
셀타젠 Genetic Genotyping

PRDX6 Rabbit Polyclonal Antibody

PRDX6 Rabbit Polyclonal Antibody

Human Peroxiredoxin 6 (PRDX6) ELISA Kit

DLR-PRDX6-Hu-48T 48T
EUR 517
  • Should the Human Peroxiredoxin 6 (PRDX6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit

DLR-PRDX6-Hu-96T 96T
EUR 673
  • Should the Human Peroxiredoxin 6 (PRDX6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit

DLR-PRDX6-Mu-48T 48T
EUR 527
  • Should the Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit

DLR-PRDX6-Mu-96T 96T
EUR 688
  • Should the Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit

RD-PRDX6-Hu-48Tests 48 Tests
EUR 521

Human Peroxiredoxin 6 (PRDX6) ELISA Kit

RD-PRDX6-Hu-96Tests 96 Tests
EUR 723

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit

RD-PRDX6-Mu-48Tests 48 Tests
EUR 533

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit

RD-PRDX6-Mu-96Tests 96 Tests
EUR 740

Human Peroxiredoxin 6 (PRDX6) ELISA Kit

RDR-PRDX6-Hu-48Tests 48 Tests
EUR 544

Human Peroxiredoxin 6 (PRDX6) ELISA Kit

RDR-PRDX6-Hu-96Tests 96 Tests
EUR 756

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit

RDR-PRDX6-Mu-48Tests 48 Tests
EUR 557

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit

RDR-PRDX6-Mu-96Tests 96 Tests
EUR 774

PRDX6 Rabbit mAb

A4286-100ul 100 ul
EUR 410

PRDX6 Rabbit mAb

A4286-200ul 200 ul
EUR 571

PRDX6 Rabbit mAb

A4286-20ul 20 ul
EUR 221

PRDX6 Rabbit mAb

A4286-50ul 50 ul
EUR 287

PRDX6 Rabbit pAb

A2031-100ul 100 ul
EUR 308

PRDX6 Rabbit pAb

A2031-200ul 200 ul
EUR 459

PRDX6 Rabbit pAb

A2031-20ul 20 ul
EUR 183

PRDX6 Rabbit pAb

A2031-50ul 50 ul
EUR 223

Polyclonal PRDX6 Antibody (Center)

AMR09505G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRDX6 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal PRDX6 / Peroxiredoxin 6 Antibody

AMR09520G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRDX6 / Peroxiredoxin 6 . This antibody is tested and proven to work in the following applications:

Polyclonal PRDX6 / Peroxiredoxin 6 Antibody

AMR09522G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRDX6 / Peroxiredoxin 6 . This antibody is tested and proven to work in the following applications:

Polyclonal PRDX6 Antibody (C-term)

AMR09524G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRDX6 (C-term). This antibody is tested and proven to work in the following applications:

PRDX6 antibody

70R-2954 50 ug
EUR 467
Description: Rabbit polyclonal PRDX6 antibody raised against the C terminal of PRDX6

PRDX6 Antibody

ABD6765 100 ug
EUR 438

PRDX6 Antibody

49475-100ul 100ul
EUR 333

PRDX6 Antibody

49475-50ul 50ul
EUR 239

PRDX6 Antibody

31117-100ul 100ul
EUR 252

PRDX6 Antibody

31117-50ul 50ul
EUR 187

PRDX6 Antibody

32561-100ul 100ul
EUR 252

PRDX6 antibody

70R-19505 50 ul
EUR 435
Description: Rabbit polyclonal PRDX6 antibody

PRDX6 antibody

70R-1201 100 ug
EUR 377
Description: Rabbit polyclonal PRDX6 antibody raised against the middle region of PRDX6

PRDX6 Antibody

DF6765 200ul
EUR 304
Description: PRDX6 Antibody detects endogenous levels of total PRDX6.

PRDX6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PRDX6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PRDX6 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

PRDX6 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6)

PRDX6 Conjugated Antibody

C49475 100ul
EUR 397

PRDX6 Conjugated Antibody

C32561 100ul
EUR 397

PRDX6 Conjugated Antibody

C31117 100ul
EUR 397

anti- PRDX6 antibody

FNab06759 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: peroxiredoxin 6
  • Uniprot ID: P30041
  • Gene ID: 9588
  • Research Area: Cancer, Metabolism
Description: Antibody raised against PRDX6

Anti-PRDX6 antibody

PAab06759 100 ug
EUR 355

Anti-PRDX6 antibody

STJ25108 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the thiol-specific antioxidant protein family. This protein is a bifunctional enzyme with two distinct active sites. It is involved in redox regulation of the cell; it can reduce H(2)O(2) and short chain organic, fatty acid, and phospholipid hydroperoxides. It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury.

Anti-PRDX6 antibody

STJ192310 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PRDX6

Anti-PRDX6/Peroxiredoxin 6 Rabbit Monoclonal Antibody

M01847 100ug/vial
EUR 397
Description: Rabbit Monoclonal PRDX6/Peroxiredoxin 6 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.


ELA-E1751r 96 Tests
EUR 886

Prdx6/ Rat Prdx6 ELISA Kit

ELI-05680r 96 Tests
EUR 886

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine)

  • EUR 276.00
  • EUR 2972.00
  • EUR 730.00
  • EUR 352.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~pro224)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6)

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6)

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Biotin.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Cy3.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with FITC.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with HRP.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with PE.

Rabbit Anti-PRDX6 monoclonal antibody, clone KN22-24

DCABH-2690 100 ul
EUR 777


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Peroxiredoxin 6 (PRDX6) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Peroxiredoxin 6 (PRDX6) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Peroxiredoxin 6 (PRDX6) Antibody

  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Peroxiredoxin 6 (PRDX6) Antibody

abx031800-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody

abx031800-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody

abx031801-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody

abx031801-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody

abx018042-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody

abx018043-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody

abx018331-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Peroxiredoxin 6 (PRDX6) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Peroxiredoxin 6 (PRDX6) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Peroxiredoxin 6 (PRDX6) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

peroxiredoxin 6 (PRDX6) Antibody

abx433117-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

peroxiredoxin 6 (PRDX6) Antibody

abx433118-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Peroxiredoxin 6 (PRDX6) Antibody

abx236759-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

PRDX6 recombinant monoclonal antibody

A5292 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human PRDX6 for WB, IHC,ELISA

PRDX6 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PRDX6 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PRDX6 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), APC

  • EUR 389.00
  • EUR 3905.00
  • EUR 1070.00
  • EUR 503.00
  • EUR 238.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~pro224)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), Biotinylated

  • EUR 344.00
  • EUR 2922.00
  • EUR 843.00
  • EUR 427.00
  • EUR 233.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~pro224)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with Biotin.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), Cy3

  • EUR 477.00
  • EUR 5165.00
  • EUR 1385.00
  • EUR 629.00
  • EUR 276.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~pro224)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with Cy3.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), FITC

  • EUR 331.00
  • EUR 3144.00
  • EUR 876.00
  • EUR 422.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~pro224)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with FITC.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), HRP

  • EUR 354.00
  • EUR 3401.00
  • EUR 944.00
  • EUR 452.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~pro224)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with HRP.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), PE

  • EUR 331.00
  • EUR 3144.00
  • EUR 876.00
  • EUR 422.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~pro224)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with PE.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6)

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Biotin.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Cy3.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with FITC.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with HRP.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with PE.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC-Cy7.

Monoclonal PRDX6 / Peroxiredoxin 6 Antibody

AMR09521G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human PRDX6 / Peroxiredoxin 6. The antibodies are raised in Mouse. This antibody is applicable in IHC-P, E, IP

Peroxiredoxin 6 (PRDX6) Antibody (Biotin)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Peroxiredoxin 6 (PRDX6) Antibody (FITC)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Peroxiredoxin 6 (PRDX6) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peroxiredoxin 6 (PRDX6) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Peroxiredoxin-6 (PRDX6) Antibody

32833-05111 150 ug
EUR 261

Anti-Peroxiredoxin 6/PRDX6 Antibody

PB9350 100ug/vial
EUR 334

PRDX6 cloning plasmid

CSB-CL018659HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 675
  • Sequence: atgcccggaggtctgcttctcggggacgtggctcccaactttgaggccaataccaccgtcggccgcatccgtttccacgactttctgggagactcatggggcattctcttctcccaccctcgggactttaccccagtgtgcaccacagagcttggcagagctgcaaagctggcacc
  • Show more
Description: A cloning plasmid for the PRDX6 gene.

PRDX6 Blocking Peptide

33R-1499 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRDX6 antibody, catalog no. 70R-1201

PRDX6 Blocking Peptide

33R-9440 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRDX6 antibody, catalog no. 70R-2954

PRDX6 Blocking Peptide

DF6765-BP 1mg
EUR 195

pET28a-PRDX6 Plasmid

PVTB00160-1a 2 ug
EUR 356

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), APC-Cy7

  • EUR 659.00
  • EUR 7690.00
  • EUR 2020.00
  • EUR 886.00
  • EUR 356.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~pro224)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC-Cy7.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Biotin.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Cy3.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with FITC.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with HRP.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with PE.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC-Cy7.

Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRDX6 (Met1~Pro224)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC-Cy7.

Rat PRDX6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EHP0762 96Tests
EUR 521


ELA-E1751h 96 Tests
EUR 824


EF006024 96 Tests
EUR 689

Human PRDX6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PRDX6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Peroxiredoxin 6 (PRDX6)

  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O77834
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.9kDa
  • Isoelectric Point: 6.8
Description: Recombinant Bovine Peroxiredoxin 6 expressed in: E.coli

Recombinant Peroxiredoxin 6 (PRDX6)

  • EUR 350.88
  • EUR 197.00
  • EUR 1040.80
  • EUR 413.60
  • EUR 727.20
  • EUR 298.00
  • EUR 2452.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P30041
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Peroxiredoxin 6 expressed in: E.coli

Recombinant Peroxiredoxin 6 (PRDX6)

  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O08709
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.6kDa
  • Isoelectric Point: 6.6
Description: Recombinant Mouse Peroxiredoxin 6 expressed in: E.coli

Recombinant Peroxiredoxin 6 (PRDX6)

  • EUR 315.04
  • EUR 187.00
  • EUR 906.40
  • EUR 368.80
  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O35244
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.1kDa
  • Isoelectric Point: 6.1
Description: Recombinant Rat Peroxiredoxin 6 expressed in: E.coli

Recombinant Peroxiredoxin 6 (PRDX6)

  • EUR 315.04
  • EUR 187.00
  • EUR 906.40
  • EUR 368.80
  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O35244
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Peroxiredoxin 6 expressed in: E.coli

PRDX6 Recombinant Protein (Human)

RP024538 100 ug Ask for price

PRDX6 Recombinant Protein (Rat)

RP221966 100 ug Ask for price

pET28a-TAT-PRDX6 Plasmid

PVTB00160-1b 2 ug
EUR 356

pEGFP-N1-PRDX6 Plasmid

PVTB00160-2a 2 ug
EUR 356

PRDX6 Recombinant Protein (Mouse)

RP164291 100 ug Ask for price

Human Peroxiredoxin-6 (PRDX6) Antibody (Biotin Conjugate)

32833-05121 150 ug
EUR 369

Mouse Peroxiredoxin 6 (PRDX6) Protein

  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Peroxiredoxin 6 (PRDX6) Protein

  • EUR 495.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 578.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Peroxiredoxin 6 (PRDX6) Protein

  • EUR 453.00
  • EUR 230.00
  • EUR 1233.00
  • EUR 523.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Peroxiredoxin 6 (PRDX6) Protein

  • EUR 453.00
  • EUR 230.00
  • EUR 1233.00
  • EUR 523.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Cow Peroxiredoxin 6 (PRDX6) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

PRDX6 ORF Vector (Human) (pORF)

ORF008180 1.0 ug DNA
EUR 95

Prdx6 ORF Vector (Rat) (pORF)

ORF073990 1.0 ug DNA
EUR 506

Prdx6 ORF Vector (Mouse) (pORF)

ORF054765 1.0 ug DNA
EUR 506

pET28a-(Arg)9-PRDX6 Plasmid

PVTB00160-1c 2 ug
EUR 356

PRDX6 ELISA Kit (Human) (OKAN05463)

OKAN05463 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a member of the thiol-specific antioxidant protein family. This protein is a bifunctional enzyme with two distinct active sites. It is involved in redox regulation of the cell; it can reduce H(2)O(2) and short chain organic, fatty acid, and phospholipid hydroperoxides. It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.119 ng/mL

PRDX6 ELISA Kit (Mouse) (OKCD02821)

OKCD02821 96 Wells
EUR 857
Description: Description of target: Involved in redox regulation of the cell. Can reduce H2O2 and short chain organic, fatty acid, and phospholipid hydroperoxides. May play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 29 pg/mL

PRDX6 ELISA Kit (Human) (OKCD08831)

OKCD08831 96 Wells
EUR 975
Description: Description of target: PRDX6 is a member of the thiol-specific antioxidant protein family. This protein is a bifunctional enzyme with two distinct active sites. It is involved in redox regulation of the cell; it can reduce H(2)O(2) and short chain organic, fatty acid, and phospholipid hydroperoxides. It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. The protein encoded by this gene is a member of the thiol-specific antioxidant protein family. This protein is a bifunctional enzyme with two distinct active sites. It is involved in redox regulation of the cell; it can reduce H(2)O(2) and short chain organic, fatty acid, and phospholipid hydroperoxides. It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.114ng/mL

PRDX6 ELISA Kit (Rat) (OKEH06109)

OKEH06109 96 Wells
EUR 662
Description: Description of target: Involved in redox regulation of the cell. Can reduce H2O2 and short chain organic, fatty acid, and phospholipid hydroperoxides. May play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31.27 pg/mL

PRDX6 ELISA Kit (Mouse) (OKEH07122)

OKEH07122 96 Wells
EUR 662
Description: Description of target: Involved in redox regulation of the cell. Can reduce H2O2 and short chain organic, fatty acid, and phospholipid hydroperoxides. May play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31.25 pg/mL

Human Peroxiredoxin-6 (PRDX6) AssayLite Antibody (FITC Conjugate)

32833-05141 150 ug
EUR 428

Human Peroxiredoxin-6 (PRDX6) AssayLite Antibody (RPE Conjugate)

32833-05151 150 ug
EUR 428

Human Peroxiredoxin-6 (PRDX6) AssayLite Antibody (APC Conjugate)

32833-05161 150 ug
EUR 428

Human Peroxiredoxin-6 (PRDX6) AssayLite Antibody (PerCP Conjugate)

32833-05171 150 ug
EUR 471

Cow Peroxiredoxin 6 (PRDX6) ELISA Kit

abx518341-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Peroxiredoxin 6 (PRDX6) ELISA Kit

abx518342-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit

abx518343-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Pig Peroxiredoxin 6 (PRDX6) ELISA Kit

abx518345-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Peroxiredoxin 6 (PRDX6) ELISA Kit

abx518346-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit

abx571527-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit

abx572818-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Rat Prdx6/ Peroxiredoxin-6 ELISA Kit

E0794Ra 1 Kit
EUR 571

Human PRDX6/ Peroxiredoxin-6 ELISA Kit

E2027Hu 1 Kit
EUR 571

Human PRDX6(Peroxiredoxin-6) ELISA Kit

EH1911 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: P30041
  • Alias: PRDX6/aiPLA2/AOP2/NSGPx/1-Cys/24 kDa protein/Acidic calcium-independent phospholipase A2/aiPLA21-Cys PRX/Antioxidant protein 2/Non-selenium glutathione peroxidase/Red blood cells page spot 12
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Mouse Peroxiredoxin- 6, Prdx6 ELISA KIT

ELI-05678m 96 Tests
EUR 865

Human Peroxiredoxin- 6, PRDX6 ELISA KIT

ELI-05679h 96 Tests
EUR 824

Bovine Peroxiredoxin- 6, PRDX6 ELISA KIT

ELI-05681b 96 Tests
EUR 928

Chicken Peroxiredoxin- 6, PRDX6 ELISA KIT

ELI-05682c 96 Tests
EUR 928

Porcine Peroxiredoxin- 6, PRDX6 ELISA KIT

ELI-05683p 96 Tests
EUR 928

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Peroxiredoxin 6 (PRDX6) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Peroxiredoxin 6 (PRDX6) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Peroxiredoxin 6 (PRDX6)ELISA Kit

201-12-2930 96 tests
EUR 440
  • This Peroxiredoxin 6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

PRDX6 sgRNA CRISPR Lentivector set (Human)

K2823601 3 x 1.0 ug
EUR 339

Prdx6 sgRNA CRISPR Lentivector set (Mouse)

K4354001 3 x 1.0 ug
EUR 339

Human Peroxiredoxin-6(PRDX6) ELISA kit

CSB-EL018659HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Peroxiredoxin-6 (PRDX6) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Peroxiredoxin-6(PRDX6) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Peroxiredoxin-6(PRDX6) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Prdx6 sgRNA CRISPR Lentivector set (Rat)

K7039501 3 x 1.0 ug
EUR 339

PRDX6 Peroxiredoxin-6 Human Recombinant Protein

PROTP30041 Regular: 20ug
EUR 317
Description: Peroxiredoxin- 6 Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 244 amino acids (1-224 a.a.) and having a molecular mass of 27.1kDa.;The Peroxiredoxin-6 is purified by proprietary chromatographic techniques.

Human Peroxiredoxin 6 ELISA Kit (PRDX6)

RK02130 96 Tests
EUR 521

Human Peroxiredoxin 6(PRDX6)ELISA Kit

QY-E03244 96T
EUR 361

Human Peroxiredoxin 6 (PRDX6) ELISA Kit

SEF756Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit

SEF756Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit

SEF756Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit

SEF756Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids.

Human Peroxiredoxin 6 (PRDX6) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Peroxiredoxin 6 elisa. Alternative names of the recognized antigen: 1-Cys
  • AOP2
  • NSGPx
  • PRX
  • aiPLA2
  • p29
  • Acidic calcium-independent phospholipase A2
  • Antioxidant protein 2
  • Non-selenium glutathione peroxidase
  • Red blood cells page spot
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit

SEF756Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit

SEF756Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit

SEF756Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit

SEF756Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Peroxiredoxin 6 elisa. Alternative names of the recognized antigen: 1-Cys
  • AOP2
  • NSGPx
  • PRX
  • aiPLA2
  • p29
  • Acidic calcium-independent phospholipase A2
  • Antioxidant protein 2
  • Non-selenium glutathione peroxidase
  • Red blood cells page spot
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Monoclonal PRDX6 / Peroxiredoxin 6 Antibody (clone 4A3), Clone: 4A3

AMR09523G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human PRDX6 / Peroxiredoxin 6 (clone 4A3). The antibodies are raised in Mouse and are from clone 4A3. This antibody is applicable in WB and IHC-P, E

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PRDX6 Rabbit Polyclonal Antibody