CelltaGen
셀타젠 Genetic Genotyping

PTPRF Rabbit Polyclonal Antibody

PTPRF Polyclonal Antibody

ABP60038-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PTPRF protein
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRF from Human, Mouse, Rat. This PTPRF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRF protein

PTPRF Polyclonal Antibody

ABP60038-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PTPRF protein
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRF from Human, Mouse, Rat. This PTPRF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRF protein

PTPRF Polyclonal Antibody

ABP60038-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PTPRF protein
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRF from Human, Mouse, Rat. This PTPRF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRF protein

PTPRF Polyclonal Antibody

ES11149-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PTPRF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRF Polyclonal Antibody

ES11149-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PTPRF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRF Rabbit pAb

A5444-100ul 100 ul
EUR 308

PTPRF Rabbit pAb

A5444-200ul 200 ul
EUR 459

PTPRF Rabbit pAb

A5444-20ul 20 ul
EUR 183

PTPRF Rabbit pAb

A5444-50ul 50 ul
EUR 223

PTPRF Polyclonal Conjugated Antibody

C30653 100ul
EUR 397

PTPRF Antibody

1-CSB-PA019053LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PTPRF/LAR Antibody

48223-100ul 100ul
EUR 333

PTPRF/LAR Antibody

48223-50ul 50ul
EUR 239

Anti-PTPRF antibody

STJ27397 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported.

Anti-PTPRF antibody

STJ192307 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTPRF

Ptprf/ Rat Ptprf ELISA Kit

ELI-35865r 96 Tests
EUR 886

PTPRF siRNA

20-abx904376
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPRF siRNA

20-abx930403
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPRF siRNA

20-abx930404
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PTPRF

YF-PA14212 50 ug
EUR 363
Description: Mouse polyclonal to PTPRF

anti-PTPRF

YF-PA24523 50 ul
EUR 334
Description: Mouse polyclonal to PTPRF

PTPRF/LAR Conjugated Antibody

C48223 100ul
EUR 397

PTPRF Antibody, HRP conjugated

1-CSB-PA019053LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PTPRF Antibody, FITC conjugated

1-CSB-PA019053LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PTPRF Antibody, Biotin conjugated

1-CSB-PA019053LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-LAR/PTPRF Antibody

PB9786 100ug/vial
EUR 334

PTPRF cloning plasmid

CSB-CL019053HU1-10ug 10ug
EUR 406
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1062
  • Sequence: atggcccctgagccagccccagggaggacgatggtgccccttgtgcctgcactggtgatgcttggtttggtggcaggcgcccatggtgacagcaaacctgtcttcattaaagtccctgaggaccagactgggctgtcaggaggggtagcctccttcgtgtgccaagctacaggag
  • Show more
Description: A cloning plasmid for the PTPRF gene.

PTPRF cloning plasmid

CSB-CL019053HU2-10ug 10ug
EUR 402
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1044
  • Sequence: atggcccctgagccagccccagggaggacgatggtgccccttgtgcctgcactggtgatgcttggtttggtggcaggcgcccatggtgacagcaaacctgtcttcattaaagtccctgaggaccagactgggctgtcaggaggggtagcctccttcgtgtgccaagctacaggag
  • Show more
Description: A cloning plasmid for the PTPRF gene.

Monoclonal antibody for LAR/PTPRF

SMC-443D 0.1mg
EUR 353
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is not conjugated.

Monoclonal antibody for LAR/PTPRF

SMC-443D-A390 0.1mg
EUR 400
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 390.

Monoclonal antibody for LAR/PTPRF

SMC-443D-A488 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 488.

Monoclonal antibody for LAR/PTPRF

SMC-443D-A565 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 565.

Monoclonal antibody for LAR/PTPRF

SMC-443D-A594 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 594.

Monoclonal antibody for LAR/PTPRF

SMC-443D-A633 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 633.

Monoclonal antibody for LAR/PTPRF

SMC-443D-A655 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 655.

Monoclonal antibody for LAR/PTPRF

SMC-443D-A680 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 680.

Monoclonal antibody for LAR/PTPRF

SMC-443D-A700 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 700.

Monoclonal antibody for LAR/PTPRF

SMC-443D-ALP 0.1mg
EUR 393
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Alkaline Phosphatase.

Monoclonal antibody for LAR/PTPRF

SMC-443D-APC 0.1mg
EUR 398
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with APC.

Monoclonal antibody for LAR/PTPRF

SMC-443D-APCCY7 0.1mg
EUR 470
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with APC/Cy7.

Monoclonal antibody for LAR/PTPRF

SMC-443D-BI 0.1mg
EUR 395
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Biotin.

Monoclonal antibody for LAR/PTPRF

SMC-443D-DY350 0.1mg
EUR 413
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 350.

Monoclonal antibody for LAR/PTPRF

SMC-443D-DY405 0.1mg
EUR 402
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 405.

Monoclonal antibody for LAR/PTPRF

SMC-443D-DY488 0.1mg
EUR 392
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 488.

Monoclonal antibody for LAR/PTPRF

SMC-443D-DY594 0.1mg
EUR 394
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 594.

Monoclonal antibody for LAR/PTPRF

SMC-443D-DY633 0.1mg
EUR 389
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 633.

Monoclonal antibody for LAR/PTPRF

SMC-443D-FITC 0.1mg
EUR 391
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with FITC.

Monoclonal antibody for LAR/PTPRF

SMC-443D-HRP 0.1mg
EUR 387
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with HRP.

Monoclonal antibody for LAR/PTPRF

SMC-443D-P594 0.1mg
EUR 406
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with PE/ATTO 594.

Monoclonal antibody for LAR/PTPRF

SMC-443D-PCP 0.1mg
EUR 398
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with PerCP.

Monoclonal antibody for LAR/PTPRF

SMC-443D-RPE 0.1mg
EUR 396
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with RPE.

Monoclonal antibody for LAR/PTPRF

SMC-443D-STR 0.1mg
EUR 397
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Streptavidin.

Monoclonal antibody for LAR/PTPRF

SMC-443S 0.012mg
EUR 65
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is not conjugated.

Protein tyrosine phosphatase receptor type F (PTPRF) polyclonal antibody

ABP-PAB-10764 100 ug Ask for price
    • Product line: Phosphatases
    • Brand:

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human)

4-PAC261Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF)

Human PTPRF ELISA KIT

ELI-22167h 96 Tests
EUR 824

Bovine PTPRF ELISA KIT

ELI-30529b 96 Tests
EUR 928

Human PTPRF ELISA Kit

ELA-E9599h 96 Tests
EUR 824

PTPRF ELISA KIT|Human

EF006526 96 Tests
EUR 689

Rat PTPRF shRNA Plasmid

20-abx990034
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PTPRF shRNA Plasmid

20-abx972304
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PTPRF shRNA Plasmid

20-abx953914
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Ptprf ELISA KIT

ELI-35908m 96 Tests
EUR 865

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), APC

4-PAC261Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with APC.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), Biotinylated

4-PAC261Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with Biotin.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), Cy3

4-PAC261Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with Cy3.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), FITC

4-PAC261Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with FITC.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), HRP

4-PAC261Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with HRP.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), PE

4-PAC261Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with PE.

PTPRF Interacting Protein Alpha 3 (PPFIA3) Antibody

20-abx114880
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

PTPRF Interacting Protein Alpha 3 (PPFIA3) Antibody

20-abx124437
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

PTPRF Interacting Protein Alpha 3 (PPFIA3) Antibody

abx236671-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Ptprf ORF Vector (Rat) (pORF)

ORF074329 1.0 ug DNA
EUR 2080

PTPRF ORF Vector (Human) (pORF)

ORF008410 1.0 ug DNA
EUR 95

PTPRF ORF Vector (Human) (pORF)

ORF008411 1.0 ug DNA
EUR 95

Ptprf ORF Vector (Mouse) (pORF)

ORF055243 1.0 ug DNA
EUR 1572

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), APC-Cy7

4-PAC261Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with APC-Cy7.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody

20-abx006780
  • EUR 411.00
  • EUR 105.00
  • EUR 592.00
  • EUR 182.00
  • 100 ul
  • 10 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody

20-abx131516
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody

20-abx334095
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody

abx445054-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Ptprf sgRNA CRISPR Lentivector set (Rat)

K7232801 3 x 1.0 ug
EUR 339

Ptprf sgRNA CRISPR Lentivector set (Mouse)

K3790301 3 x 1.0 ug
EUR 339

PTPRF sgRNA CRISPR Lentivector set (Human)

K1757901 3 x 1.0 ug
EUR 339

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody (HRP)

20-abx337450
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody (FITC)

20-abx337451
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Antibody (Biotin)

20-abx337452
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ALP)

abx442451-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (APC)

abx442732-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (Biotin)

abx443012-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (FITC)

abx443292-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (HRP)

abx443573-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (PerCP)

abx444135-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (RPE)

abx444416-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (Streptavidin)

abx444697-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

PTPRF(His tagged) / LAR(His tagged)-100

AR09-P0002-100 100ug
EUR 718

PTPRF(His tagged) / LAR(His tagged)-25

AR09-P0002-25 25ug
EUR 289

PTPRF(His tagged) / LAR(His tagged)-50

AR09-P0002-50 50ug
EUR 431

Ptprf sgRNA CRISPR Lentivector (Rat) (Target 1)

K7232802 1.0 ug DNA
EUR 154

Ptprf sgRNA CRISPR Lentivector (Rat) (Target 2)

K7232803 1.0 ug DNA
EUR 154

Ptprf sgRNA CRISPR Lentivector (Rat) (Target 3)

K7232804 1.0 ug DNA
EUR 154

Ptprf sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3790302 1.0 ug DNA
EUR 154

Ptprf sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3790303 1.0 ug DNA
EUR 154

Ptprf sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3790304 1.0 ug DNA
EUR 154

PTPRF sgRNA CRISPR Lentivector (Human) (Target 1)

K1757902 1.0 ug DNA
EUR 154

PTPRF sgRNA CRISPR Lentivector (Human) (Target 2)

K1757903 1.0 ug DNA
EUR 154

PTPRF sgRNA CRISPR Lentivector (Human) (Target 3)

K1757904 1.0 ug DNA
EUR 154

PTPRF Protein Vector (Rat) (pPB-C-His)

PV297314 500 ng
EUR 3144

PTPRF Protein Vector (Rat) (pPB-N-His)

PV297315 500 ng
EUR 3144

PTPRF Protein Vector (Rat) (pPM-C-HA)

PV297316 500 ng
EUR 3144

PTPRF Protein Vector (Rat) (pPM-C-His)

PV297317 500 ng
EUR 3144

PTPRF Protein Vector (Human) (pPB-C-His)

PV033637 500 ng
EUR 329

PTPRF Protein Vector (Human) (pPB-N-His)

PV033638 500 ng
EUR 329

PTPRF Protein Vector (Human) (pPM-C-HA)

PV033639 500 ng
EUR 329

PTPRF Protein Vector (Human) (pPM-C-His)

PV033640 500 ng
EUR 329

PTPRF Protein Vector (Human) (pPB-C-His)

PV033641 500 ng
EUR 329

PTPRF Protein Vector (Human) (pPB-N-His)

PV033642 500 ng
EUR 329

PTPRF Protein Vector (Human) (pPM-C-HA)

PV033643 500 ng
EUR 329

PTPRF Protein Vector (Human) (pPM-C-His)

PV033644 500 ng
EUR 329

PTPRF Protein Vector (Mouse) (pPB-C-His)

PV220970 500 ng
EUR 3144

PTPRF Protein Vector (Mouse) (pPB-N-His)

PV220971 500 ng
EUR 3144

PTPRF Protein Vector (Mouse) (pPM-C-HA)

PV220972 500 ng
EUR 3144

PTPRF Protein Vector (Mouse) (pPM-C-His)

PV220973 500 ng
EUR 3144

Ptprf 3'UTR Luciferase Stable Cell Line

TU117291 1.0 ml Ask for price

Ptprf 3'UTR GFP Stable Cell Line

TU167291 1.0 ml Ask for price

Ptprf 3'UTR Luciferase Stable Cell Line

TU217084 1.0 ml Ask for price

Ptprf 3'UTR GFP Stable Cell Line

TU267084 1.0 ml Ask for price

PTPRF 3'UTR GFP Stable Cell Line

TU069224 1.0 ml
EUR 1521

PTPRF 3'UTR Luciferase Stable Cell Line

TU019224 1.0 ml
EUR 1521

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 390)

abx440203-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 488)

abx440484-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 565)

abx440765-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 594)

abx441046-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 633)

abx441327-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 655)

abx441608-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 680)

abx441889-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor-Type Tyrosine-Protein Phosphatase F (PTPRF) Antibody (ATTO 700)

abx442170-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody

ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody

ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody

ABP57575-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody

ABP57575-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody

ABP57575-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody

ABP57576-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody

ABP57576-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody

ABP57576-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody

ABP57577-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody

ABP57577-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody

ABP57577-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4c Rabbit Polyclonal Antibody

ABP57578-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody

ABP57578-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody

ABP57578-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG5 Rabbit Polyclonal Antibody

ABP57579-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody

ABP57579-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody

ABP57579-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG7 Rabbit Polyclonal Antibody

ABP57580-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody

ABP57580-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody

ABP57580-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG13 Rabbit Polyclonal Antibody

ABP57581-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody

ABP57581-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody

ABP57581-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody

ABP57582-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody

ABP57582-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody

ABP57582-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG14L Rabbit Polyclonal Antibody

ABP57583-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG14L
  • Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody

ABP57583-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG14L
  • Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody

ABP57583-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG14L
  • Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

NBR1 Rabbit Polyclonal Antibody

ABP57585-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody

ABP57585-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody

ABP57585-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody

ABP57586-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody

ABP57586-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody

ABP57586-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

PTPRF Rabbit Polyclonal Antibody