PTPRF Rabbit Polyclonal Antibody
PTPRF Polyclonal Antibody |
ABP60038-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PTPRF protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PTPRF from Human, Mouse, Rat. This PTPRF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRF protein |
PTPRF Polyclonal Antibody |
ABP60038-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PTPRF protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PTPRF from Human, Mouse, Rat. This PTPRF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRF protein |
PTPRF Polyclonal Antibody |
ABP60038-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PTPRF protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PTPRF from Human, Mouse, Rat. This PTPRF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRF protein |
PTPRF Polyclonal Antibody |
ES11149-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PTPRF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PTPRF Polyclonal Antibody |
ES11149-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PTPRF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PTPRF Rabbit pAb |
A5444-100ul |
Abclonal |
100 ul |
EUR 308 |
PTPRF Rabbit pAb |
A5444-200ul |
Abclonal |
200 ul |
EUR 459 |
PTPRF Rabbit pAb |
A5444-20ul |
Abclonal |
20 ul |
EUR 183 |
PTPRF Rabbit pAb |
A5444-50ul |
Abclonal |
50 ul |
EUR 223 |
PTPRF Polyclonal Conjugated Antibody |
C30653 |
SAB |
100ul |
EUR 397 |
PTPRF Antibody |
1-CSB-PA019053LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
PTPRF/LAR Antibody |
48223-100ul |
SAB |
100ul |
EUR 333 |
PTPRF/LAR Antibody |
48223-50ul |
SAB |
50ul |
EUR 239 |
Anti-PTPRF antibody |
STJ27397 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. |
Anti-PTPRF antibody |
STJ192307 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PTPRF |
PTPRF siRNA |
20-abx904376 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PTPRF siRNA |
20-abx930403 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PTPRF siRNA |
20-abx930404 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PTPRF |
YF-PA14212 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to PTPRF |
anti-PTPRF |
YF-PA24523 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to PTPRF |
PTPRF/LAR Conjugated Antibody |
C48223 |
SAB |
100ul |
EUR 397 |
PTPRF Antibody, HRP conjugated |
1-CSB-PA019053LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PTPRF Antibody, FITC conjugated |
1-CSB-PA019053LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PTPRF Antibody, Biotin conjugated |
1-CSB-PA019053LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-LAR/PTPRF Antibody |
PB9786 |
BosterBio |
100ug/vial |
EUR 334 |
PTPRF cloning plasmid |
CSB-CL019053HU1-10ug |
Cusabio |
10ug |
EUR 406 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1062
- Sequence: atggcccctgagccagccccagggaggacgatggtgccccttgtgcctgcactggtgatgcttggtttggtggcaggcgcccatggtgacagcaaacctgtcttcattaaagtccctgaggaccagactgggctgtcaggaggggtagcctccttcgtgtgccaagctacaggag
- Show more
|
Description: A cloning plasmid for the PTPRF gene. |
PTPRF cloning plasmid |
CSB-CL019053HU2-10ug |
Cusabio |
10ug |
EUR 402 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1044
- Sequence: atggcccctgagccagccccagggaggacgatggtgccccttgtgcctgcactggtgatgcttggtttggtggcaggcgcccatggtgacagcaaacctgtcttcattaaagtccctgaggaccagactgggctgtcaggaggggtagcctccttcgtgtgccaagctacaggag
- Show more
|
Description: A cloning plasmid for the PTPRF gene. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D |
Stressmarq |
0.1mg |
EUR 353 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is not conjugated. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-A390 |
Stressmarq |
0.1mg |
EUR 400 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 390. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-A488 |
Stressmarq |
0.1mg |
EUR 399 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 488. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-A565 |
Stressmarq |
0.1mg |
EUR 399 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 565. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-A594 |
Stressmarq |
0.1mg |
EUR 399 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 594. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-A633 |
Stressmarq |
0.1mg |
EUR 399 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 633. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-A655 |
Stressmarq |
0.1mg |
EUR 399 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 655. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-A680 |
Stressmarq |
0.1mg |
EUR 399 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 680. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-A700 |
Stressmarq |
0.1mg |
EUR 399 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 700. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-ALP |
Stressmarq |
0.1mg |
EUR 393 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-APC |
Stressmarq |
0.1mg |
EUR 398 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with APC. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-APCCY7 |
Stressmarq |
0.1mg |
EUR 470 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with APC/Cy7. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-BI |
Stressmarq |
0.1mg |
EUR 395 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Biotin. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-DY350 |
Stressmarq |
0.1mg |
EUR 413 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 350. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-DY405 |
Stressmarq |
0.1mg |
EUR 402 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 405. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-DY488 |
Stressmarq |
0.1mg |
EUR 392 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 488. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-DY594 |
Stressmarq |
0.1mg |
EUR 394 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 594. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-DY633 |
Stressmarq |
0.1mg |
EUR 389 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 633. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-FITC |
Stressmarq |
0.1mg |
EUR 391 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with FITC. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-HRP |
Stressmarq |
0.1mg |
EUR 387 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with HRP. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-P594 |
Stressmarq |
0.1mg |
EUR 406 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with PE/ATTO 594. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-PCP |
Stressmarq |
0.1mg |
EUR 398 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with PerCP. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-RPE |
Stressmarq |
0.1mg |
EUR 396 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with RPE. |
Monoclonal antibody for LAR/PTPRF |
SMC-443D-STR |
Stressmarq |
0.1mg |
EUR 397 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Streptavidin. |
Monoclonal antibody for LAR/PTPRF |
SMC-443S |
Stressmarq |
0.012mg |
EUR 65 |
- PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
- Show more
|
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is not conjugated. |
Protein tyrosine phosphatase receptor type F (PTPRF) polyclonal antibody |
ABP-PAB-10764 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Phosphatases
- Brand:
|
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human) |
4-PAC261Hu01 |
Cloud-Clone |
-
EUR 261.00
-
EUR 2734.00
-
EUR 676.00
-
EUR 330.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRF (Asp30~Tyr224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF) |
Rat PTPRF shRNA Plasmid |
20-abx990034 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PTPRF shRNA Plasmid |
20-abx972304 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PTPRF shRNA Plasmid |
20-abx953914 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), APC |
4-PAC261Hu01-APC |
Cloud-Clone |
-
EUR 367.00
-
EUR 3581.00
-
EUR 989.00
-
EUR 470.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRF (Asp30~Tyr224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with APC. |
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), Biotinylated |
4-PAC261Hu01-Biotin |
Cloud-Clone |
-
EUR 327.00
-
EUR 2684.00
-
EUR 783.00
-
EUR 403.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRF (Asp30~Tyr224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with Biotin. |
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), Cy3 |
4-PAC261Hu01-Cy3 |
Cloud-Clone |
-
EUR 447.00
-
EUR 4733.00
-
EUR 1277.00
-
EUR 585.00
-
EUR 263.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRF (Asp30~Tyr224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with Cy3. |
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), FITC |
4-PAC261Hu01-FITC |
Cloud-Clone |
-
EUR 313.00
-
EUR 2884.00
-
EUR 811.00
-
EUR 396.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRF (Asp30~Tyr224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with FITC. |
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), HRP |
4-PAC261Hu01-HRP |
Cloud-Clone |
-
EUR 334.00
-
EUR 3120.00
-
EUR 873.00
-
EUR 424.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRF (Asp30~Tyr224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with HRP. |
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), PE |
4-PAC261Hu01-PE |
Cloud-Clone |
-
EUR 313.00
-
EUR 2884.00
-
EUR 811.00
-
EUR 396.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRF (Asp30~Tyr224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with PE. |
PTPRF Interacting Protein Alpha 3 (PPFIA3) Antibody |
20-abx114880 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PTPRF Interacting Protein Alpha 3 (PPFIA3) Antibody |
20-abx124437 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
PTPRF Interacting Protein Alpha 3 (PPFIA3) Antibody |
abx236671-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Ptprf ORF Vector (Rat) (pORF) |
ORF074329 |
ABM |
1.0 ug DNA |
EUR 2080 |
PTPRF ORF Vector (Human) (pORF) |
ORF008410 |
ABM |
1.0 ug DNA |
EUR 95 |
PTPRF ORF Vector (Human) (pORF) |
ORF008411 |
ABM |
1.0 ug DNA |
EUR 95 |
Ptprf ORF Vector (Mouse) (pORF) |
ORF055243 |
ABM |
1.0 ug DNA |
EUR 1572 |
PTPRF ELISA Kit (Human) (OKAN05983) |
OKAN05983 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.31 ng/mL |
PTPRF ELISA Kit (Human) (OKCD08060) |
OKCD08060 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.31ng/mL |
PTPRF ELISA Kit (Rat) (OKEH05941) |
OKEH05941 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: Possible cell adhesion receptor. It possesses an intrinsic protein tyrosine phosphatase activity (PTPase) and dephosphorylates EPHA2 regulating its activity.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.783 ng/mL |
PTPRF ELISA Kit (Mouse) (OKEH04975) |
OKEH04975 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: Possible cell adhesion receptor. It possesses an intrinsic protein tyrosine phosphatase activity (PTPase) and dephosphorylates EPHA2 regulating its activity.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.782 ng/mL |
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC261Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 614.00
-
EUR 7042.00
-
EUR 1858.00
-
EUR 821.00
-
EUR 337.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRF (Asp30~Tyr224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with APC-Cy7. |
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody |
20-abx006780 |
Abbexa |
-
EUR 411.00
-
EUR 105.00
-
EUR 592.00
-
EUR 182.00
|
-
100 ul
-
10 ul
-
200 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody |
20-abx131516 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody |
20-abx334095 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody |
abx445054-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
Ptprf sgRNA CRISPR Lentivector set (Rat) |
K7232801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ptprf sgRNA CRISPR Lentivector set (Mouse) |
K3790301 |
ABM |
3 x 1.0 ug |
EUR 339 |
PTPRF sgRNA CRISPR Lentivector set (Human) |
K1757901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody (HRP) |
20-abx337450 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody (FITC) |
20-abx337451 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody (Biotin) |
20-abx337452 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ALP) |
abx442451-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (APC) |
abx442732-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (Biotin) |
abx443012-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (FITC) |
abx443292-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (HRP) |
abx443573-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (PerCP) |
abx444135-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (RPE) |
abx444416-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (Streptavidin) |
abx444697-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
PTPRF(His tagged) / LAR(His tagged)-100 |
AR09-P0002-100 |
Abfrontier |
100ug |
EUR 718 |
PTPRF(His tagged) / LAR(His tagged)-25 |
AR09-P0002-25 |
Abfrontier |
25ug |
EUR 289 |
PTPRF(His tagged) / LAR(His tagged)-50 |
AR09-P0002-50 |
Abfrontier |
50ug |
EUR 431 |
Ptprf sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7232802 |
ABM |
1.0 ug DNA |
EUR 154 |
Ptprf sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7232803 |
ABM |
1.0 ug DNA |
EUR 154 |
Ptprf sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7232804 |
ABM |
1.0 ug DNA |
EUR 154 |
Ptprf sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3790302 |
ABM |
1.0 ug DNA |
EUR 154 |
Ptprf sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3790303 |
ABM |
1.0 ug DNA |
EUR 154 |
Ptprf sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3790304 |
ABM |
1.0 ug DNA |
EUR 154 |
PTPRF sgRNA CRISPR Lentivector (Human) (Target 1) |
K1757902 |
ABM |
1.0 ug DNA |
EUR 154 |
PTPRF sgRNA CRISPR Lentivector (Human) (Target 2) |
K1757903 |
ABM |
1.0 ug DNA |
EUR 154 |
PTPRF sgRNA CRISPR Lentivector (Human) (Target 3) |
K1757904 |
ABM |
1.0 ug DNA |
EUR 154 |
PTPRF Protein Vector (Rat) (pPB-C-His) |
PV297314 |
ABM |
500 ng |
EUR 3144 |
PTPRF Protein Vector (Rat) (pPB-N-His) |
PV297315 |
ABM |
500 ng |
EUR 3144 |
PTPRF Protein Vector (Rat) (pPM-C-HA) |
PV297316 |
ABM |
500 ng |
EUR 3144 |
PTPRF Protein Vector (Rat) (pPM-C-His) |
PV297317 |
ABM |
500 ng |
EUR 3144 |
PTPRF Protein Vector (Human) (pPB-C-His) |
PV033637 |
ABM |
500 ng |
EUR 329 |
PTPRF Protein Vector (Human) (pPB-N-His) |
PV033638 |
ABM |
500 ng |
EUR 329 |
PTPRF Protein Vector (Human) (pPM-C-HA) |
PV033639 |
ABM |
500 ng |
EUR 329 |
PTPRF Protein Vector (Human) (pPM-C-His) |
PV033640 |
ABM |
500 ng |
EUR 329 |
PTPRF Protein Vector (Human) (pPB-C-His) |
PV033641 |
ABM |
500 ng |
EUR 329 |
PTPRF Protein Vector (Human) (pPB-N-His) |
PV033642 |
ABM |
500 ng |
EUR 329 |
PTPRF Protein Vector (Human) (pPM-C-HA) |
PV033643 |
ABM |
500 ng |
EUR 329 |
PTPRF Protein Vector (Human) (pPM-C-His) |
PV033644 |
ABM |
500 ng |
EUR 329 |
PTPRF Protein Vector (Mouse) (pPB-C-His) |
PV220970 |
ABM |
500 ng |
EUR 3144 |
PTPRF Protein Vector (Mouse) (pPB-N-His) |
PV220971 |
ABM |
500 ng |
EUR 3144 |
PTPRF Protein Vector (Mouse) (pPM-C-HA) |
PV220972 |
ABM |
500 ng |
EUR 3144 |
PTPRF Protein Vector (Mouse) (pPM-C-His) |
PV220973 |
ABM |
500 ng |
EUR 3144 |
Ptprf 3'UTR Luciferase Stable Cell Line |
TU117291 |
ABM |
1.0 ml |
Ask for price |
Ptprf 3'UTR GFP Stable Cell Line |
TU167291 |
ABM |
1.0 ml |
Ask for price |
Ptprf 3'UTR Luciferase Stable Cell Line |
TU217084 |
ABM |
1.0 ml |
Ask for price |
Ptprf 3'UTR GFP Stable Cell Line |
TU267084 |
ABM |
1.0 ml |
Ask for price |
PTPRF 3'UTR GFP Stable Cell Line |
TU069224 |
ABM |
1.0 ml |
EUR 1521 |
PTPRF 3'UTR Luciferase Stable Cell Line |
TU019224 |
ABM |
1.0 ml |
EUR 1521 |
PTPRF ELISA Kit (Human) : 96 Wells (OKEH01983) |
OKEH01983 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.43 ng/mL |
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 390) |
abx440203-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 488) |
abx440484-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 565) |
abx440765-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 594) |
abx441046-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 633) |
abx441327-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 655) |
abx441608-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 680) |
abx441889-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 700) |
abx442170-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4b Rabbit Polyclonal Antibody |
ABP57577-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
ATG4b Rabbit Polyclonal Antibody |
ABP57577-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
ATG4b Rabbit Polyclonal Antibody |
ABP57577-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
ATG4c Rabbit Polyclonal Antibody |
ABP57578-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4c
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c |
ATG4c Rabbit Polyclonal Antibody |
ABP57578-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4c
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c |
ATG4c Rabbit Polyclonal Antibody |
ABP57578-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG4c
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c |
ATG5 Rabbit Polyclonal Antibody |
ABP57579-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG5
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5 |
ATG5 Rabbit Polyclonal Antibody |
ABP57579-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG5
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5 |
ATG5 Rabbit Polyclonal Antibody |
ABP57579-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG5
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5 |
ATG7 Rabbit Polyclonal Antibody |
ABP57580-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG7
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7 |
ATG7 Rabbit Polyclonal Antibody |
ABP57580-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG7
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7 |
ATG7 Rabbit Polyclonal Antibody |
ABP57580-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG7
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7 |
ATG13 Rabbit Polyclonal Antibody |
ABP57581-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG13 Rabbit Polyclonal Antibody |
ABP57581-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG13 Rabbit Polyclonal Antibody |
ABP57581-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG13 Rabbit Polyclonal Antibody |
ABP57582-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG13 Rabbit Polyclonal Antibody |
ABP57582-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG13 Rabbit Polyclonal Antibody |
ABP57582-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG14L Rabbit Polyclonal Antibody |
ABP57583-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG14L
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L |
ATG14L Rabbit Polyclonal Antibody |
ABP57583-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG14L
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L |
ATG14L Rabbit Polyclonal Antibody |
ABP57583-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG14L
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L |
NBR1 Rabbit Polyclonal Antibody |
ABP57585-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NBR1
- Applications tips:
|
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1 |
PTPRF Rabbit Polyclonal Antibody