셀타젠 Genetic Genotyping

PPM1B Rabbit Polyclonal Antibody

PPM1B Polyclonal Antibody

ABP59983-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PPM1B protein at amino acid sequence of 310-390
  • Applications tips:
Description: A polyclonal antibody for detection of PPM1B from Human, Mouse, Rat. This PPM1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PPM1B protein at amino acid sequence of 310-390

PPM1B Polyclonal Antibody

ES11231-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PPM1B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PPM1B Polyclonal Antibody

ES11231-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PPM1B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PPM1B antibody

70R-19459 50 ul
EUR 435
Description: Rabbit polyclonal PPM1B antibody

PPM1B antibody

70R-2682 50 ug
EUR 467
Description: Rabbit polyclonal PPM1B antibody

PPM1B Antibody

47357-100ul 100ul
EUR 252

PPM1B antibody

10R-5376 100 ul
EUR 691
Description: Mouse monoclonal PPM1B antibody

PPM1B antibody

10R-5377 100 ul
EUR 691
Description: Mouse monoclonal PPM1B antibody

PPM1B antibody

10R-5378 100 ul
EUR 691
Description: Mouse monoclonal PPM1B antibody

PPM1B antibody

10R-5379 100 ul
EUR 691
Description: Mouse monoclonal PPM1B antibody

PPM1B antibody

10R-5380 100 ul
EUR 726
Description: Mouse monoclonal PPM1B antibody

PPM1B antibody

10R-5381 100 ul
EUR 691
Description: Mouse monoclonal PPM1B antibody

PPM1B antibody

10R-1090 100 ul
EUR 316
Description: Mouse monoclonal PPM1B antibody

PPM1B Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PPM1B. Recognizes PPM1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PPM1B Conjugated Antibody

C47357 100ul
EUR 397

anti- PPM1B antibody

FNab06685 100µg
EUR 505.25
  • Immunogen: protein phosphatase 1B(formerly 2C), magnesium-dependent, beta isoform
  • Uniprot ID: O75688
  • Gene ID: 5495
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against PPM1B

Anti-PPM1B antibody

PAab06685 100 ug
EUR 355

Anti-PPM1B antibody

STJ192389 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PPM1B

Ppm1b/ Rat Ppm1b ELISA Kit

ELI-43109r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA13921 50 ul
EUR 363
Description: Mouse polyclonal to PPM1B


YF-PA13922 50 ug
EUR 363
Description: Mouse polyclonal to PPM1B


YF-PA13923 100 ug
EUR 403
Description: Rabbit polyclonal to PPM1B

PPM1B Blocking Peptide

33R-2480 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPM1B antibody, catalog no. 70R-2682

PPM1B cloning plasmid

CSB-CL018490HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 579
  • Sequence: atgagtattgtactagtttgcttttcaaatgctcccaaggtctcagatgaagcggtgaaaaaagattcagagttggataagcacttggaatcacgggttgaagagattatggagaagtctggcgaggaaggaatgcctgatcttgcccatgtcatgcgcatcttgtctgcagaaaa
  • Show more
Description: A cloning plasmid for the PPM1B gene.


EF001983 96 Tests
EUR 689

Mouse PPM1B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PPM1B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PPM1B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PPM1B Recombinant Protein (Human)

RP024307 100 ug Ask for price

PPM1B Recombinant Protein (Mouse)

RP163787 100 ug Ask for price

PPM1B Recombinant Protein (Mouse)

RP163790 100 ug Ask for price

PPM1B Recombinant Protein (Mouse)

RP163793 100 ug Ask for price

PPM1B Recombinant Protein (Mouse)

RP163796 100 ug Ask for price

PPM1B Recombinant Protein (Rat)

RP221648 100 ug Ask for price

Anti-PPM1B (1A3-2A4)

YF-MA14833 100 ug
EUR 363
Description: Mouse monoclonal to PPM1B

Human Protein phosphatase 1B (PPM1B)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein phosphatase 1B(PPM1B) expressed in E.coli

Ppm1b ORF Vector (Rat) (pORF)

ORF073884 1.0 ug DNA
EUR 506

PPM1B ORF Vector (Human) (pORF)

ORF008103 1.0 ug DNA
EUR 95

Ppm1b ORF Vector (Mouse) (pORF)

ORF054597 1.0 ug DNA
EUR 506

Ppm1b ORF Vector (Mouse) (pORF)

ORF054598 1.0 ug DNA
EUR 506

Ppm1b ORF Vector (Mouse) (pORF)

ORF054599 1.0 ug DNA
EUR 506

Ppm1b ORF Vector (Mouse) (pORF)

ORF054600 1.0 ug DNA
EUR 506

PPM1B ELISA Kit (Human) (OKCD04220)

OKCD04220 96 Wells
EUR 831
Description: Description of target: The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase has been shown to dephosphorylate cyclin-dependent kinases (CDKs), and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to cause cell-growth arrest or cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional transcript variants have been described, but currently do not represent full-length sequences.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

Protein Phosphatase, Mg2+/Mn2+ Dependent 1B (PPM1B) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Phosphatase, Mg2+/Mn2+ Dependent 1B (PPM1B) Antibody

abx236685-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Monoclonal PPM1B Antibody (monoclonal) (M01), Clone: 1A3-2A4

AMM03931G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PPM1B (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1A3-2A4. This antibody is applicable in WB and IF, IP, E

Ppm1b sgRNA CRISPR Lentivector set (Rat)

K6655601 3 x 1.0 ug
EUR 339

Ppm1b sgRNA CRISPR Lentivector set (Mouse)

K4554101 3 x 1.0 ug
EUR 339

PPM1B sgRNA CRISPR Lentivector set (Human)

K1700401 3 x 1.0 ug
EUR 339

Mouse Protein phosphatase 1B, Ppm1b ELISA KIT

ELI-15413m 96 Tests
EUR 865

Bovine Protein phosphatase 1B, PPM1B ELISA KIT

ELI-21763b 96 Tests
EUR 928

Human Protein phosphatase 1B, PPM1B ELISA KIT

ELI-22337h 96 Tests
EUR 824

Ppm1b sgRNA CRISPR Lentivector (Rat) (Target 1)

K6655602 1.0 ug DNA
EUR 154

Ppm1b sgRNA CRISPR Lentivector (Rat) (Target 2)

K6655603 1.0 ug DNA
EUR 154

Ppm1b sgRNA CRISPR Lentivector (Rat) (Target 3)

K6655604 1.0 ug DNA
EUR 154

Ppm1b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4554102 1.0 ug DNA
EUR 154

Ppm1b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4554103 1.0 ug DNA
EUR 154

Ppm1b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4554104 1.0 ug DNA
EUR 154

PPM1B sgRNA CRISPR Lentivector (Human) (Target 1)

K1700402 1.0 ug DNA
EUR 154

PPM1B sgRNA CRISPR Lentivector (Human) (Target 2)

K1700403 1.0 ug DNA
EUR 154

PPM1B sgRNA CRISPR Lentivector (Human) (Target 3)

K1700404 1.0 ug DNA
EUR 154

PPM1B Protein Vector (Rat) (pPB-C-His)

PV295534 500 ng
EUR 603

PPM1B Protein Vector (Rat) (pPB-N-His)

PV295535 500 ng
EUR 603

PPM1B Protein Vector (Rat) (pPM-C-HA)

PV295536 500 ng
EUR 603

PPM1B Protein Vector (Rat) (pPM-C-His)

PV295537 500 ng
EUR 603

PPM1B Protein Vector (Human) (pPB-C-His)

PV032409 500 ng
EUR 329

PPM1B Protein Vector (Human) (pPB-N-His)

PV032410 500 ng
EUR 329

PPM1B Protein Vector (Human) (pPM-C-HA)

PV032411 500 ng
EUR 329

PPM1B Protein Vector (Human) (pPM-C-His)

PV032412 500 ng
EUR 329

PPM1B Protein Vector (Mouse) (pPB-C-His)

PV218386 500 ng
EUR 603

PPM1B Protein Vector (Mouse) (pPB-N-His)

PV218387 500 ng
EUR 603

PPM1B Protein Vector (Mouse) (pPM-C-HA)

PV218388 500 ng
EUR 603

PPM1B Protein Vector (Mouse) (pPM-C-His)

PV218389 500 ng
EUR 603

PPM1B Protein Vector (Mouse) (pPB-C-His)

PV218390 500 ng
EUR 603

PPM1B Protein Vector (Mouse) (pPB-N-His)

PV218391 500 ng
EUR 603

PPM1B Protein Vector (Mouse) (pPM-C-HA)

PV218392 500 ng
EUR 603

PPM1B Protein Vector (Mouse) (pPM-C-His)

PV218393 500 ng
EUR 603

PPM1B Protein Vector (Mouse) (pPB-C-His)

PV218394 500 ng
EUR 603

PPM1B Protein Vector (Mouse) (pPB-N-His)

PV218395 500 ng
EUR 603

PPM1B Protein Vector (Mouse) (pPM-C-HA)

PV218396 500 ng
EUR 603

PPM1B Protein Vector (Mouse) (pPM-C-His)

PV218397 500 ng
EUR 603

PPM1B Protein Vector (Mouse) (pPB-C-His)

PV218398 500 ng
EUR 603

PPM1B Protein Vector (Mouse) (pPB-N-His)

PV218399 500 ng
EUR 603

PPM1B Protein Vector (Mouse) (pPM-C-HA)

PV218400 500 ng
EUR 603

PPM1B Protein Vector (Mouse) (pPM-C-His)

PV218401 500 ng
EUR 603

Ppm1b 3'UTR Luciferase Stable Cell Line

TU116787 1.0 ml Ask for price

Ppm1b 3'UTR GFP Stable Cell Line

TU166787 1.0 ml Ask for price

Ppm1b 3'UTR Luciferase Stable Cell Line

TU216633 1.0 ml Ask for price

Ppm1b 3'UTR GFP Stable Cell Line

TU266633 1.0 ml Ask for price

PPM1B 3'UTR GFP Stable Cell Line

TU068605 1.0 ml
EUR 1521

PPM1B 3'UTR Luciferase Stable Cell Line

TU018605 1.0 ml
EUR 1521

PPM1B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV691027 1.0 ug DNA
EUR 682

PPM1B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV691031 1.0 ug DNA
EUR 682

PPM1B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV691032 1.0 ug DNA
EUR 682

PPM1B Rabbit Polyclonal Antibody