PROM2 Rabbit Polyclonal Antibody

PROM2 Rabbit Polyclonal Antibody

PROM2 Polyclonal Antibody
ES10935-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PROM2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PROM2 Polyclonal Antibody
ES10935-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PROM2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal PROM2 Antibody (Center)
APR04249G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PROM2 (Center). This antibody is tested and proven to work in the following applications:

PROM2 antibody
10R-5462	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal PROM2 antibody

PROM2 antibody
10R-5463	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal PROM2 antibody

PROM2 antibody
10R-5464	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal PROM2 antibody

PROM2 antibody
10R-5466	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal PROM2 antibody

Prom2/ Rat Prom2 ELISA Kit
ELI-36875r	Lifescience Market	96 Tests	EUR 886

Polyclonal Prominin 2 / PROM2 Antibody (Internal)
APR02171G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Prominin 2 / PROM2 (Internal). This antibody is tested and proven to work in the following applications:

Anti-PROM2 antibody
STJ192093	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PROM2

Anti-PROM2 Antibody
STJ502662	St John's Laboratory	100 µg	EUR 476

PROM2 siRNA
20-abx904264	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PROM2 siRNA
20-abx929885	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PROM2 siRNA
20-abx929886	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Prominin-2 (PROM2) Antibody
abx029817-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Prominin-2 (PROM2) Antibody
abx029817-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Prominin-2 (PROM2) Antibody
abx340232-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Anti-PROM2 Antibody (Biotin)
STJ502667	St John's Laboratory	100 µg	EUR 586

Anti-PROM2 Antibody (FITC)
STJ502668	St John's Laboratory	100 µg	EUR 586

PROM2 cloning plasmid
CSB-CL854024HU-10ug	Cusabio	10ug	EUR 811
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2505 Sequence: ATGAAGCACACACTGGCTCTGCTGGCTCCCCTGCTGGGCCTGGGCCTGGGGCTGGCCCTGAGTCAGCTGGCTGCAGGGGCCACAGACTGCAAGTTCCTTGGCCCGGCAGAGCACCTGACATTCACCCCAGCAGCCAGGGCCCGGTGGCTGGCCCCTCGAGTTCGTGCGCCAGGAC Show more
Description: A cloning plasmid for the PROM2 gene.

Rat PROM2 shRNA Plasmid
20-abx987841	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PROM2 shRNA Plasmid
20-abx965669	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PROM2 shRNA Plasmid
20-abx980427	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Prom2 ORF Vector (Rat) (pORF)
ORF074093	ABM	1.0 ug DNA	EUR 506

PROM2 ORF Vector (Human) (pORF)
ORF014171	ABM	1.0 ug DNA	EUR 354

Prom2 ORF Vector (Mouse) (pORF)
ORF054915	ABM	1.0 ug DNA	EUR 506

Prom2 ORF Vector (Mouse) (pORF)
ORF054916	ABM	1.0 ug DNA	EUR 506

PROM2 Rabbit Polyclonal Antibody