PTPRF Rabbit Polyclonal Antibody

PTPRF Polyclonal Antibody
ABP60038-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human PTPRF protein Applications tips:
Description: A polyclonal antibody for detection of PTPRF from Human, Mouse, Rat. This PTPRF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRF protein

PTPRF Polyclonal Antibody
ABP60038-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human PTPRF protein Applications tips:
Description: A polyclonal antibody for detection of PTPRF from Human, Mouse, Rat. This PTPRF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRF protein

PTPRF Polyclonal Antibody
ABP60038-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PTPRF protein Applications tips:
Description: A polyclonal antibody for detection of PTPRF from Human, Mouse, Rat. This PTPRF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRF protein

PTPRF Polyclonal Antibody
ES11149-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PTPRF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRF Polyclonal Antibody
ES11149-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PTPRF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRF Rabbit pAb
A5444-100ul	Abclonal	100 ul	EUR 308

PTPRF Rabbit pAb
A5444-200ul	Abclonal	200 ul	EUR 459

PTPRF Rabbit pAb
A5444-20ul	Abclonal	20 ul	EUR 183

PTPRF Rabbit pAb
A5444-50ul	Abclonal	50 ul	EUR 223

PTPRF Polyclonal Conjugated Antibody
C30653	SAB	100ul	EUR 397

PTPRF Antibody
1-CSB-PA019053LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PTPRF/LAR Antibody
48223-100ul	SAB	100ul	EUR 333

PTPRF/LAR Antibody
48223-50ul	SAB	50ul	EUR 239

Anti-PTPRF antibody
STJ27397	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported.

Anti-PTPRF antibody
STJ192307	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PTPRF

Ptprf/ Rat Ptprf ELISA Kit
ELI-35865r	Lifescience Market	96 Tests	EUR 886

PTPRF siRNA
20-abx904376	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PTPRF siRNA
20-abx930403	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PTPRF siRNA
20-abx930404	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-PTPRF
YF-PA14212	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to PTPRF

anti-PTPRF
YF-PA24523	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to PTPRF

PTPRF/LAR Conjugated Antibody
C48223	SAB	100ul	EUR 397

PTPRF Antibody, HRP conjugated
1-CSB-PA019053LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PTPRF Antibody, FITC conjugated
1-CSB-PA019053LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PTPRF Antibody, Biotin conjugated
1-CSB-PA019053LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-LAR/PTPRF Antibody
PB9786	BosterBio	100ug/vial	EUR 334

PTPRF cloning plasmid
CSB-CL019053HU1-10ug	Cusabio	10ug	EUR 406
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1062 Sequence: atggcccctgagccagccccagggaggacgatggtgccccttgtgcctgcactggtgatgcttggtttggtggcaggcgcccatggtgacagcaaacctgtcttcattaaagtccctgaggaccagactgggctgtcaggaggggtagcctccttcgtgtgccaagctacaggag Show more
Description: A cloning plasmid for the PTPRF gene.

PTPRF cloning plasmid
CSB-CL019053HU2-10ug	Cusabio	10ug	EUR 402
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1044 Sequence: atggcccctgagccagccccagggaggacgatggtgccccttgtgcctgcactggtgatgcttggtttggtggcaggcgcccatggtgacagcaaacctgtcttcattaaagtccctgaggaccagactgggctgtcaggaggggtagcctccttcgtgtgccaagctacaggag Show more
Description: A cloning plasmid for the PTPRF gene.

Monoclonal antibody for LAR/PTPRF
SMC-443D	Stressmarq	0.1mg	EUR 353
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is not conjugated.

Monoclonal antibody for LAR/PTPRF
SMC-443D-A390	Stressmarq	0.1mg	EUR 400
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 390.

Monoclonal antibody for LAR/PTPRF
SMC-443D-A488	Stressmarq	0.1mg	EUR 399
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 488.

Monoclonal antibody for LAR/PTPRF
SMC-443D-A565	Stressmarq	0.1mg	EUR 399
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 565.

Monoclonal antibody for LAR/PTPRF
SMC-443D-A594	Stressmarq	0.1mg	EUR 399
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 594.

Monoclonal antibody for LAR/PTPRF
SMC-443D-A633	Stressmarq	0.1mg	EUR 399
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 633.

Monoclonal antibody for LAR/PTPRF
SMC-443D-A655	Stressmarq	0.1mg	EUR 399
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 655.

Monoclonal antibody for LAR/PTPRF
SMC-443D-A680	Stressmarq	0.1mg	EUR 399
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 680.

Monoclonal antibody for LAR/PTPRF
SMC-443D-A700	Stressmarq	0.1mg	EUR 399
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 700.

Monoclonal antibody for LAR/PTPRF
SMC-443D-ALP	Stressmarq	0.1mg	EUR 393
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Alkaline Phosphatase.

Monoclonal antibody for LAR/PTPRF
SMC-443D-APC	Stressmarq	0.1mg	EUR 398
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with APC.

Monoclonal antibody for LAR/PTPRF
SMC-443D-APCCY7	Stressmarq	0.1mg	EUR 470
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with APC/Cy7.

Monoclonal antibody for LAR/PTPRF
SMC-443D-BI	Stressmarq	0.1mg	EUR 395
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Biotin.

Monoclonal antibody for LAR/PTPRF
SMC-443D-DY350	Stressmarq	0.1mg	EUR 413
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 350.

Monoclonal antibody for LAR/PTPRF
SMC-443D-DY405	Stressmarq	0.1mg	EUR 402
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 405.

Monoclonal antibody for LAR/PTPRF
SMC-443D-DY488	Stressmarq	0.1mg	EUR 392
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 488.

Monoclonal antibody for LAR/PTPRF
SMC-443D-DY594	Stressmarq	0.1mg	EUR 394
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 594.

Monoclonal antibody for LAR/PTPRF
SMC-443D-DY633	Stressmarq	0.1mg	EUR 389
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 633.

Monoclonal antibody for LAR/PTPRF
SMC-443D-FITC	Stressmarq	0.1mg	EUR 391
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with FITC.

Monoclonal antibody for LAR/PTPRF
SMC-443D-HRP	Stressmarq	0.1mg	EUR 387
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with HRP.

Monoclonal antibody for LAR/PTPRF
SMC-443D-P594	Stressmarq	0.1mg	EUR 406
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with PE/ATTO 594.

Monoclonal antibody for LAR/PTPRF
SMC-443D-PCP	Stressmarq	0.1mg	EUR 398
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with PerCP.

Monoclonal antibody for LAR/PTPRF
SMC-443D-RPE	Stressmarq	0.1mg	EUR 396
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with RPE.

Monoclonal antibody for LAR/PTPRF
SMC-443D-STR	Stressmarq	0.1mg	EUR 397
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Streptavidin.

Monoclonal antibody for LAR/PTPRF
SMC-443S	Stressmarq	0.012mg	EUR 65
PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is not conjugated.

Protein tyrosine phosphatase receptor type F (PTPRF) polyclonal antibody
ABP-PAB-10764	Allele Biotech	100 ug	Ask for price
Product line: Phosphatases Brand:

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human)
4-PAC261Hu01	Cloud-Clone	EUR 261.00 EUR 2734.00 EUR 676.00 EUR 330.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRF (Asp30~Tyr224) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF)

Human PTPRF ELISA KIT
ELI-22167h	Lifescience Market	96 Tests	EUR 824

Bovine PTPRF ELISA KIT
ELI-30529b	Lifescience Market	96 Tests	EUR 928

Human PTPRF ELISA Kit
ELA-E9599h	Lifescience Market	96 Tests	EUR 824

PTPRF ELISA KIT|Human
EF006526	Lifescience Market	96 Tests	EUR 689

Rat PTPRF shRNA Plasmid
20-abx990034	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PTPRF shRNA Plasmid
20-abx972304	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PTPRF shRNA Plasmid
20-abx953914	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Ptprf ELISA KIT
ELI-35908m	Lifescience Market	96 Tests	EUR 865

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), APC
4-PAC261Hu01-APC	Cloud-Clone	EUR 367.00 EUR 3581.00 EUR 989.00 EUR 470.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRF (Asp30~Tyr224) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with APC.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), Biotinylated
4-PAC261Hu01-Biotin	Cloud-Clone	EUR 327.00 EUR 2684.00 EUR 783.00 EUR 403.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRF (Asp30~Tyr224) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with Biotin.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), Cy3
4-PAC261Hu01-Cy3	Cloud-Clone	EUR 447.00 EUR 4733.00 EUR 1277.00 EUR 585.00 EUR 263.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRF (Asp30~Tyr224) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with Cy3.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), FITC
4-PAC261Hu01-FITC	Cloud-Clone	EUR 313.00 EUR 2884.00 EUR 811.00 EUR 396.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRF (Asp30~Tyr224) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with FITC.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), HRP
4-PAC261Hu01-HRP	Cloud-Clone	EUR 334.00 EUR 3120.00 EUR 873.00 EUR 424.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRF (Asp30~Tyr224) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with HRP.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), PE
4-PAC261Hu01-PE	Cloud-Clone	EUR 313.00 EUR 2884.00 EUR 811.00 EUR 396.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRF (Asp30~Tyr224) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with PE.

PTPRF Interacting Protein Alpha 3 (PPFIA3) Antibody
20-abx114880	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

PTPRF Interacting Protein Alpha 3 (PPFIA3) Antibody
20-abx124437	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

PTPRF Interacting Protein Alpha 3 (PPFIA3) Antibody
abx236671-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Ptprf ORF Vector (Rat) (pORF)
ORF074329	ABM	1.0 ug DNA	EUR 2080

PTPRF ORF Vector (Human) (pORF)
ORF008410	ABM	1.0 ug DNA	EUR 95

PTPRF ORF Vector (Human) (pORF)
ORF008411	ABM	1.0 ug DNA	EUR 95

Ptprf ORF Vector (Mouse) (pORF)
ORF055243	ABM	1.0 ug DNA	EUR 1572

PTPRF ELISA Kit (Human) (OKAN05983)
OKAN05983	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.31 ng/mL

PTPRF ELISA Kit (Human) (OKCD08060)
OKCD08060	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.31ng/mL

PTPRF ELISA Kit (Rat) (OKEH05941)
OKEH05941	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: Possible cell adhesion receptor. It possesses an intrinsic protein tyrosine phosphatase activity (PTPase) and dephosphorylates EPHA2 regulating its activity.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.783 ng/mL

PTPRF ELISA Kit (Mouse) (OKEH04975)
OKEH04975	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: Possible cell adhesion receptor. It possesses an intrinsic protein tyrosine phosphatase activity (PTPase) and dephosphorylates EPHA2 regulating its activity.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.782 ng/mL

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), APC-Cy7
4-PAC261Hu01-APC-Cy7	Cloud-Clone	EUR 614.00 EUR 7042.00 EUR 1858.00 EUR 821.00 EUR 337.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTPRF (Asp30~Tyr224) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with APC-Cy7.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody
20-abx006780	Abbexa	EUR 411.00 EUR 105.00 EUR 592.00 EUR 182.00	100 ul 10 ul 200 ul 50 ul
Shipped within 5-10 working days.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody
20-abx131516	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody
20-abx334095	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody
abx445054-100ug	Abbexa	100 ug	EUR 523
Shipped within 5-12 working days.

Ptprf sgRNA CRISPR Lentivector set (Rat)
K7232801	ABM	3 x 1.0 ug	EUR 339

Ptprf sgRNA CRISPR Lentivector set (Mouse)
K3790301	ABM	3 x 1.0 ug	EUR 339

PTPRF sgRNA CRISPR Lentivector set (Human)
K1757901	ABM	3 x 1.0 ug	EUR 339

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody (HRP)
20-abx337450	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody (FITC)
20-abx337451	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody (Biotin)
20-abx337452	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ALP)
abx442451-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (APC)
abx442732-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (Biotin)
abx443012-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (FITC)
abx443292-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (HRP)
abx443573-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (PerCP)
abx444135-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (RPE)
abx444416-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (Streptavidin)
abx444697-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

PTPRF(His tagged) / LAR(His tagged)-100
AR09-P0002-100	Abfrontier	100ug	EUR 718

PTPRF(His tagged) / LAR(His tagged)-25
AR09-P0002-25	Abfrontier	25ug	EUR 289

PTPRF(His tagged) / LAR(His tagged)-50
AR09-P0002-50	Abfrontier	50ug	EUR 431

Ptprf sgRNA CRISPR Lentivector (Rat) (Target 1)
K7232802	ABM	1.0 ug DNA	EUR 154

Ptprf sgRNA CRISPR Lentivector (Rat) (Target 2)
K7232803	ABM	1.0 ug DNA	EUR 154

Ptprf sgRNA CRISPR Lentivector (Rat) (Target 3)
K7232804	ABM	1.0 ug DNA	EUR 154

Ptprf sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3790302	ABM	1.0 ug DNA	EUR 154

Ptprf sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3790303	ABM	1.0 ug DNA	EUR 154

Ptprf sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3790304	ABM	1.0 ug DNA	EUR 154

PTPRF sgRNA CRISPR Lentivector (Human) (Target 1)
K1757902	ABM	1.0 ug DNA	EUR 154

PTPRF sgRNA CRISPR Lentivector (Human) (Target 2)
K1757903	ABM	1.0 ug DNA	EUR 154

PTPRF sgRNA CRISPR Lentivector (Human) (Target 3)
K1757904	ABM	1.0 ug DNA	EUR 154

PTPRF Protein Vector (Rat) (pPB-C-His)
PV297314	ABM	500 ng	EUR 3144

PTPRF Protein Vector (Rat) (pPB-N-His)
PV297315	ABM	500 ng	EUR 3144

PTPRF Protein Vector (Rat) (pPM-C-HA)
PV297316	ABM	500 ng	EUR 3144

PTPRF Protein Vector (Rat) (pPM-C-His)
PV297317	ABM	500 ng	EUR 3144

PTPRF Protein Vector (Human) (pPB-C-His)
PV033637	ABM	500 ng	EUR 329

PTPRF Protein Vector (Human) (pPB-N-His)
PV033638	ABM	500 ng	EUR 329

PTPRF Protein Vector (Human) (pPM-C-HA)
PV033639	ABM	500 ng	EUR 329

PTPRF Protein Vector (Human) (pPM-C-His)
PV033640	ABM	500 ng	EUR 329

PTPRF Protein Vector (Human) (pPB-C-His)
PV033641	ABM	500 ng	EUR 329

PTPRF Protein Vector (Human) (pPB-N-His)
PV033642	ABM	500 ng	EUR 329

PTPRF Protein Vector (Human) (pPM-C-HA)
PV033643	ABM	500 ng	EUR 329

PTPRF Protein Vector (Human) (pPM-C-His)
PV033644	ABM	500 ng	EUR 329

PTPRF Protein Vector (Mouse) (pPB-C-His)
PV220970	ABM	500 ng	EUR 3144

PTPRF Protein Vector (Mouse) (pPB-N-His)
PV220971	ABM	500 ng	EUR 3144

PTPRF Protein Vector (Mouse) (pPM-C-HA)
PV220972	ABM	500 ng	EUR 3144

PTPRF Protein Vector (Mouse) (pPM-C-His)
PV220973	ABM	500 ng	EUR 3144

Ptprf 3'UTR Luciferase Stable Cell Line
TU117291	ABM	1.0 ml	Ask for price

Ptprf 3'UTR GFP Stable Cell Line
TU167291	ABM	1.0 ml	Ask for price

Ptprf 3'UTR Luciferase Stable Cell Line
TU217084	ABM	1.0 ml	Ask for price

Ptprf 3'UTR GFP Stable Cell Line
TU267084	ABM	1.0 ml	Ask for price

PTPRF 3'UTR GFP Stable Cell Line
TU069224	ABM	1.0 ml	EUR 1521

PTPRF 3'UTR Luciferase Stable Cell Line
TU019224	ABM	1.0 ml	EUR 1521

PTPRF ELISA Kit (Human) : 96 Wells (OKEH01983)
OKEH01983	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.43 ng/mL

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 390)
abx440203-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 488)
abx440484-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 565)
abx440765-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 594)
abx441046-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 633)
abx441327-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 655)
abx441608-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 680)
abx441889-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 700)
abx442170-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody
ABP57577-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4c Rabbit Polyclonal Antibody
ABP57578-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG5 Rabbit Polyclonal Antibody
ABP57579-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG7 Rabbit Polyclonal Antibody
ABP57580-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG13 Rabbit Polyclonal Antibody
ABP57581-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG14L Rabbit Polyclonal Antibody
ABP57583-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody
ABP57583-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody
ABP57583-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

NBR1 Rabbit Polyclonal Antibody
ABP57585-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

PTPRF Rabbit Polyclonal Antibody