셀타젠 Genetic Genotyping

REEP1 Rabbit Polyclonal Antibody

REEP1 Polyclonal Antibody

31353-100ul 100ul
EUR 252

REEP1 Polyclonal Antibody

31353-50ul 50ul
EUR 187

REEP1 Rabbit pAb

A7832-100ul 100 ul
EUR 308

REEP1 Rabbit pAb

A7832-200ul 200 ul
EUR 459

REEP1 Rabbit pAb

A7832-20ul 20 ul
EUR 183

REEP1 Rabbit pAb

A7832-50ul 50 ul
EUR 223

REEP1 Polyclonal Conjugated Antibody

C31353 100ul
EUR 397

REEP1 antibody

70R-7241 50 ug
EUR 467
Description: Rabbit polyclonal REEP1 antibody raised against the middle region of REEP1

REEP1 antibody

70R-7467 50 ug
EUR 467
Description: Rabbit polyclonal REEP1 antibody raised against the C terminal of REEP1

REEP1 antibody

70R-19848 50 ul
EUR 435
Description: Rabbit polyclonal REEP1 antibody

REEP1 Antibody

DF12719 200ul
EUR 304
Description: REEP1 Antibody detects endogenous levels of REEP1.

REEP1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

REEP1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

REEP1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti- REEP1 antibody

FNab07229 100µg
EUR 548.75
  • Immunogen: receptor accessory protein 1
  • Uniprot ID: Q9H902
  • Gene ID: 65055
  • Research Area: Metabolism
Description: Antibody raised against REEP1

Anti-REEP1 antibody

PAab07229 100 ug
EUR 386

Anti-REEP1 antibody

STJ110142 100 µl
EUR 277
Description: This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants.

Anti-REEP1 antibody

STJ192598 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to REEP1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Monoclonal antibody for REEP1

SMC-480D 0.1mg
EUR 353
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is not conjugated.

Monoclonal antibody for REEP1

SMC-480D-A390 0.1mg
EUR 400
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 390.

Monoclonal antibody for REEP1

SMC-480D-A488 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 488.

Monoclonal antibody for REEP1

SMC-480D-A565 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 565.

Monoclonal antibody for REEP1

SMC-480D-A594 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 594.

Monoclonal antibody for REEP1

SMC-480D-A633 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 633.

Monoclonal antibody for REEP1

SMC-480D-A655 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 655.

Monoclonal antibody for REEP1

SMC-480D-A680 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 680.

Monoclonal antibody for REEP1

SMC-480D-A700 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 700.

Monoclonal antibody for REEP1

SMC-480D-ALP 0.1mg
EUR 393
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for REEP1

SMC-480D-APC 0.1mg
EUR 398
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with APC.

Monoclonal antibody for REEP1

SMC-480D-APCCY7 0.1mg
EUR 470
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with APC/Cy7.

Monoclonal antibody for REEP1

SMC-480D-BI 0.1mg
EUR 395
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Biotin.

Monoclonal antibody for REEP1

SMC-480D-DY350 0.1mg
EUR 413
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 350.

Monoclonal antibody for REEP1

SMC-480D-DY405 0.1mg
EUR 402
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 405.

Monoclonal antibody for REEP1

SMC-480D-DY488 0.1mg
EUR 392
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 488.

Monoclonal antibody for REEP1

SMC-480D-DY594 0.1mg
EUR 394
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 594.

Monoclonal antibody for REEP1

SMC-480D-DY633 0.1mg
EUR 389
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 633.

Monoclonal antibody for REEP1

SMC-480D-FITC 0.1mg
EUR 391
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with FITC.

Monoclonal antibody for REEP1

SMC-480D-HRP 0.1mg
EUR 387
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with HRP.

Monoclonal antibody for REEP1

SMC-480D-P594 0.1mg
EUR 406
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with PE/ATTO 594.

Monoclonal antibody for REEP1

SMC-480D-PCP 0.1mg
EUR 398
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with PerCP.

Monoclonal antibody for REEP1

SMC-480D-RPE 0.1mg
EUR 396
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with RPE.

Monoclonal antibody for REEP1

SMC-480D-STR 0.1mg
EUR 397
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Streptavidin.

Monoclonal antibody for REEP1

SMC-480S 0.012mg
EUR 65
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is not conjugated.

REEP1 Blocking Peptide

33R-1288 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADCYAP1R1 antibody, catalog no. 70R-9939

REEP1 Blocking Peptide

33R-2704 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of REEP1 antibody, catalog no. 70R-7467

REEP1 cloning plasmid

CSB-CL862045HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 606
  • Sequence: atggtgtcatggatcatctccaggctggtggtgcttatatttggcaccctttaccctgcgtattattcctacaaggctgtgaaatcaaaggacattaaggaatatgtcaaatggatgatgtactggattatatttgcacttttcaccacagcagagacattcacagacatcttcct
  • Show more
Description: A cloning plasmid for the REEP1 gene.

REEP1 Blocking Peptide

DF12719-BP 1mg
EUR 195

Monoclonal antibody for REEP1/2

SMC-482D 0.1mg
EUR 353
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is not conjugated.

Monoclonal antibody for REEP1/2

SMC-482D-A390 0.1mg
EUR 400
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 390.

Monoclonal antibody for REEP1/2

SMC-482D-A488 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 488.

Monoclonal antibody for REEP1/2

SMC-482D-A565 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 565.

Monoclonal antibody for REEP1/2

SMC-482D-A594 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 594.

Monoclonal antibody for REEP1/2

SMC-482D-A633 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 633.

Monoclonal antibody for REEP1/2

SMC-482D-A655 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 655.

Monoclonal antibody for REEP1/2

SMC-482D-A680 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 680.

Monoclonal antibody for REEP1/2

SMC-482D-A700 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 700.

Monoclonal antibody for REEP1/2

SMC-482D-ALP 0.1mg
EUR 393
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for REEP1/2

SMC-482D-APC 0.1mg
EUR 398
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with APC.

Monoclonal antibody for REEP1/2

SMC-482D-APCCY7 0.1mg
EUR 470
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with APC/Cy7.

Monoclonal antibody for REEP1/2

SMC-482D-BI 0.1mg
EUR 395
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Biotin.

Monoclonal antibody for REEP1/2

SMC-482D-DY350 0.1mg
EUR 413
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 350.

Monoclonal antibody for REEP1/2

SMC-482D-DY405 0.1mg
EUR 402
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 405.

Monoclonal antibody for REEP1/2

SMC-482D-DY488 0.1mg
EUR 392
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 488.

Monoclonal antibody for REEP1/2

SMC-482D-DY594 0.1mg
EUR 394
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 594.

Monoclonal antibody for REEP1/2

SMC-482D-DY633 0.1mg
EUR 389
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 633.

Monoclonal antibody for REEP1/2

SMC-482D-FITC 0.1mg
EUR 391
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with FITC.

Monoclonal antibody for REEP1/2

SMC-482D-HRP 0.1mg
EUR 387
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with HRP.

Monoclonal antibody for REEP1/2

SMC-482D-P594 0.1mg
EUR 406
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with PE/ATTO 594.

Monoclonal antibody for REEP1/2

SMC-482D-PCP 0.1mg
EUR 398
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with PerCP.

Monoclonal antibody for REEP1/2

SMC-482D-RPE 0.1mg
EUR 396
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with RPE.

Monoclonal antibody for REEP1/2

SMC-482D-STR 0.1mg
EUR 397
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Streptavidin.

Monoclonal antibody for REEP1/2

SMC-482S 0.012mg
EUR 65
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is not conjugated.

Receptor Accessory Protein 1 (REEP1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Accessory Protein 1 (REEP1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Accessory Protein 1 (REEP1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Accessory Protein 1 (REEP1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Accessory Protein 1 (REEP1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Accessory Protein 1 (REEP1) Antibody

abx445089-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody

abx237229-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Mouse REEP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF002407 96 Tests
EUR 689

Human REEP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

REEP1 Recombinant Protein (Human)

RP026134 100 ug Ask for price

REEP1 Recombinant Protein (Rat)

RP224024 100 ug Ask for price

REEP1 Recombinant Protein (Mouse)

RP167513 100 ug Ask for price

Receptor Accessory Protein 1 (REEP1) Antibody (ALP)

abx442486-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (APC)

abx442767-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (Biotin)

abx443047-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (FITC)

abx443327-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (HRP)

abx443608-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (PerCP)

abx444170-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (RPE)

abx444451-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (Streptavidin)

abx444732-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

REEP1 ORF Vector (Human) (pORF)

ORF008712 1.0 ug DNA
EUR 95

Reep1 ORF Vector (Rat) (pORF)

ORF074676 1.0 ug DNA
EUR 506

Reep1 ORF Vector (Mouse) (pORF)

ORF055839 1.0 ug DNA
EUR 506

Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 390)

abx440238-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 488)

abx440519-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 565)

abx440800-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 594)

abx441081-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 633)

abx441362-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 655)

abx441643-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 680)

abx441924-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 700)

abx442205-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

REEP1 sgRNA CRISPR Lentivector set (Human)

K1806501 3 x 1.0 ug
EUR 339

Reep1 sgRNA CRISPR Lentivector set (Rat)

K6152501 3 x 1.0 ug
EUR 339

Reep1 sgRNA CRISPR Lentivector set (Mouse)

K3329701 3 x 1.0 ug
EUR 339

Receptor Accessory Protein 1 (REEP1) Antibody (PE/ATTO 594)

abx443889-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody

abx445091-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

REEP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1806502 1.0 ug DNA
EUR 154

REEP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1806503 1.0 ug DNA
EUR 154

REEP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1806504 1.0 ug DNA
EUR 154

Reep1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6152502 1.0 ug DNA
EUR 154

Reep1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6152503 1.0 ug DNA
EUR 154

Reep1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6152504 1.0 ug DNA
EUR 154

Reep1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3329702 1.0 ug DNA
EUR 154

Reep1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3329703 1.0 ug DNA
EUR 154

Reep1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3329704 1.0 ug DNA
EUR 154

REEP1 Protein Vector (Human) (pPB-C-His)

PV034845 500 ng
EUR 329

REEP1 Protein Vector (Human) (pPB-N-His)

PV034846 500 ng
EUR 329

REEP1 Protein Vector (Human) (pPM-C-HA)

PV034847 500 ng
EUR 329

REEP1 Protein Vector (Human) (pPM-C-His)

PV034848 500 ng
EUR 329

REEP1 Protein Vector (Rat) (pPB-C-His)

PV298702 500 ng
EUR 1166

REEP1 Protein Vector (Rat) (pPB-N-His)

PV298703 500 ng
EUR 1166

REEP1 Protein Vector (Rat) (pPM-C-HA)

PV298704 500 ng
EUR 1166

REEP1 Protein Vector (Rat) (pPM-C-His)

PV298705 500 ng
EUR 1166

REEP1 Protein Vector (Mouse) (pPB-C-His)

PV223354 500 ng
EUR 603

REEP1 Protein Vector (Mouse) (pPB-N-His)

PV223355 500 ng
EUR 603

REEP1 Protein Vector (Mouse) (pPM-C-HA)

PV223356 500 ng
EUR 603

REEP1 Protein Vector (Mouse) (pPM-C-His)

PV223357 500 ng
EUR 603

Reep1 3'UTR GFP Stable Cell Line

TU167699 1.0 ml Ask for price

REEP1 3'UTR Luciferase Stable Cell Line

TU019729 1.0 ml
EUR 2333

Reep1 3'UTR Luciferase Stable Cell Line

TU117699 1.0 ml Ask for price

REEP1 3'UTR GFP Stable Cell Line

TU069729 1.0 ml
EUR 2333

Reep1 3'UTR GFP Stable Cell Line

TU267455 1.0 ml Ask for price

Reep1 3'UTR Luciferase Stable Cell Line

TU217455 1.0 ml Ask for price

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (ALP)

abx442488-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (APC)

abx442769-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (Biotin)

abx443049-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (FITC)

abx443329-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (HRP)

abx443610-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (PerCP)

abx444172-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (RPE)

abx444453-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (Streptavidin)

abx444734-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

REEP1 Rabbit Polyclonal Antibody