CelltaGen
셀타젠 Genetic Genotyping

PROM2 Rabbit Polyclonal Antibody

PROM2 Polyclonal Antibody

ES10935-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PROM2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PROM2 Polyclonal Antibody

ES10935-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PROM2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal PROM2 Antibody (Center)

APR04249G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PROM2 (Center). This antibody is tested and proven to work in the following applications:

PROM2 antibody

10R-5462 100 ul
EUR 691
Description: Mouse monoclonal PROM2 antibody

PROM2 antibody

10R-5463 100 ul
EUR 726
Description: Mouse monoclonal PROM2 antibody

PROM2 antibody

10R-5464 100 ul
EUR 691
Description: Mouse monoclonal PROM2 antibody

PROM2 antibody

10R-5466 100 ul
EUR 691
Description: Mouse monoclonal PROM2 antibody

Prom2/ Rat Prom2 ELISA Kit

ELI-36875r 96 Tests
EUR 886

Polyclonal Prominin 2 / PROM2 Antibody (Internal)

APR02171G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Prominin 2 / PROM2 (Internal). This antibody is tested and proven to work in the following applications:

Anti-PROM2 antibody

STJ192093 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PROM2

Anti-PROM2 Antibody

STJ502662 100 µg
EUR 476

PROM2 siRNA

20-abx904264
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PROM2 siRNA

20-abx929885
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PROM2 siRNA

20-abx929886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Prominin-2 (PROM2) Antibody

abx029817-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Prominin-2 (PROM2) Antibody

abx029817-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Prominin-2 (PROM2) Antibody

abx340232-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Anti-PROM2 Antibody (Biotin)

STJ502667 100 µg
EUR 586

Anti-PROM2 Antibody (FITC)

STJ502668 100 µg
EUR 586

PROM2 cloning plasmid

CSB-CL854024HU-10ug 10ug
EUR 811
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2505
  • Sequence: ATGAAGCACACACTGGCTCTGCTGGCTCCCCTGCTGGGCCTGGGCCTGGGGCTGGCCCTGAGTCAGCTGGCTGCAGGGGCCACAGACTGCAAGTTCCTTGGCCCGGCAGAGCACCTGACATTCACCCCAGCAGCCAGGGCCCGGTGGCTGGCCCCTCGAGTTCGTGCGCCAGGAC
  • Show more
Description: A cloning plasmid for the PROM2 gene.

Rat PROM2 shRNA Plasmid

20-abx987841
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PROM2 shRNA Plasmid

20-abx965669
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PROM2 shRNA Plasmid

20-abx980427
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Prom2 ORF Vector (Rat) (pORF)

ORF074093 1.0 ug DNA
EUR 506

PROM2 ORF Vector (Human) (pORF)

ORF014171 1.0 ug DNA
EUR 354

Prom2 ORF Vector (Mouse) (pORF)

ORF054915 1.0 ug DNA
EUR 506

Prom2 ORF Vector (Mouse) (pORF)

ORF054916 1.0 ug DNA
EUR 506

PROM2 Rabbit Polyclonal Antibody