PZP Rabbit Polyclonal Antibody

PZP Rabbit Polyclonal Antibody

PZP Polyclonal Antibody
ABP60051-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350 Applications tips:
Description: A polyclonal antibody for detection of PZP from Human. This PZP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350

PZP Polyclonal Antibody
ES11393-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PZP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PZP Polyclonal Antibody
ES11393-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PZP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Pregnancy Zone Protein (PZP) ELISA Kit
DLR-PZP-Hu-48T	DL Develop	48T	EUR 517
Should the Human Pregnancy Zone Protein (PZP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Pregnancy Zone Protein (PZP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Pregnancy Zone Protein (PZP) ELISA Kit
DLR-PZP-Hu-96T	DL Develop	96T	EUR 673
Should the Human Pregnancy Zone Protein (PZP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Pregnancy Zone Protein (PZP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Pregnancy Zone Protein (PZP) ELISA Kit
RDR-PZP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Pregnancy Zone Protein (PZP) ELISA Kit
RDR-PZP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Pregnancy Zone Protein (PZP) ELISA Kit
RD-PZP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Pregnancy Zone Protein (PZP) ELISA Kit
RD-PZP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

PZP Rabbit pAb
A3324-100ul	Abclonal	100 ul	EUR 308

PZP Rabbit pAb
A3324-200ul	Abclonal	200 ul	EUR 459

PZP Rabbit pAb
A3324-20ul	Abclonal	20 ul	EUR 183

PZP Rabbit pAb
A3324-50ul	Abclonal	50 ul	EUR 223

PZP Polyclonal Conjugated Antibody
C30444	SAB	100ul	EUR 397

PZP antibody
70R-19675	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PZP antibody

PZP Antibody
1-CSB-PA019131GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PZP Antibody
1-CSB-PA019131HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is Unconjugated. Tested in the following application: ELISA

PZP Polyclonal Antibody, Biotin Conjugated
A53241	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

PZP Polyclonal Antibody, FITC Conjugated
A53242	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

PZP Polyclonal Antibody, HRP Conjugated
A53243	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Anti-PZP antibody
STJ116200	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is highly expressed in late-pregnancy serum and is similar in structure to alpha-2-macroglobulin. The encoded protein, which acts as a homotetramer, inhibits the activity of all four classes of proteinases. This protein contains cleavage sites for several proteinases. Upon binding of a proteinase, the conformation of this protein changes to trap the proteinase, limiting its activity. This protein appears to be elevated in the sera of presymptomatic Alzheimer's disease patients.

Anti-PZP antibody
STJ192551	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PZP

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human)
4-PAG324Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Val1212~Met1391) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP)

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse)
4-PAG324Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Tyr1224~Ala1495) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP)

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse)
4-PAG324Mu02	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1246~Ala1495) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP)

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat)
4-PAG324Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1251~Ala1500) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP)

PZP Antibody, HRP conjugated
1-CSB-PA019131HB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PZP Antibody, FITC conjugated
1-CSB-PA019131HC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PZP Antibody, Biotin conjugated
1-CSB-PA019131HD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), APC
4-PAG324Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Val1212~Met1391) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with APC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), Biotinylated
4-PAG324Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Val1212~Met1391) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), Cy3
4-PAG324Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Val1212~Met1391) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), FITC
4-PAG324Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Val1212~Met1391) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with FITC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), HRP
4-PAG324Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Val1212~Met1391) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with HRP.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), PE
4-PAG324Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Val1212~Met1391) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with PE.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC
4-PAG324Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Tyr1224~Ala1495) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Biotinylated
4-PAG324Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Tyr1224~Ala1495) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Cy3
4-PAG324Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Tyr1224~Ala1495) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), FITC
4-PAG324Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Tyr1224~Ala1495) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with FITC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), HRP
4-PAG324Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Tyr1224~Ala1495) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with HRP.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), PE
4-PAG324Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Tyr1224~Ala1495) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with PE.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC
4-PAG324Mu02-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1246~Ala1495) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Biotinylated
4-PAG324Mu02-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1246~Ala1495) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Cy3
4-PAG324Mu02-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1246~Ala1495) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), FITC
4-PAG324Mu02-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1246~Ala1495) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with FITC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), HRP
4-PAG324Mu02-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1246~Ala1495) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with HRP.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), PE
4-PAG324Mu02-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1246~Ala1495) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with PE.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), APC
4-PAG324Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1251~Ala1500) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with APC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), Biotinylated
4-PAG324Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1251~Ala1500) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), Cy3
4-PAG324Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1251~Ala1500) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), FITC
4-PAG324Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1251~Ala1500) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with FITC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), HRP
4-PAG324Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1251~Ala1500) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with HRP.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), PE
4-PAG324Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1251~Ala1500) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with PE.

PZP cloning plasmid
CSB-CL019131HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3807 Sequence: ATGTCTGAATCTTATCGGAGAACTACTTTTCCAGTAAGATTCCGTGTTGTCTCCGTGGATGAAAATTTTCGCCCTCGAAATGAACTGATTCCACTGATATACCTTGAGAACCCAAGAAGAAATCGAATTGCACAATGGCAGAGTCTCAAGCTAGAAGCTGGCATCAATCAGTTGT Show more
Description: A cloning plasmid for the PZP gene.

Pregnancy Zone Protein (PZP) Antibody
20-abx102180	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pregnancy Zone Protein (PZP) Antibody
20-abx102181	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pregnancy Zone Protein (PZP) Antibody
20-abx102182	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pregnancy Zone Protein (PZP) Antibody
20-abx129879	Abbexa	EUR 314.00 EUR 133.00 EUR 829.00 EUR 439.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pregnancy Zone Protein (PZP) Antibody
20-abx174149	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Pregnancy Zone Protein (PZP) Antibody
20-abx002369	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), APC-Cy7
4-PAG324Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Val1212~Met1391) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG324Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Tyr1224~Ala1495) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG324Mu02-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1246~Ala1495) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), APC-Cy7
4-PAG324Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1251~Ala1500) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7.

Pregnancy Zone Protein (PZP) Antibody (FITC)
20-abx271207	Abbexa	EUR 509.00 EUR 258.00 EUR 1525.00 EUR 704.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody (FITC)
20-abx271260	Abbexa	EUR 495.00 EUR 258.00 EUR 1455.00 EUR 676.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody (Biotin)
20-abx271473	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody (Biotin)
20-abx271526	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody (Biotin)
20-abx272390	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pregnancy Zone Protein (PZP) Antibody Pair
20-abx370759	Abbexa	EUR 1859.00 EUR 1177.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody Pair
20-abx370771	Abbexa	EUR 1776.00 EUR 1135.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody (HRP)
20-abx274625	Abbexa	EUR 509.00 EUR 258.00 EUR 1525.00 EUR 704.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human PZP ELISA Kit
ELA-E1140h	Lifescience Market	96 Tests	EUR 824

PZP ELISA KIT|Human
EF003623	Lifescience Market	96 Tests	EUR 689

Human Pregnancy zone protein (PZP)
1-CSB-EP019131HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 42.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Pregnancy zone protein(PZP),partial expressed in E.coli

Human Pregnancy zone protein (PZP)
1-CSB-YP019131HU	Cusabio	EUR 430.00 EUR 234.00 EUR 1508.00 EUR 642.00 EUR 1009.00 EUR 291.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 65.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Pregnancy zone protein(PZP),partial expressed in Yeast

Human PZP PicoKine ELISA Kit
EK1873	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human PZP in cell culture supernates, serum and plasma (heparin, EDTA).

Pzp ORF Vector (Rat) (pORF)
ORF074390	ABM	1.0 ug DNA	EUR 2080

PZP ORF Vector (Human) (pORF)
ORF014217	ABM	1.0 ug DNA	EUR 354

Pzp ORF Vector (Mouse) (pORF)
ORF055356	ABM	1.0 ug DNA	EUR 1572

Recombinant Pregnancy Zone Protein (PZP)
4-RPG324Hu01	Cloud-Clone	EUR 583.84 EUR 259.00 EUR 1914.40 EUR 704.80 EUR 1309.60 EUR 454.00 EUR 4636.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P20742 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 21.1kDa Isoelectric Point: 6.3
Description: Recombinant Human Pregnancy Zone Protein expressed in: E.coli

Recombinant Pregnancy Zone Protein (PZP)
4-RPG324Mu01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q61838 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 56.8kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Pregnancy Zone Protein expressed in: E.coli

Recombinant Pregnancy Zone Protein (PZP)
4-RPG324Mu02	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q61838 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.3kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Pregnancy Zone Protein expressed in: E.coli

Recombinant Pregnancy Zone Protein (PZP)
4-RPG324Ra01	Cloud-Clone	EUR 548.00 EUR 250.00 EUR 1780.00 EUR 660.00 EUR 1220.00 EUR 430.00 EUR 4300.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q63041 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 53.3kDa Isoelectric Point: Inquire
Description: Recombinant Rat Pregnancy Zone Protein expressed in: E.coli

PZP ELISA Kit (Mouse) (OKAN04986)
OKAN04986	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.65 ng/mL

PZP ELISA Kit (Human) (OKAN06584)
OKAN06584	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.118 ng/mL

PZP ELISA Kit (Human) (OKBB01285)
OKBB01285	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Pregnancy zone protein (PZP) is a protein which in humans is encoded by the PZP gene on chromosome 12. It is mapped to 12p13.31. The protein encoded by this gene is highly expressed in late-pregnancy serum and is similar in structure to alpha-2-macroglobulin. The encoded protein, which acts as a homotetramer, inhibits the activity of all four classes of proteinases. This protein contains cleavage sites for several proteinases. Upon binding of a proteinase, the conformation of this protein changes to trap the proteinase, limiting its activity. This protein appears to be elevated in the sera of presymptomatic Alzheimer's disease patients.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

PZP ELISA Kit (Human) (OKCD08911)
OKCD08911	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Rabbit anti-human Pregnancy zone polyclonal Antibody;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.118ng/mL

PZP ELISA Kit (Mouse) (OKCD08912)
OKCD08912	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: Is able to inhibit all four classes of proteinases by a unique 'trapping' mechanism. This protein has a peptide stretch, called the 'bait region' which contains specific cleavage sites for different proteinases. When a proteinase cleaves the bait region, a conformational change is induced in the protein which traps the proteinase. The entrapped enzyme remains active against low molecular weight substrates (activity against high molecular weight substrates is greatly reduced). Following cleavage in the bait region, a thioester bond is hydrolyzed and mediates the covalent binding of the protein to the proteinase. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.64ng/mL

PZP ELISA Kit (Rat) (OKCD08913)
OKCD08913	Aviva Systems Biology	96 Wells	EUR 1053
Description: Description of target: plasma protease inhibitor.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 2.7ng/mL

PZP ELISA Kit (Human) (OKEH04635)
OKEH04635	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Is able to inhibit all four classes of proteinases by a unique 'trapping' mechanism. This protein has a peptide stretch, called the 'bait region' which contains specific cleavage sites for different proteinases. When a proteinase cleaves the bait region, a conformational change is induced in the protein which traps the proteinase. The entrapped enzyme remains active against low molecular weight substrates (activity against high molecular weight substrates is greatly reduced). Following cleavage in the bait region a thioester bond is hydrolyzed and mediates the covalent binding of the protein to the proteinase.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 43 pg/mL

Mouse Pregnancy Zone Protein (PZP) Protein
20-abx165942	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Pregnancy Zone Protein (PZP) Protein
20-abx068659	Abbexa	EUR 815.00 EUR 314.00 EUR 2569.00 EUR 968.00 EUR 565.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Pregnancy Zone Protein (PZP) Protein
20-abx068660	Abbexa	EUR 759.00 EUR 300.00 EUR 2388.00 EUR 913.00 EUR 537.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Pregnancy Zone Protein (PZP) Protein
20-abx068661	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Pzp sgRNA CRISPR Lentivector set (Rat)
K7332401	ABM	3 x 1.0 ug	EUR 339

Pzp sgRNA CRISPR Lentivector set (Mouse)
K3715701	ABM	3 x 1.0 ug	EUR 339

PZP sgRNA CRISPR Lentivector set (Human)
K1765801	ABM	3 x 1.0 ug	EUR 339

Human Pregnancy zone protein(PZP) ELISA kit
CSB-EL019131HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human Pregnancy zone protein (PZP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Pregnancy zone protein(PZP) ELISA kit
1-CSB-EL019131HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human Pregnancy zone protein(PZP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Pregnancy Zone Protein (PZP) ELISA Kit
20-abx152906	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Pregnancy Zone Protein (PZP) ELISA Kit
20-abx258971	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Pregnancy Zone Protein (PZP) ELISA Kit
20-abx258972	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human PZP/ Pregnancy zone protein ELISA Kit
E2110Hu	Sunlong	1 Kit	EUR 571

Human PZP(Pregnancy zone protein) ELISA Kit
EH1299	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: P20742 Alias: PZP/CPAMD6(Pregnancy zone protein)/C3 and PZP-like alpha-2-macroglobulin domain-containing protein 6/pregnancy-zone protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human Pregnancy zone protein, PZP ELISA KIT
ELI-03752h	Lifescience Market	96 Tests	EUR 824

Human Pregnancy zone protein (PZP) ELISA Kit
abx576051-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Pregnancy Zone Protein (PZP) CLIA Kit
20-abx495159	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Pregnancy Zone Protein (PZP) CLIA Kit
20-abx496457	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Pregnancy Zone Protein (PZP) CLIA Kit
20-abx496528	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Pzp sgRNA CRISPR Lentivector (Rat) (Target 1)
K7332402	ABM	1.0 ug DNA	EUR 154

Pzp sgRNA CRISPR Lentivector (Rat) (Target 2)
K7332403	ABM	1.0 ug DNA	EUR 154

Pzp sgRNA CRISPR Lentivector (Rat) (Target 3)
K7332404	ABM	1.0 ug DNA	EUR 154

Pzp sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3715702	ABM	1.0 ug DNA	EUR 154

Pzp sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3715703	ABM	1.0 ug DNA	EUR 154

Pzp sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3715704	ABM	1.0 ug DNA	EUR 154

PZP sgRNA CRISPR Lentivector (Human) (Target 1)
K1765802	ABM	1.0 ug DNA	EUR 154

PZP sgRNA CRISPR Lentivector (Human) (Target 2)
K1765803	ABM	1.0 ug DNA	EUR 154

PZP sgRNA CRISPR Lentivector (Human) (Target 3)
K1765804	ABM	1.0 ug DNA	EUR 154

PZP Protein Vector (Rat) (pPB-C-His)
PV297558	ABM	500 ng	EUR 2538

PZP Protein Vector (Rat) (pPB-N-His)
PV297559	ABM	500 ng	EUR 2538

PZP Protein Vector (Rat) (pPM-C-HA)
PV297560	ABM	500 ng	EUR 2538

PZP Protein Vector (Rat) (pPM-C-His)
PV297561	ABM	500 ng	EUR 2538

PZP Protein Vector (Human) (pPB-C-His)
PV056865	ABM	500 ng	EUR 481

PZP Protein Vector (Human) (pPB-N-His)
PV056866	ABM	500 ng	EUR 481

PZP Protein Vector (Human) (pPM-C-HA)
PV056867	ABM	500 ng	EUR 481

PZP Protein Vector (Human) (pPM-C-His)
PV056868	ABM	500 ng	EUR 481

PZP Protein Vector (Mouse) (pPB-C-His)
PV221422	ABM	500 ng	EUR 2530

PZP Protein Vector (Mouse) (pPB-N-His)
PV221423	ABM	500 ng	EUR 2530

PZP Rabbit Polyclonal Antibody