RAP1A Rabbit Polyclonal Antibody

RAP1A Rabbit Polyclonal Antibody

RAP1A Polyclonal Antibody
ES11127-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RAP1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAP1A Polyclonal Antibody
ES11127-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RAP1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAP1A Rabbit pAb
A0975-100ul 100 ul
EUR 308

RAP1A Rabbit pAb
A0975-200ul 200 ul
EUR 459

RAP1A Rabbit pAb
A0975-20ul 20 ul
EUR 183

RAP1A Rabbit pAb
A0975-50ul 50 ul
EUR 223

RAP1A antibody
22245-100ul 100ul
EUR 390

RAP1A antibody
70R-19768 50 ul
EUR 435
Description: Rabbit polyclonal RAP1A antibody

RAP1A Antibody
35640-100ul 100ul
EUR 252

RAP1A antibody
38156-100ul 100ul
EUR 252

RAP1A Antibody
1-CSB-PA827156
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

RAP1A Antibody
1-CSB-PA968243
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

RAP1A Antibody
DF6157 200ul
EUR 304
Description: RAP1A Antibody detects endogenous levels of total RAP1A.

RAP1A antibody
70R-51010 100 ul
EUR 244
Description: Purified Polyclonal RAP1A antibody

RAP1A Antibody
BF0304 200ul
EUR 376
Description: RAP1A antibody detects endogenous levels of total RAP1A.

RAP1A Antibody
1-CSB-PA019321GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

RAP1A Antibody
1-CSB-PA019321LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

RAP1A Antibody
ABD6157 100 ug
EUR 438

Polyclonal Rap1a Antibody - middle region
AMM07522G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rap1a - middle region. This antibody is tested and proven to work in the following applications:

RAP1A Polyclonal Antibody, Biotin Conjugated
A60519 100 µg
EUR 570.55
Description: kits suitable for this type of research

RAP1A Polyclonal Antibody, FITC Conjugated
A60520 100 µg
EUR 570.55
Description: fast delivery possible

RAP1A Polyclonal Antibody, HRP Conjugated
A60521 100 µg
EUR 570.55
Description: reagents widely cited

Polyclonal Rap1a Antibody - C-terminal region
AMM07521G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rap1a - C-terminal region. This antibody is tested and proven to work in the following applications:

RAP1A Conjugated Antibody
C35640 100ul
EUR 397

Anti-RAP1A Antibody
PB9816 100ug/vial
EUR 294

Anti-RAP1A antibody
STJ25296 100 µl
EUR 277
Description: This gene encodes a member of the Ras family of small GTPases. The encoded protein undergoes a change in conformational state and activity, depending on whether it is bound to GTP or GDP. This protein is activated by several types of guanine nucleotide exchange factors (GEFs), and inactivated by two groups of GTPase-activating proteins (GAPs). The activation status of the encoded protein is therefore affected by the balance of intracellular levels of GEFs and GAPs. The encoded protein regulates signaling pathways that affect cell proliferation and adhesion, and may play a role in tumor malignancy. Pseudogenes of this gene have been defined on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants.

Anti-RAP1A antibody
STJ192285 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAP1A

RAP1A siRNA
20-abx904462
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAP1A siRNA
20-abx930868
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAP1A siRNA
20-abx930869
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RAP1A
YF-PA24544 50 ul
EUR 334
Description: Mouse polyclonal to RAP1A

RAP1A Antibody, HRP conjugated
1-CSB-PA019321LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAP1A Antibody, FITC conjugated
1-CSB-PA019321LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAP1A Antibody, Biotin conjugated
1-CSB-PA019321LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Ras-related protein Rap1A (RAP1A) ELISA Kit
abx251608-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

RAP1A Blocking Peptide
DF6157-BP 1mg
EUR 195

RAP1A Blocking Peptide
20-abx063885
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RAP1A Blocking Peptide
BF0304-BP 1mg
EUR 195

RAP1A cloning plasmid
CSB-CL019321HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atgcgtgagtacaagctagtggtccttggttcaggaggcgttgggaagtctgctctgacagttcagtttgttcagggaatttttgttgaaaaatatgacccaacgatagaagattcctacagaaagcaagttgaagtcgattgccaacagtgtatgctcgaaatcctggatactgc
  • Show more
Description: A cloning plasmid for the RAP1A gene.

anti-RAP1A (5F8)
LF-MA30709 100 ul
EUR 527
Description: Mouse Monoclonal to RAP1A

anti-RAP1A (5F8G2)
LF-MA30710 100 ul
EUR 527
Description: Mouse Monoclonal to RAP1A

Recombinant Human Rap1a
STA-735 10 µg
EUR 276
Description:
  • Recombinant Human Rap1a is expressed in E. coli and contains a His tag at the N-terminus. 10 µg/vial.
  • Recombinant protein is raised in E. coli
  • Protein includes a tag
  • Recombinant Protein purified from E. coli

Anti-RAP1A (3E1)
YF-MA15102 100 ug
EUR 363
Description: Mouse monoclonal to RAP1A

Monoclonal RAP1A Antibody, Clone: 5F8
AMM02891G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human RAP1A. The antibodies are raised in Mouse and are from clone 5F8. This antibody is applicable in WB, FC, E

RAP1A protein (His tag)
80R-1361 50 ug
EUR 397
Description: Purified recombinant Human RAP1A protein

Human RAP1A ELISA Kit
ELA-E3220h 96 Tests
EUR 824

RAP1A ELISA KIT|Human
EF006324 96 Tests
EUR 689

Rat RAP1A shRNA Plasmid
20-abx988754
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAP1A shRNA Plasmid
20-abx953993
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RAP1A shRNA Plasmid
20-abx980033
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAP1A Recombinant Protein (Human)
RP025744 100 ug Ask for price

RAP1A Recombinant Protein (Mouse)
RP166739 100 ug Ask for price

RAP1A Recombinant Protein (Rat)
RP223586 100 ug Ask for price

Ras-Related Protein Rap-1A (RAP1A) Antibody
20-abx008128
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ras-Related Protein Rap-1A (RAP1A) Antibody
abx015976-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Ras-related protein Rap-1A (RAP1A) Antibody
20-abx213991
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rap1A, Member Of Ras Oncogene Family Antibody
20-abx115041
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras-Related Protein Rap-1A (RAP1A) Antibody
abx011676-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Ras-related protein Rap-1A (RAP1A) Antibody
20-abx242043
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Monoclonal RAP1A Antibody (monoclonal) (M01), Clone: 30
AMM07520G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RAP1A (monoclonal) (M01). The antibodies are raised in mouse and are from clone 30. This antibody is applicable in WB, E

Ras-Related Protein Rap-1A (RAP1A) Antibody
20-abx301260
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras-Related Protein Rap-1A (RAP1A) Antibody
20-abx000928
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rap1a ORF Vector (Rat) (pORF)
ORF074530 1.0 ug DNA
EUR 506

RAP1A ORF Vector (Human) (pORF)
ORF008582 1.0 ug DNA
EUR 95

Rap1a ORF Vector (Mouse) (pORF)
ORF055581 1.0 ug DNA
EUR 506

RAP1A ELISA Kit (Mouse) (OKEH05134)
OKEH05134 96 Wells
EUR 727
Description: Description of target: Induces morphological reversion of a cell line transformed by a Ras oncogene. Counteracts the mitogenic function of Ras, at least partly because it can interact with Ras GAPs and RAF in a competitive manner. Together with ITGB1BP1, regulates KRIT1 localization to microtubules and membranes. Plays a role in nerve growth factor (NGF)-induced neurite outgrowth. Plays a role in the regulation of embryonic blood vessel formation. Involved in the establishment of basal endothelial barrier function. May be involved in the regulation of the vascular endothelial growth factor receptor KDR expression at endothelial cell-cell junctions.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

RAP1A ELISA Kit (Rat) (OKEH03532)
OKEH03532 96 Wells
EUR 727
Description: Description of target: Induces morphological reversion of a cell line transformed by a Ras oncogene. Counteracts the mitogenic function of Ras, at least partly because it can interact with Ras GAPs and RAF in a competitive manner. Together with ITGB1BP1, regulates KRIT1 localization to microtubules and membranes. Plays a role in nerve growth factor (NGF)-induced neurite outgrowth. Plays a role in the regulation of embryonic blood vessel formation. Involved in the establishment of basal endothelial barrier function. May be involved in the regulation of the vascular endothelial growth factor receptor KDR expression at endothelial cell-cell junctions.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Ras-Related Protein Rap-1A (RAP1A) Antibody (HRP)
20-abx305049
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras-Related Protein Rap-1A (RAP1A) Antibody (FITC)
20-abx305050
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras-Related Protein Rap-1A (RAP1A) Antibody (Biotin)
20-abx305051
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAP1A, Member RAS Oncogene Family Protein
20-abx262895
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Rap1a sgRNA CRISPR Lentivector set (Rat)
K7257001 3 x 1.0 ug
EUR 339

RAP1A sgRNA CRISPR Lentivector set (Human)
K1784701 3 x 1.0 ug
EUR 339

Rap1a sgRNA CRISPR Lentivector set (Mouse)
K4457901 3 x 1.0 ug
EUR 339

Recombinant Human RAP1A, Member RAS Oncogene Family
7-06058 2µg Ask for price

Recombinant Human RAP1A, Member RAS Oncogene Family
7-06059 10µg Ask for price

Recombinant Human RAP1A, Member RAS Oncogene Family
7-06060 1mg Ask for price

Rap1a sgRNA CRISPR Lentivector (Rat) (Target 1)
K7257002 1.0 ug DNA
EUR 154

Rap1a sgRNA CRISPR Lentivector (Rat) (Target 2)
K7257003 1.0 ug DNA
EUR 154

Rap1a sgRNA CRISPR Lentivector (Rat) (Target 3)
K7257004 1.0 ug DNA
EUR 154

RAP1A sgRNA CRISPR Lentivector (Human) (Target 1)
K1784702 1.0 ug DNA
EUR 154

RAP1A sgRNA CRISPR Lentivector (Human) (Target 2)
K1784703 1.0 ug DNA
EUR 154

RAP1A sgRNA CRISPR Lentivector (Human) (Target 3)
K1784704 1.0 ug DNA
EUR 154

Rap1a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4457902 1.0 ug DNA
EUR 154

Rap1a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4457903 1.0 ug DNA
EUR 154

Rap1a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4457904 1.0 ug DNA
EUR 154

RAP1A Protein Vector (Rat) (pPB-C-His)
PV298118 500 ng
EUR 603

RAP1A Protein Vector (Rat) (pPB-N-His)
PV298119 500 ng
EUR 603

RAP1A Protein Vector (Rat) (pPM-C-HA)
PV298120 500 ng
EUR 603

RAP1A Protein Vector (Rat) (pPM-C-His)
PV298121 500 ng
EUR 603

RAP1A Protein Vector (Human) (pPB-C-His)
PV034325 500 ng
EUR 329

RAP1A Protein Vector (Human) (pPB-N-His)
PV034326 500 ng
EUR 329

RAP1A Protein Vector (Human) (pPM-C-HA)
PV034327 500 ng
EUR 329

RAP1A Protein Vector (Human) (pPM-C-His)
PV034328 500 ng
EUR 329

RAP1A Protein Vector (Mouse) (pPB-C-His)
PV222322 500 ng
EUR 603

RAP1A Protein Vector (Mouse) (pPB-N-His)
PV222323 500 ng
EUR 603

RAP1A Rabbit Polyclonal Antibody