CelltaGen
셀타젠 Genetic Genotyping

PZP Rabbit Polyclonal Antibody

PZP Polyclonal Antibody

A53244 100 µg
EUR 570.55
Description: fast delivery possible

PZP Polyclonal Antibody

30444-100ul 100ul
EUR 252

PZP Polyclonal Antibody

30444-50ul 50ul
EUR 187

Human Pregnancy Zone Protein (PZP) ELISA Kit

DLR-PZP-Hu-48T 48T
EUR 517
  • Should the Human Pregnancy Zone Protein (PZP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Pregnancy Zone Protein (PZP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Pregnancy Zone Protein (PZP) ELISA Kit

DLR-PZP-Hu-96T 96T
EUR 673
  • Should the Human Pregnancy Zone Protein (PZP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Pregnancy Zone Protein (PZP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Pregnancy Zone Protein (PZP) ELISA Kit

RD-PZP-Hu-48Tests 48 Tests
EUR 521

Human Pregnancy Zone Protein (PZP) ELISA Kit

RD-PZP-Hu-96Tests 96 Tests
EUR 723

Human Pregnancy Zone Protein (PZP) ELISA Kit

RDR-PZP-Hu-48Tests 48 Tests
EUR 544

Human Pregnancy Zone Protein (PZP) ELISA Kit

RDR-PZP-Hu-96Tests 96 Tests
EUR 756

PZP Rabbit pAb

A3324-100ul 100 ul
EUR 308

PZP Rabbit pAb

A3324-200ul 200 ul
EUR 459

PZP Rabbit pAb

A3324-20ul 20 ul
EUR 183

PZP Rabbit pAb

A3324-50ul 50 ul
EUR 223

PZP Polyclonal Conjugated Antibody

C30444 100ul
EUR 397

PZP antibody

70R-19675 50 ul
EUR 435
Description: Rabbit polyclonal PZP antibody

PZP Antibody

1-CSB-PA019131GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PZP Antibody

1-CSB-PA019131HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is Unconjugated. Tested in the following application: ELISA

PZP Polyclonal Antibody, Biotin Conjugated

A53241 100 µg
EUR 570.55
Description: kits suitable for this type of research

PZP Polyclonal Antibody, FITC Conjugated

A53242 100 µg
EUR 570.55
Description: fast delivery possible

PZP Polyclonal Antibody, HRP Conjugated

A53243 100 µg
EUR 570.55
Description: reagents widely cited

Anti-PZP antibody

STJ116200 100 µl
EUR 277
Description: The protein encoded by this gene is highly expressed in late-pregnancy serum and is similar in structure to alpha-2-macroglobulin. The encoded protein, which acts as a homotetramer, inhibits the activity of all four classes of proteinases. This protein contains cleavage sites for several proteinases. Upon binding of a proteinase, the conformation of this protein changes to trap the proteinase, limiting its activity. This protein appears to be elevated in the sera of presymptomatic Alzheimer's disease patients.

Anti-PZP antibody

STJ192551 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PZP

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human)

4-PAG324Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Val1212~Met1391)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP)

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse)

4-PAG324Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Tyr1224~Ala1495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP)

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse)

4-PAG324Mu02
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1246~Ala1495)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP)

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat)

4-PAG324Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1251~Ala1500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP)

PZP Antibody, HRP conjugated

1-CSB-PA019131HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PZP Antibody, FITC conjugated

1-CSB-PA019131HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PZP Antibody, Biotin conjugated

1-CSB-PA019131HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), APC

4-PAG324Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Val1212~Met1391)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with APC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), Biotinylated

4-PAG324Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Val1212~Met1391)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), Cy3

4-PAG324Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Val1212~Met1391)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), FITC

4-PAG324Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Val1212~Met1391)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with FITC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), HRP

4-PAG324Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Val1212~Met1391)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with HRP.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), PE

4-PAG324Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Val1212~Met1391)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with PE.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC

4-PAG324Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Tyr1224~Ala1495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Biotinylated

4-PAG324Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Tyr1224~Ala1495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Cy3

4-PAG324Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Tyr1224~Ala1495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), FITC

4-PAG324Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Tyr1224~Ala1495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with FITC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), HRP

4-PAG324Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Tyr1224~Ala1495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with HRP.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), PE

4-PAG324Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Tyr1224~Ala1495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with PE.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC

4-PAG324Mu02-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1246~Ala1495)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Biotinylated

4-PAG324Mu02-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1246~Ala1495)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Cy3

4-PAG324Mu02-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1246~Ala1495)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), FITC

4-PAG324Mu02-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1246~Ala1495)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with FITC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), HRP

4-PAG324Mu02-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1246~Ala1495)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with HRP.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), PE

4-PAG324Mu02-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1246~Ala1495)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with PE.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), APC

4-PAG324Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1251~Ala1500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with APC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), Biotinylated

4-PAG324Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1251~Ala1500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), Cy3

4-PAG324Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1251~Ala1500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), FITC

4-PAG324Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1251~Ala1500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with FITC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), HRP

4-PAG324Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1251~Ala1500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with HRP.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), PE

4-PAG324Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1251~Ala1500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with PE.

PZP cloning plasmid

CSB-CL019131HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3807
  • Sequence: ATGTCTGAATCTTATCGGAGAACTACTTTTCCAGTAAGATTCCGTGTTGTCTCCGTGGATGAAAATTTTCGCCCTCGAAATGAACTGATTCCACTGATATACCTTGAGAACCCAAGAAGAAATCGAATTGCACAATGGCAGAGTCTCAAGCTAGAAGCTGGCATCAATCAGTTGT
  • Show more
Description: A cloning plasmid for the PZP gene.

Pregnancy Zone Protein (PZP) Antibody

20-abx129879
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pregnancy Zone Protein (PZP) Antibody

20-abx002369
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pregnancy Zone Protein (PZP) Antibody

20-abx102180
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pregnancy Zone Protein (PZP) Antibody

20-abx102181
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pregnancy Zone Protein (PZP) Antibody

20-abx102182
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pregnancy Zone Protein (PZP) Antibody

20-abx174149
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), APC-Cy7

4-PAG324Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Val1212~Met1391)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC-Cy7

4-PAG324Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Tyr1224~Ala1495)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC-Cy7

4-PAG324Mu02-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1246~Ala1495)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), APC-Cy7

4-PAG324Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PZP (Leu1251~Ala1500)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7.

Pregnancy Zone Protein (PZP) Antibody (HRP)

20-abx274625
  • EUR 509.00
  • EUR 258.00
  • EUR 1525.00
  • EUR 704.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pregnancy Zone Protein (PZP) Antibody Pair

20-abx370759
  • EUR 1859.00
  • EUR 1177.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody Pair

20-abx370771
  • EUR 1776.00
  • EUR 1135.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody (FITC)

20-abx271207
  • EUR 509.00
  • EUR 258.00
  • EUR 1525.00
  • EUR 704.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody (FITC)

20-abx271260
  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody (Biotin)

20-abx271473
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody (Biotin)

20-abx271526
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody (Biotin)

20-abx272390
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human PZP ELISA Kit

ELA-E1140h 96 Tests
EUR 824

PZP ELISA KIT|Human

EF003623 96 Tests
EUR 689

Human PZP PicoKine ELISA Kit

EK1873 96 wells
EUR 425
Description: For quantitative detection of human PZP in cell culture supernates, serum and plasma (heparin, EDTA).

Human Pregnancy zone protein (PZP)

1-CSB-YP019131HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 65.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Pregnancy zone protein(PZP),partial expressed in Yeast

Human Pregnancy zone protein (PZP)

1-CSB-EP019131HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 42.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Pregnancy zone protein(PZP),partial expressed in E.coli

Pzp ORF Vector (Rat) (pORF)

ORF074390 1.0 ug DNA
EUR 2080

PZP ORF Vector (Human) (pORF)

ORF014217 1.0 ug DNA
EUR 354

Pzp ORF Vector (Mouse) (pORF)

ORF055356 1.0 ug DNA
EUR 1572

Recombinant Pregnancy Zone Protein (PZP)

4-RPG324Hu01
  • EUR 583.84
  • EUR 259.00
  • EUR 1914.40
  • EUR 704.80
  • EUR 1309.60
  • EUR 454.00
  • EUR 4636.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20742
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.1kDa
  • Isoelectric Point: 6.3
Description: Recombinant Human Pregnancy Zone Protein expressed in: E.coli

Recombinant Pregnancy Zone Protein (PZP)

4-RPG324Mu01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q61838
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 56.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Pregnancy Zone Protein expressed in: E.coli

Recombinant Pregnancy Zone Protein (PZP)

4-RPG324Mu02
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q61838
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Pregnancy Zone Protein expressed in: E.coli

Recombinant Pregnancy Zone Protein (PZP)

4-RPG324Ra01
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q63041
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 53.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Pregnancy Zone Protein expressed in: E.coli

Human Pregnancy Zone Protein (PZP) Protein

20-abx068659
  • EUR 815.00
  • EUR 314.00
  • EUR 2569.00
  • EUR 968.00
  • EUR 565.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Pregnancy Zone Protein (PZP) Protein

20-abx068660
  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Pregnancy Zone Protein (PZP) Protein

20-abx068661
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Pregnancy Zone Protein (PZP) Protein

20-abx165942
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

PZP sgRNA CRISPR Lentivector set (Human)

K1765801 3 x 1.0 ug
EUR 339

Pzp sgRNA CRISPR Lentivector set (Mouse)

K3715701 3 x 1.0 ug
EUR 339

Pzp sgRNA CRISPR Lentivector set (Rat)

K7332401 3 x 1.0 ug
EUR 339

Mouse Pregnancy Zone Protein (PZP) CLIA Kit

20-abx496457
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Pregnancy Zone Protein (PZP) CLIA Kit

20-abx496528
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Pregnancy zone protein (PZP) ELISA Kit

abx576051-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human PZP/ Pregnancy zone protein ELISA Kit

E2110Hu 1 Kit
EUR 571

Human PZP(Pregnancy zone protein) ELISA Kit

EH1299 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P20742
  • Alias: PZP/CPAMD6(Pregnancy zone protein)/C3 and PZP-like alpha-2-macroglobulin domain-containing protein 6/pregnancy-zone protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human Pregnancy zone protein, PZP ELISA KIT

ELI-03752h 96 Tests
EUR 824

Human Pregnancy Zone Protein (PZP) ELISA Kit

20-abx152906
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Pregnancy Zone Protein (PZP) ELISA Kit

20-abx258971
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Pregnancy Zone Protein (PZP) ELISA Kit

20-abx258972
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Pregnancy Zone Protein (PZP) CLIA Kit

20-abx495159
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

PZP sgRNA CRISPR Lentivector (Human) (Target 1)

K1765802 1.0 ug DNA
EUR 154

PZP sgRNA CRISPR Lentivector (Human) (Target 2)

K1765803 1.0 ug DNA
EUR 154

PZP sgRNA CRISPR Lentivector (Human) (Target 3)

K1765804 1.0 ug DNA
EUR 154

Pzp sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3715702 1.0 ug DNA
EUR 154

Pzp sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3715703 1.0 ug DNA
EUR 154

Pzp sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3715704 1.0 ug DNA
EUR 154

Human Pregnancy zone protein(PZP) ELISA kit

CSB-EL019131HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human Pregnancy zone protein (PZP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Pregnancy zone protein(PZP) ELISA kit

1-CSB-EL019131HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human Pregnancy zone protein(PZP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pzp sgRNA CRISPR Lentivector (Rat) (Target 1)

K7332402 1.0 ug DNA
EUR 154

Pzp sgRNA CRISPR Lentivector (Rat) (Target 2)

K7332403 1.0 ug DNA
EUR 154

Pzp sgRNA CRISPR Lentivector (Rat) (Target 3)

K7332404 1.0 ug DNA
EUR 154

PZP Protein Vector (Human) (pPB-C-His)

PV056865 500 ng
EUR 481

PZP Protein Vector (Human) (pPB-N-His)

PV056866 500 ng
EUR 481

PZP Protein Vector (Human) (pPM-C-HA)

PV056867 500 ng
EUR 481

PZP Protein Vector (Human) (pPM-C-His)

PV056868 500 ng
EUR 481

Human Pregnancy Zone Protein ELISA Kit (PZP)

RK02175 96 Tests
EUR 521

Mouse Pregnancy Zone Protein ELISA Kit (PZP)

RK03150 96 Tests
EUR 521

Human Pregnancy Zone Protein(PZP)ELISA Kit

QY-E01765 96T
EUR 361

PZP Protein Vector (Rat) (pPB-C-His)

PV297558 500 ng
EUR 2538

PZP Protein Vector (Rat) (pPB-N-His)

PV297559 500 ng
EUR 2538

PZP Protein Vector (Rat) (pPM-C-HA)

PV297560 500 ng
EUR 2538

PZP Protein Vector (Rat) (pPM-C-His)

PV297561 500 ng
EUR 2538

PZP Protein Vector (Mouse) (pPB-C-His)

PV221422 500 ng
EUR 2530

PZP Protein Vector (Mouse) (pPB-N-His)

PV221423 500 ng
EUR 2530

PZP Protein Vector (Mouse) (pPM-C-HA)

PV221424 500 ng
EUR 2530

PZP Protein Vector (Mouse) (pPM-C-His)

PV221425 500 ng
EUR 2530

Pzp 3'UTR GFP Stable Cell Line

TU167359 1.0 ml Ask for price

Human Pregnancy Zone Protein (PZP) ELISA Kit

SEG324Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.

PZP Rabbit Polyclonal Antibody