CelltaGen
셀타젠 Genetic Genotyping

REEP1 Rabbit Polyclonal Antibody

REEP1 Polyclonal Antibody

ES11440-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against REEP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

REEP1 Polyclonal Antibody

ES11440-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against REEP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

REEP1 Rabbit pAb

A7832-100ul 100 ul
EUR 308

REEP1 Rabbit pAb

A7832-200ul 200 ul
EUR 459

REEP1 Rabbit pAb

A7832-20ul 20 ul
EUR 183

REEP1 Rabbit pAb

A7832-50ul 50 ul
EUR 223

REEP1 Polyclonal Conjugated Antibody

C31353 100ul
EUR 397

REEP1 antibody

70R-19848 50 ul
EUR 435
Description: Rabbit polyclonal REEP1 antibody

REEP1 Antibody

1-CSB-PA862045DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

REEP1 Antibody

1-CSB-PA862045DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

REEP1 Antibody

DF12719 200ul
EUR 304
Description: REEP1 Antibody detects endogenous levels of REEP1.

REEP1 antibody

70R-7241 50 ug
EUR 467
Description: Rabbit polyclonal REEP1 antibody raised against the middle region of REEP1

REEP1 antibody

70R-7467 50 ug
EUR 467
Description: Rabbit polyclonal REEP1 antibody raised against the C terminal of REEP1

REEP1 Antibody

1-CSB-PA019540GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti- REEP1 antibody

FNab07229 100µg
EUR 548.75
  • Immunogen: receptor accessory protein 1
  • Uniprot ID: Q9H902
  • Gene ID: 65055
  • Research Area: Metabolism
Description: Antibody raised against REEP1

Anti-REEP1 antibody

PAab07229 100 ug
EUR 386

Anti-REEP1 antibody

STJ110142 100 µl
EUR 277
Description: This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants.

Anti-REEP1 antibody

STJ192598 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to REEP1

REEP1 siRNA

20-abx931216
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

REEP1 siRNA

20-abx931217
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Monoclonal antibody for REEP1

SMC-480D 0.1mg
EUR 353
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is not conjugated.

Monoclonal antibody for REEP1

SMC-480D-A390 0.1mg
EUR 400
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 390.

Monoclonal antibody for REEP1

SMC-480D-A488 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 488.

Monoclonal antibody for REEP1

SMC-480D-A565 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 565.

Monoclonal antibody for REEP1

SMC-480D-A594 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 594.

Monoclonal antibody for REEP1

SMC-480D-A633 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 633.

Monoclonal antibody for REEP1

SMC-480D-A655 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 655.

Monoclonal antibody for REEP1

SMC-480D-A680 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 680.

Monoclonal antibody for REEP1

SMC-480D-A700 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 700.

Monoclonal antibody for REEP1

SMC-480D-ALP 0.1mg
EUR 393
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for REEP1

SMC-480D-APC 0.1mg
EUR 398
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with APC.

Monoclonal antibody for REEP1

SMC-480D-APCCY7 0.1mg
EUR 470
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with APC/Cy7.

Monoclonal antibody for REEP1

SMC-480D-BI 0.1mg
EUR 395
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Biotin.

Monoclonal antibody for REEP1

SMC-480D-DY350 0.1mg
EUR 413
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 350.

Monoclonal antibody for REEP1

SMC-480D-DY405 0.1mg
EUR 402
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 405.

Monoclonal antibody for REEP1

SMC-480D-DY488 0.1mg
EUR 392
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 488.

Monoclonal antibody for REEP1

SMC-480D-DY594 0.1mg
EUR 394
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 594.

Monoclonal antibody for REEP1

SMC-480D-DY633 0.1mg
EUR 389
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 633.

Monoclonal antibody for REEP1

SMC-480D-FITC 0.1mg
EUR 391
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with FITC.

Monoclonal antibody for REEP1

SMC-480D-HRP 0.1mg
EUR 387
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with HRP.

Monoclonal antibody for REEP1

SMC-480D-P594 0.1mg
EUR 406
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with PE/ATTO 594.

Monoclonal antibody for REEP1

SMC-480D-PCP 0.1mg
EUR 398
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with PerCP.

Monoclonal antibody for REEP1

SMC-480D-RPE 0.1mg
EUR 396
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with RPE.

Monoclonal antibody for REEP1

SMC-480D-STR 0.1mg
EUR 397
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Streptavidin.

Monoclonal antibody for REEP1

SMC-480S 0.012mg
EUR 65
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is not conjugated.

REEP1 Blocking Peptide

33R-2704 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of REEP1 antibody, catalog no. 70R-7467

REEP1 Blocking Peptide

33R-1288 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADCYAP1R1 antibody, catalog no. 70R-9939

REEP1 Blocking Peptide

DF12719-BP 1mg
EUR 195

REEP1 cloning plasmid

CSB-CL862045HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 606
  • Sequence: atggtgtcatggatcatctccaggctggtggtgcttatatttggcaccctttaccctgcgtattattcctacaaggctgtgaaatcaaaggacattaaggaatatgtcaaatggatgatgtactggattatatttgcacttttcaccacagcagagacattcacagacatcttcct
  • Show more
Description: A cloning plasmid for the REEP1 gene.

Monoclonal antibody for REEP1/2

SMC-482D 0.1mg
EUR 353
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is not conjugated.

Monoclonal antibody for REEP1/2

SMC-482D-A390 0.1mg
EUR 400
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 390.

Monoclonal antibody for REEP1/2

SMC-482D-A488 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 488.

Monoclonal antibody for REEP1/2

SMC-482D-A565 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 565.

Monoclonal antibody for REEP1/2

SMC-482D-A594 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 594.

Monoclonal antibody for REEP1/2

SMC-482D-A633 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 633.

Monoclonal antibody for REEP1/2

SMC-482D-A655 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 655.

Monoclonal antibody for REEP1/2

SMC-482D-A680 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 680.

Monoclonal antibody for REEP1/2

SMC-482D-A700 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 700.

Monoclonal antibody for REEP1/2

SMC-482D-ALP 0.1mg
EUR 393
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for REEP1/2

SMC-482D-APC 0.1mg
EUR 398
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with APC.

Monoclonal antibody for REEP1/2

SMC-482D-APCCY7 0.1mg
EUR 470
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with APC/Cy7.

Monoclonal antibody for REEP1/2

SMC-482D-BI 0.1mg
EUR 395
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Biotin.

Monoclonal antibody for REEP1/2

SMC-482D-DY350 0.1mg
EUR 413
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 350.

Monoclonal antibody for REEP1/2

SMC-482D-DY405 0.1mg
EUR 402
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 405.

Monoclonal antibody for REEP1/2

SMC-482D-DY488 0.1mg
EUR 392
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 488.

Monoclonal antibody for REEP1/2

SMC-482D-DY594 0.1mg
EUR 394
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 594.

Monoclonal antibody for REEP1/2

SMC-482D-DY633 0.1mg
EUR 389
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 633.

Monoclonal antibody for REEP1/2

SMC-482D-FITC 0.1mg
EUR 391
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with FITC.

Monoclonal antibody for REEP1/2

SMC-482D-HRP 0.1mg
EUR 387
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with HRP.

Monoclonal antibody for REEP1/2

SMC-482D-P594 0.1mg
EUR 406
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with PE/ATTO 594.

Monoclonal antibody for REEP1/2

SMC-482D-PCP 0.1mg
EUR 398
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with PerCP.

Monoclonal antibody for REEP1/2

SMC-482D-RPE 0.1mg
EUR 396
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with RPE.

Monoclonal antibody for REEP1/2

SMC-482D-STR 0.1mg
EUR 397
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Streptavidin.

Monoclonal antibody for REEP1/2

SMC-482S 0.012mg
EUR 65
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is not conjugated.

Receptor Accessory Protein 1 (REEP1) Antibody

20-abx007076
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Accessory Protein 1 (REEP1) Antibody

20-abx115085
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Accessory Protein 1 (REEP1) Antibody

20-abx142193
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Accessory Protein 1 (REEP1) Antibody

abx237229-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody

20-abx322525
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Accessory Protein 1 (REEP1) Antibody

20-abx322526
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Accessory Protein 1 (REEP1) Antibody

abx445089-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

REEP1 ELISA KIT|Human

EF002407 96 Tests
EUR 689

Mouse REEP1 shRNA Plasmid

20-abx974224
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human REEP1 shRNA Plasmid

20-abx962166
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

REEP1 Recombinant Protein (Human)

RP026134 100 ug Ask for price

REEP1 Recombinant Protein (Mouse)

RP167513 100 ug Ask for price

REEP1 Recombinant Protein (Rat)

RP224024 100 ug Ask for price

Receptor Accessory Protein 1 (REEP1) Antibody (ALP)

abx442486-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (APC)

abx442767-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (Biotin)

abx443047-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (FITC)

abx443327-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (HRP)

abx443608-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (PerCP)

abx444170-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (RPE)

abx444451-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (Streptavidin)

abx444732-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Reep1 ORF Vector (Rat) (pORF)

ORF074676 1.0 ug DNA
EUR 506

REEP1 ORF Vector (Human) (pORF)

ORF008712 1.0 ug DNA
EUR 95

Reep1 ORF Vector (Mouse) (pORF)

ORF055839 1.0 ug DNA
EUR 506

Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 390)

abx440238-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 488)

abx440519-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 565)

abx440800-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 594)

abx441081-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 633)

abx441362-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 655)

abx441643-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 680)

abx441924-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 700)

abx442205-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Reep1 sgRNA CRISPR Lentivector set (Rat)

K6152501 3 x 1.0 ug
EUR 339

REEP1 sgRNA CRISPR Lentivector set (Human)

K1806501 3 x 1.0 ug
EUR 339

Reep1 sgRNA CRISPR Lentivector set (Mouse)

K3329701 3 x 1.0 ug
EUR 339

Receptor Accessory Protein 1 (REEP1) Antibody (PE/ATTO 594)

abx443889-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody

abx445091-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Reep1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6152502 1.0 ug DNA
EUR 154

Reep1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6152503 1.0 ug DNA
EUR 154

Reep1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6152504 1.0 ug DNA
EUR 154

REEP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1806502 1.0 ug DNA
EUR 154

REEP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1806503 1.0 ug DNA
EUR 154

REEP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1806504 1.0 ug DNA
EUR 154

Reep1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3329702 1.0 ug DNA
EUR 154

Reep1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3329703 1.0 ug DNA
EUR 154

Reep1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3329704 1.0 ug DNA
EUR 154

REEP1 Protein Vector (Rat) (pPB-C-His)

PV298702 500 ng
EUR 1166

REEP1 Protein Vector (Rat) (pPB-N-His)

PV298703 500 ng
EUR 1166

REEP1 Protein Vector (Rat) (pPM-C-HA)

PV298704 500 ng
EUR 1166

REEP1 Protein Vector (Rat) (pPM-C-His)

PV298705 500 ng
EUR 1166

REEP1 Protein Vector (Human) (pPB-C-His)

PV034845 500 ng
EUR 329

REEP1 Protein Vector (Human) (pPB-N-His)

PV034846 500 ng
EUR 329

REEP1 Protein Vector (Human) (pPM-C-HA)

PV034847 500 ng
EUR 329

REEP1 Protein Vector (Human) (pPM-C-His)

PV034848 500 ng
EUR 329

REEP1 Protein Vector (Mouse) (pPB-C-His)

PV223354 500 ng
EUR 603

REEP1 Protein Vector (Mouse) (pPB-N-His)

PV223355 500 ng
EUR 603

REEP1 Protein Vector (Mouse) (pPM-C-HA)

PV223356 500 ng
EUR 603

REEP1 Protein Vector (Mouse) (pPM-C-His)

PV223357 500 ng
EUR 603

Reep1 3'UTR Luciferase Stable Cell Line

TU117699 1.0 ml Ask for price

Reep1 3'UTR GFP Stable Cell Line

TU167699 1.0 ml Ask for price

Reep1 3'UTR Luciferase Stable Cell Line

TU217455 1.0 ml Ask for price

Reep1 3'UTR GFP Stable Cell Line

TU267455 1.0 ml Ask for price

REEP1 3'UTR GFP Stable Cell Line

TU069729 1.0 ml
EUR 2333

REEP1 3'UTR Luciferase Stable Cell Line

TU019729 1.0 ml
EUR 2333

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (ALP)

abx442488-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (APC)

abx442769-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (Biotin)

abx443049-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (FITC)

abx443329-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (HRP)

abx443610-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (PerCP)

abx444172-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (RPE)

abx444453-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (Streptavidin)

abx444734-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

REEP1 Rabbit Polyclonal Antibody