PRDX6 Rabbit Polyclonal Antibody
Human Peroxiredoxin 6 (PRDX6) ELISA Kit |
DLR-PRDX6-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Peroxiredoxin 6 (PRDX6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Peroxiredoxin 6 (PRDX6) ELISA Kit |
DLR-PRDX6-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Peroxiredoxin 6 (PRDX6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit |
DLR-PRDX6-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit |
DLR-PRDX6-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Peroxiredoxin 6 (PRDX6) ELISA Kit |
RD-PRDX6-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Peroxiredoxin 6 (PRDX6) ELISA Kit |
RD-PRDX6-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit |
RD-PRDX6-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit |
RD-PRDX6-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Peroxiredoxin 6 (PRDX6) ELISA Kit |
RDR-PRDX6-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Peroxiredoxin 6 (PRDX6) ELISA Kit |
RDR-PRDX6-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit |
RDR-PRDX6-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit |
RDR-PRDX6-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
PRDX6 Rabbit mAb |
A4286-100ul |
Abclonal |
100 ul |
EUR 410 |
PRDX6 Rabbit mAb |
A4286-200ul |
Abclonal |
200 ul |
EUR 571 |
PRDX6 Rabbit mAb |
A4286-20ul |
Abclonal |
20 ul |
EUR 221 |
PRDX6 Rabbit mAb |
A4286-50ul |
Abclonal |
50 ul |
EUR 287 |
PRDX6 Rabbit pAb |
A2031-100ul |
Abclonal |
100 ul |
EUR 308 |
PRDX6 Rabbit pAb |
A2031-200ul |
Abclonal |
200 ul |
EUR 459 |
PRDX6 Rabbit pAb |
A2031-20ul |
Abclonal |
20 ul |
EUR 183 |
PRDX6 Rabbit pAb |
A2031-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal PRDX6 Antibody (Center) |
AMR09505G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRDX6 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal PRDX6 / Peroxiredoxin 6 Antibody |
AMR09520G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRDX6 / Peroxiredoxin 6 . This antibody is tested and proven to work in the following applications: |
Polyclonal PRDX6 / Peroxiredoxin 6 Antibody |
AMR09522G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRDX6 / Peroxiredoxin 6 . This antibody is tested and proven to work in the following applications: |
Polyclonal PRDX6 Antibody (C-term) |
AMR09524G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRDX6 (C-term). This antibody is tested and proven to work in the following applications: |
PRDX6 antibody |
70R-2954 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PRDX6 antibody raised against the C terminal of PRDX6 |
PRDX6 Antibody |
49475-100ul |
SAB |
100ul |
EUR 333 |
PRDX6 Antibody |
49475-50ul |
SAB |
50ul |
EUR 239 |
PRDX6 Antibody |
31117-100ul |
SAB |
100ul |
EUR 252 |
PRDX6 Antibody |
31117-50ul |
SAB |
50ul |
EUR 187 |
PRDX6 Antibody |
32561-100ul |
SAB |
100ul |
EUR 252 |
PRDX6 antibody |
70R-19505 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PRDX6 antibody |
PRDX6 antibody |
70R-1201 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal PRDX6 antibody raised against the middle region of PRDX6 |
PRDX6 Antibody |
DF6765 |
Affbiotech |
200ul |
EUR 304 |
Description: PRDX6 Antibody detects endogenous levels of total PRDX6. |
PRDX6 Antibody |
1-CSB-PA968257 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
PRDX6 Antibody |
1-CSB-PA596780 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
PRDX6 Antibody |
1-CSB-PA018659GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
PRDX6 Antibody |
1-CSB-PA018659LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000 |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat) |
4-PAF756Ra02 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6) |
PRDX6 Conjugated Antibody |
C49475 |
SAB |
100ul |
EUR 397 |
PRDX6 Conjugated Antibody |
C32561 |
SAB |
100ul |
EUR 397 |
PRDX6 Conjugated Antibody |
C31117 |
SAB |
100ul |
EUR 397 |
anti- PRDX6 antibody |
FNab06759 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:200
- Immunogen: peroxiredoxin 6
- Uniprot ID: P30041
- Gene ID: 9588
- Research Area: Cancer, Metabolism
|
Description: Antibody raised against PRDX6 |
Anti-PRDX6 antibody |
STJ25108 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the thiol-specific antioxidant protein family. This protein is a bifunctional enzyme with two distinct active sites. It is involved in redox regulation of the cell; it can reduce H(2)O(2) and short chain organic, fatty acid, and phospholipid hydroperoxides. It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. |
Anti-PRDX6 antibody |
STJ192310 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PRDX6 |
Anti-PRDX6/Peroxiredoxin 6 Rabbit Monoclonal Antibody |
M01847 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal PRDX6/Peroxiredoxin 6 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine) |
4-PAF756Bo01 |
Cloud-Clone |
-
EUR 276.00
-
EUR 2972.00
-
EUR 730.00
-
EUR 352.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~pro224)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6) |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat) |
4-PAF756Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6) |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), APC |
4-PAF756Ra02-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), Biotinylated |
4-PAF756Ra02-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Biotin. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), Cy3 |
4-PAF756Ra02-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Cy3. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), FITC |
4-PAF756Ra02-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with FITC. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), HRP |
4-PAF756Ra02-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with HRP. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), PE |
4-PAF756Ra02-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with PE. |
PRDX6 siRNA |
20-abx904221 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PRDX6 siRNA |
20-abx929690 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PRDX6 siRNA |
20-abx929691 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
20-abx114402 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
20-abx130225 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
20-abx001648 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
20-abx142170 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
20-abx101561 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
20-abx101562 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
20-abx104862 |
Abbexa |
-
EUR 481.00
-
EUR 133.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
abx031800-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
abx031800-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
abx031801-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
abx031801-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
abx018042-100ug |
Abbexa |
100 ug |
EUR 384 |
- Shipped within 5-10 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
abx018043-100ug |
Abbexa |
100 ug |
EUR 384 |
- Shipped within 5-10 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
abx018331-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
20-abx174004 |
Abbexa |
|
|
|
Peroxiredoxin 6 (PRDX6) Antibody |
20-abx177966 |
Abbexa |
|
|
|
Peroxiredoxin 6 (PRDX6) Antibody |
20-abx177967 |
Abbexa |
|
|
|
Peroxiredoxin 6 (PRDX6) Antibody |
20-abx214752 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
20-abx214753 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
20-abx338412 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
peroxiredoxin 6 (PRDX6) Antibody |
abx433117-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
peroxiredoxin 6 (PRDX6) Antibody |
abx433118-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody |
abx236759-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
PRDX6 recombinant monoclonal antibody |
A5292 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human PRDX6 for WB, IHC,ELISA |
PRDX6 Antibody, HRP conjugated |
1-CSB-PA018659LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PRDX6 Antibody, FITC conjugated |
1-CSB-PA018659LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PRDX6 Antibody, Biotin conjugated |
1-CSB-PA018659LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PRDX6. Recognizes PRDX6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), APC |
4-PAF756Bo01-APC |
Cloud-Clone |
-
EUR 389.00
-
EUR 3905.00
-
EUR 1070.00
-
EUR 503.00
-
EUR 238.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~pro224)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), Biotinylated |
4-PAF756Bo01-Biotin |
Cloud-Clone |
-
EUR 344.00
-
EUR 2922.00
-
EUR 843.00
-
EUR 427.00
-
EUR 233.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~pro224)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with Biotin. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), Cy3 |
4-PAF756Bo01-Cy3 |
Cloud-Clone |
-
EUR 477.00
-
EUR 5165.00
-
EUR 1385.00
-
EUR 629.00
-
EUR 276.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~pro224)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with Cy3. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), FITC |
4-PAF756Bo01-FITC |
Cloud-Clone |
-
EUR 331.00
-
EUR 3144.00
-
EUR 876.00
-
EUR 422.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~pro224)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with FITC. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), HRP |
4-PAF756Bo01-HRP |
Cloud-Clone |
-
EUR 354.00
-
EUR 3401.00
-
EUR 944.00
-
EUR 452.00
-
EUR 223.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~pro224)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with HRP. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), PE |
4-PAF756Bo01-PE |
Cloud-Clone |
-
EUR 331.00
-
EUR 3144.00
-
EUR 876.00
-
EUR 422.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~pro224)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with PE. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat) |
4-PAF756Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6) |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), APC |
4-PAF756Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), Biotinylated |
4-PAF756Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Biotin. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), Cy3 |
4-PAF756Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Cy3. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), FITC |
4-PAF756Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with FITC. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), HRP |
4-PAF756Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with HRP. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), PE |
4-PAF756Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with PE. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAF756Ra02-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC-Cy7. |
Monoclonal PRDX6 / Peroxiredoxin 6 Antibody |
AMR09521G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human PRDX6 / Peroxiredoxin 6. The antibodies are raised in Mouse. This antibody is applicable in IHC-P, E, IP |
Peroxiredoxin 6 (PRDX6) Antibody (Biotin) |
20-abx273421 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody (FITC) |
20-abx273575 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody (HRP) |
20-abx336973 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody (FITC) |
20-abx336974 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody (Biotin) |
20-abx336975 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Peroxiredoxin 6 (PRDX6) Antibody (Biotin) |
20-abx272387 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Peroxiredoxin-6 (PRDX6) Antibody |
32833-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-Peroxiredoxin 6/PRDX6 Antibody |
PB9350 |
BosterBio |
100ug/vial |
EUR 334 |
PRDX6 cloning plasmid |
CSB-CL018659HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 675
- Sequence: atgcccggaggtctgcttctcggggacgtggctcccaactttgaggccaataccaccgtcggccgcatccgtttccacgactttctgggagactcatggggcattctcttctcccaccctcgggactttaccccagtgtgcaccacagagcttggcagagctgcaaagctggcacc
- Show more
|
Description: A cloning plasmid for the PRDX6 gene. |
PRDX6 Blocking Peptide |
33R-1499 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRDX6 antibody, catalog no. 70R-1201 |
PRDX6 Blocking Peptide |
33R-9440 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRDX6 antibody, catalog no. 70R-2954 |
PRDX6 Blocking Peptide |
DF6765-BP |
Affbiotech |
1mg |
EUR 195 |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Bovine), APC-Cy7 |
4-PAF756Bo01-APC-Cy7 |
Cloud-Clone |
-
EUR 659.00
-
EUR 7690.00
-
EUR 2020.00
-
EUR 886.00
-
EUR 356.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~pro224)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC-Cy7. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), APC |
4-PAF756Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated |
4-PAF756Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Biotin. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), Cy3 |
4-PAF756Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with Cy3. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), FITC |
4-PAF756Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with FITC. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), HRP |
4-PAF756Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with HRP. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), PE |
4-PAF756Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with PE. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Rat), APC-Cy7 |
4-PAF756Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC-Cy7. |
Peroxiredoxin 6 (PRDX6) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7 |
4-PAF756Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PRDX6 (Met1~Pro224)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Peroxiredoxin 6 (PRDX6). This antibody is labeled with APC-Cy7. |
Rat PRDX6 shRNA Plasmid |
20-abx987074 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PRDX6 ELISA Kit |
EHP0762 |
Abclonal |
96Tests |
EUR 521 |
Human PRDX6 shRNA Plasmid |
20-abx956382 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PRDX6 shRNA Plasmid |
20-abx969155 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Recombinant Peroxiredoxin 6 (PRDX6) |
4-RPF756Bo01 |
Cloud-Clone |
-
EUR 530.08
-
EUR 245.00
-
EUR 1712.80
-
EUR 637.60
-
EUR 1175.20
-
EUR 418.00
-
EUR 4132.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O77834
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 28.9kDa
- Isoelectric Point: 6.8
|
Description: Recombinant Bovine Peroxiredoxin 6 expressed in: E.coli |
Recombinant Peroxiredoxin 6 (PRDX6) |
4-RPF756Hu01 |
Cloud-Clone |
-
EUR 350.88
-
EUR 197.00
-
EUR 1040.80
-
EUR 413.60
-
EUR 727.20
-
EUR 298.00
-
EUR 2452.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P30041
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 26.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Peroxiredoxin 6 expressed in: E.coli |
Recombinant Peroxiredoxin 6 (PRDX6) |
4-RPF756Mu01 |
Cloud-Clone |
-
EUR 440.48
-
EUR 221.00
-
EUR 1376.80
-
EUR 525.60
-
EUR 951.20
-
EUR 358.00
-
EUR 3292.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O08709
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 28.6kDa
- Isoelectric Point: 6.6
|
Description: Recombinant Mouse Peroxiredoxin 6 expressed in: E.coli |
Recombinant Peroxiredoxin 6 (PRDX6) |
4-RPF756Ra01 |
Cloud-Clone |
-
EUR 315.04
-
EUR 187.00
-
EUR 906.40
-
EUR 368.80
-
EUR 637.60
-
EUR 274.00
-
EUR 2116.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O35244
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 26.1kDa
- Isoelectric Point: 6.1
|
Description: Recombinant Rat Peroxiredoxin 6 expressed in: E.coli |
Recombinant Peroxiredoxin 6 (PRDX6) |
4-RPF756Ra02 |
Cloud-Clone |
-
EUR 315.04
-
EUR 187.00
-
EUR 906.40
-
EUR 368.80
-
EUR 637.60
-
EUR 274.00
-
EUR 2116.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O35244
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 51.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Peroxiredoxin 6 expressed in: E.coli |
PRDX6 Recombinant Protein (Human) |
RP024538 |
ABM |
100 ug |
Ask for price |
PRDX6 Recombinant Protein (Rat) |
RP221966 |
ABM |
100 ug |
Ask for price |
PRDX6 Recombinant Protein (Mouse) |
RP164291 |
ABM |
100 ug |
Ask for price |
Human Peroxiredoxin-6 (PRDX6) Antibody (Biotin Conjugate) |
32833-05121 |
AssayPro |
150 ug |
EUR 369 |
Mouse Peroxiredoxin 6 (PRDX6) Protein |
20-abx652232 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1859.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Peroxiredoxin 6 (PRDX6) Protein |
20-abx068489 |
Abbexa |
-
EUR 495.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 578.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Rat Peroxiredoxin 6 (PRDX6) Protein |
20-abx068490 |
Abbexa |
-
EUR 453.00
-
EUR 230.00
-
EUR 1233.00
-
EUR 523.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Peroxiredoxin 6 (PRDX6) Protein |
20-abx068491 |
Abbexa |
-
EUR 453.00
-
EUR 230.00
-
EUR 1233.00
-
EUR 523.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Cow Peroxiredoxin 6 (PRDX6) Protein |
20-abx166297 |
Abbexa |
-
EUR 732.00
-
EUR 286.00
-
EUR 2305.00
-
EUR 885.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
PRDX6 ORF Vector (Human) (pORF) |
ORF008180 |
ABM |
1.0 ug DNA |
EUR 95 |
Prdx6 ORF Vector (Rat) (pORF) |
ORF073990 |
ABM |
1.0 ug DNA |
EUR 506 |
Prdx6 ORF Vector (Mouse) (pORF) |
ORF054765 |
ABM |
1.0 ug DNA |
EUR 506 |
PRDX6 ELISA Kit (Human) (OKAN05463) |
OKAN05463 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: The protein encoded by this gene is a member of the thiol-specific antioxidant protein family. This protein is a bifunctional enzyme with two distinct active sites. It is involved in redox regulation of the cell; it can reduce H(2)O(2) and short chain organic, fatty acid, and phospholipid hydroperoxides. It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.119 ng/mL |
PRDX6 ELISA Kit (Mouse) (OKCD02821) |
OKCD02821 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Involved in redox regulation of the cell. Can reduce H2O2 and short chain organic, fatty acid, and phospholipid hydroperoxides. May play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 29 pg/mL |
PRDX6 ELISA Kit (Human) (OKCD08831) |
OKCD08831 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: PRDX6 is a member of the thiol-specific antioxidant protein family. This protein is a bifunctional enzyme with two distinct active sites. It is involved in redox regulation of the cell; it can reduce H(2)O(2) and short chain organic, fatty acid, and phospholipid hydroperoxides. It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. The protein encoded by this gene is a member of the thiol-specific antioxidant protein family. This protein is a bifunctional enzyme with two distinct active sites. It is involved in redox regulation of the cell; it can reduce H(2)O(2) and short chain organic, fatty acid, and phospholipid hydroperoxides. It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.114ng/mL |
PRDX6 ELISA Kit (Rat) (OKEH06109) |
OKEH06109 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Involved in redox regulation of the cell. Can reduce H2O2 and short chain organic, fatty acid, and phospholipid hydroperoxides. May play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31.27 pg/mL |
PRDX6 ELISA Kit (Mouse) (OKEH07122) |
OKEH07122 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Involved in redox regulation of the cell. Can reduce H2O2 and short chain organic, fatty acid, and phospholipid hydroperoxides. May play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31.25 pg/mL |
Human Peroxiredoxin-6 (PRDX6) AssayLite Antibody (FITC Conjugate) |
32833-05141 |
AssayPro |
150 ug |
EUR 428 |
Human Peroxiredoxin-6 (PRDX6) AssayLite Antibody (RPE Conjugate) |
32833-05151 |
AssayPro |
150 ug |
EUR 428 |
Human Peroxiredoxin-6 (PRDX6) AssayLite Antibody (APC Conjugate) |
32833-05161 |
AssayPro |
150 ug |
EUR 428 |
Human Peroxiredoxin-6 (PRDX6) AssayLite Antibody (PerCP Conjugate) |
32833-05171 |
AssayPro |
150 ug |
EUR 471 |
Cow Peroxiredoxin 6 (PRDX6) ELISA Kit |
abx518341-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Chicken Peroxiredoxin 6 (PRDX6) ELISA Kit |
abx518342-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Peroxiredoxin 6 (PRDX6) ELISA Kit |
abx518343-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Pig Peroxiredoxin 6 (PRDX6) ELISA Kit |
abx518345-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Peroxiredoxin 6 (PRDX6) ELISA Kit |
abx518346-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit |
abx571527-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Peroxiredoxin 6 (PRDX6) ELISA Kit |
abx572818-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Rat Prdx6/ Peroxiredoxin-6 ELISA Kit |
E0794Ra |
Sunlong |
1 Kit |
EUR 571 |
Human PRDX6/ Peroxiredoxin-6 ELISA Kit |
E2027Hu |
Sunlong |
1 Kit |
EUR 571 |
Human PRDX6(Peroxiredoxin-6) ELISA Kit |
EH1911 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 15.6-1000 pg/ml
- Uniprot ID: P30041
- Alias: PRDX6/aiPLA2/AOP2/NSGPx/1-Cys/24 kDa protein/Acidic calcium-independent phospholipase A2/aiPLA21-Cys PRX/Antioxidant protein 2/Non-selenium glutathione peroxidase/Red blood cells page spot 12
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml |
Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit |
20-abx154535 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Peroxiredoxin 6 (PRDX6) ELISA Kit |
20-abx152715 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Peroxiredoxin 6 (PRDX6) CLIA Kit |
20-abx494996 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Peroxiredoxin 6 (PRDX6) CLIA Kit |
20-abx494997 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Peroxiredoxin 6 (PRDX6)ELISA Kit |
201-12-2930 |
SunredBio |
96 tests |
EUR 440 |
- This Peroxiredoxin 6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
PRDX6 sgRNA CRISPR Lentivector set (Human) |
K2823601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Prdx6 sgRNA CRISPR Lentivector set (Mouse) |
K4354001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Peroxiredoxin-6(PRDX6) ELISA kit |
CSB-EL018659HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Peroxiredoxin-6 (PRDX6) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Peroxiredoxin-6(PRDX6) ELISA kit |
1-CSB-EL018659HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Peroxiredoxin-6(PRDX6) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Prdx6 sgRNA CRISPR Lentivector set (Rat) |
K7039501 |
ABM |
3 x 1.0 ug |
EUR 339 |
PRDX6 Peroxiredoxin-6 Human Recombinant Protein |
PROTP30041 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: Peroxiredoxin- 6 Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 244 amino acids (1-224 a.a.) and having a molecular mass of 27.1kDa.;The Peroxiredoxin-6 is purified by proprietary chromatographic techniques. |
Human Peroxiredoxin 6 ELISA Kit (PRDX6) |
RK02130 |
Abclonal |
96 Tests |
EUR 521 |
Human Peroxiredoxin 6 (PRDX6) ELISA Kit |
SEF756Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids. |
Human Peroxiredoxin 6 (PRDX6) ELISA Kit |
SEF756Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids. |
Human Peroxiredoxin 6 (PRDX6) ELISA Kit |
SEF756Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids. |
Human Peroxiredoxin 6 (PRDX6) ELISA Kit |
SEF756Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids. |
Human Peroxiredoxin 6 (PRDX6) ELISA Kit |
4-SEF756Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Peroxiredoxin 6 elisa. Alternative names of the recognized antigen: 1-Cys
- AOP2
- NSGPx
- PRX
- aiPLA2
- p29
- Acidic calcium-independent phospholipase A2
- Antioxidant protein 2
- Non-selenium glutathione peroxidase
- Red blood cells page spot
- Show more
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit |
SEF756Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit |
SEF756Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit |
SEF756Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit |
SEF756Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Peroxiredoxin 6 (PRDX6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Peroxiredoxin 6 (PRDX6) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Peroxiredoxin 6 (PRDX6) ELISA Kit |
4-SEF756Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Peroxiredoxin 6 elisa. Alternative names of the recognized antigen: 1-Cys
- AOP2
- NSGPx
- PRX
- aiPLA2
- p29
- Acidic calcium-independent phospholipase A2
- Antioxidant protein 2
- Non-selenium glutathione peroxidase
- Red blood cells page spot
- Show more
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Peroxiredoxin 6 (PRDX6) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Monoclonal PRDX6 / Peroxiredoxin 6 Antibody (clone 4A3), Clone: 4A3 |
AMR09523G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human PRDX6 / Peroxiredoxin 6 (clone 4A3). The antibodies are raised in Mouse and are from clone 4A3. This antibody is applicable in WB and IHC-P, E |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
PRDX6 Rabbit Polyclonal Antibody