 5495
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against PPM1B |
Anti-PPM1B antibody |
STJ192389 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PPM1B |
PPM1B siRNA |
20-abx904165 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PPM1B siRNA |
20-abx929427 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PPM1B siRNA |
20-abx929428 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PPM1B |
YF-PA13921 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to PPM1B |
anti-PPM1B |
YF-PA13922 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to PPM1B |
anti-PPM1B |
YF-PA13923 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to PPM1B |
PPM1B cloning plasmid |
CSB-CL018490HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 579
- Sequence: atgagtattgtactagtttgcttttcaaatgctcccaaggtctcagatgaagcggtgaaaaaagattcagagttggataagcacttggaatcacgggttgaagagattatggagaagtctggcgaggaaggaatgcctgatcttgcccatgtcatgcgcatcttgtctgcagaaaa
- Show more
|
Description: A cloning plasmid for the PPM1B gene. |
PPM1B Blocking Peptide |
33R-2480 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPM1B antibody, catalog no. 70R-2682 |
Rat PPM1B shRNA Plasmid |
20-abx984589 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PPM1B shRNA Plasmid |
20-abx953681 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PPM1B shRNA Plasmid |
20-abx972166 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PPM1B Recombinant Protein (Human) |
RP024307 |
ABM |
100 ug |
Ask for price |
PPM1B Recombinant Protein (Rat) |
RP221648 |
ABM |
100 ug |
Ask for price |
PPM1B Recombinant Protein (Mouse) |
RP163787 |
ABM |
100 ug |
Ask for price |
PPM1B Recombinant Protein (Mouse) |
RP163790 |
ABM |
100 ug |
Ask for price |
PPM1B Recombinant Protein (Mouse) |
RP163793 |
ABM |
100 ug |
Ask for price |
PPM1B Recombinant Protein (Mouse) |
RP163796 |
ABM |
100 ug |
Ask for price |
Anti-PPM1B (1A3-2A4) |
YF-MA14833 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PPM1B |
Human Protein phosphatase 1B (PPM1B) |
1-CSB-EP018490HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 36.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Protein phosphatase 1B(PPM1B) expressed in E.coli |
PPM1B ORF Vector (Human) (pORF) |
ORF008103 |
ABM |
1.0 ug DNA |
EUR 95 |
Ppm1b ORF Vector (Rat) (pORF) |
ORF073884 |
ABM |
1.0 ug DNA |
EUR 506 |
Ppm1b ORF Vector (Mouse) (pORF) |
ORF054597 |
ABM |
1.0 ug DNA |
EUR 506 |
Ppm1b ORF Vector (Mouse) (pORF) |
ORF054598 |
ABM |
1.0 ug DNA |
EUR 506 |
Ppm1b ORF Vector (Mouse) (pORF) |
ORF054599 |
ABM |
1.0 ug DNA |
EUR 506 |
Ppm1b ORF Vector (Mouse) (pORF) |
ORF054600 |
ABM |
1.0 ug DNA |
EUR 506 |
PPM1B ELISA Kit (Human) (OKCD04220) |
OKCD04220 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase has been shown to dephosphorylate cyclin-dependent kinases (CDKs), and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to cause cell-growth arrest or cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional transcript variants have been described, but currently do not represent full-length sequences.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL |
Monoclonal PPM1B Antibody (monoclonal) (M01), Clone: 1A3-2A4 |
AMM03931G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human PPM1B (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1A3-2A4. This antibody is applicable in WB and IF, IP, E |
Protein Phosphatase, Mg2+/Mn2+ Dependent 1B (PPM1B) Antibody |
20-abx114840 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protein Phosphatase, Mg2+/Mn2+ Dependent 1B (PPM1B) Antibody |
abx236685-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
PPM1B sgRNA CRISPR Lentivector set (Human) |
K1700401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ppm1b sgRNA CRISPR Lentivector set (Mouse) |
K4554101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ppm1b sgRNA CRISPR Lentivector set (Rat) |
K6655601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Bovine Protein phosphatase 1B, PPM1B ELISA KIT |
ELI-21763b |
Lifescience Market |
96 Tests |
EUR 928 |
Human Protein phosphatase 1B, PPM1B ELISA KIT |
ELI-22337h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Protein phosphatase 1B, Ppm1b ELISA KIT |
ELI-15413m |
Lifescience Market |
96 Tests |
EUR 865 |
PPM1B sgRNA CRISPR Lentivector (Human) (Target 1) |
K1700402 |
ABM |
1.0 ug DNA |
EUR 154 |
PPM1B sgRNA CRISPR Lentivector (Human) (Target 2) |
K1700403 |
ABM |
1.0 ug DNA |
EUR 154 |
PPM1B sgRNA CRISPR Lentivector (Human) (Target 3) |
K1700404 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppm1b sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4554102 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppm1b sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4554103 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppm1b sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4554104 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppm1b sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6655602 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppm1b sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6655603 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppm1b sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6655604 |
ABM |
1.0 ug DNA |
EUR 154 |
PPM1B Protein Vector (Human) (pPB-C-His) |
PV032409 |
ABM |
500 ng |
EUR 329 |
PPM1B Protein Vector (Human) (pPB-N-His) |
PV032410 |
ABM |
500 ng |
EUR 329 |
PPM1B Protein Vector (Human) (pPM-C-HA) |
PV032411 |
ABM |
500 ng |
EUR 329 |
PPM1B Protein Vector (Human) (pPM-C-His) |
PV032412 |
ABM |
500 ng |
EUR 329 |
PPM1B Protein Vector (Mouse) (pPB-C-His) |
PV218386 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Mouse) (pPB-N-His) |
PV218387 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Mouse) (pPM-C-HA) |
PV218388 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Mouse) (pPM-C-His) |
PV218389 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Mouse) (pPB-C-His) |
PV218390 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Mouse) (pPB-N-His) |
PV218391 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Mouse) (pPM-C-HA) |
PV218392 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Mouse) (pPM-C-His) |
PV218393 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Mouse) (pPB-C-His) |
PV218394 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Mouse) (pPB-N-His) |
PV218395 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Mouse) (pPM-C-HA) |
PV218396 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Mouse) (pPM-C-His) |
PV218397 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Mouse) (pPB-C-His) |
PV218398 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Mouse) (pPB-N-His) |
PV218399 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Mouse) (pPM-C-HA) |
PV218400 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Mouse) (pPM-C-His) |
PV218401 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Rat) (pPB-C-His) |
PV295534 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Rat) (pPB-N-His) |
PV295535 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Rat) (pPM-C-HA) |
PV295536 |
ABM |
500 ng |
EUR 603 |
PPM1B Protein Vector (Rat) (pPM-C-His) |
PV295537 |
ABM |
500 ng |
EUR 603 |
Ppm1b 3'UTR GFP Stable Cell Line |
TU166787 |
ABM |
1.0 ml |
Ask for price |
PPM1B 3'UTR Luciferase Stable Cell Line |
TU018605 |
ABM |
1.0 ml |
EUR 1521 |
Ppm1b 3'UTR Luciferase Stable Cell Line |
TU116787 |
ABM |
1.0 ml |
Ask for price |
PPM1B 3'UTR GFP Stable Cell Line |
TU068605 |
ABM |
1.0 ml |
EUR 1521 |
Ppm1b 3'UTR GFP Stable Cell Line |
TU266633 |
ABM |
1.0 ml |
Ask for price |
Ppm1b 3'UTR Luciferase Stable Cell Line |
TU216633 |
ABM |
1.0 ml |
Ask for price |
PPM1B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV691027 |
ABM |
1.0 ug DNA |
EUR 682 |
PPM1B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV691031 |
ABM |
1.0 ug DNA |
EUR 682 |
PPM1B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV691032 |
ABM |
1.0 ug DNA |
EUR 682 |
PPM1B Rabbit Polyclonal Antibody