REEP1 Rabbit Polyclonal Antibody
 REEP1 Polyclonal Antibody |
|
31353-100ul |
SAB |
100ul |
EUR 252 |
REEP1 Polyclonal Antibody |
|
31353-50ul |
SAB |
50ul |
EUR 187 |
 REEP1 Rabbit pAb |
|
A7832-100ul |
Abclonal |
100 ul |
EUR 308 |
REEP1 Rabbit pAb |
|
A7832-200ul |
Abclonal |
200 ul |
EUR 459 |
REEP1 Rabbit pAb |
|
A7832-20ul |
Abclonal |
20 ul |
EUR 183 |
REEP1 Rabbit pAb |
|
A7832-50ul |
Abclonal |
50 ul |
EUR 223 |
 REEP1 Polyclonal Conjugated Antibody |
|
C31353 |
SAB |
100ul |
EUR 397 |
 REEP1 antibody |
|
70R-7241 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal REEP1 antibody raised against the middle region of REEP1 |
REEP1 antibody |
|
70R-7467 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal REEP1 antibody raised against the C terminal of REEP1 |
REEP1 antibody |
|
70R-19848 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal REEP1 antibody |
 REEP1 Antibody |
|
DF12719 |
Affbiotech |
200ul |
EUR 304 |
|
Description: REEP1 Antibody detects endogenous levels of REEP1. |
REEP1 Antibody |
|
1-CSB-PA862045DSR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
REEP1 Antibody |
|
1-CSB-PA862045DSR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
REEP1 Antibody |
|
1-CSB-PA019540GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 anti- REEP1 antibody |
|
FNab07229 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: receptor accessory protein 1
- Uniprot ID: Q9H902
- Gene ID: 65055
- Research Area: Metabolism
|
|
Description: Antibody raised against REEP1 |
 Anti-REEP1 antibody |
|
STJ110142 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants. |
Anti-REEP1 antibody |
|
STJ192598 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to REEP1 |
 REEP1 siRNA |
|
20-abx931216 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
REEP1 siRNA |
|
20-abx931217 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Monoclonal antibody for REEP1 |
|
SMC-480D |
Stressmarq |
0.1mg |
EUR 353 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is not conjugated. |
Monoclonal antibody for REEP1 |
|
SMC-480D-A390 |
Stressmarq |
0.1mg |
EUR 400 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 390. |
Monoclonal antibody for REEP1 |
|
SMC-480D-A488 |
Stressmarq |
0.1mg |
EUR 399 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 488. |
Monoclonal antibody for REEP1 |
|
SMC-480D-A565 |
Stressmarq |
0.1mg |
EUR 399 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 565. |
Monoclonal antibody for REEP1 |
|
SMC-480D-A594 |
Stressmarq |
0.1mg |
EUR 399 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 594. |
Monoclonal antibody for REEP1 |
|
SMC-480D-A633 |
Stressmarq |
0.1mg |
EUR 399 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 633. |
Monoclonal antibody for REEP1 |
|
SMC-480D-A655 |
Stressmarq |
0.1mg |
EUR 399 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 655. |
Monoclonal antibody for REEP1 |
|
SMC-480D-A680 |
Stressmarq |
0.1mg |
EUR 399 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 680. |
Monoclonal antibody for REEP1 |
|
SMC-480D-A700 |
Stressmarq |
0.1mg |
EUR 399 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 700. |
Monoclonal antibody for REEP1 |
|
SMC-480D-ALP |
Stressmarq |
0.1mg |
EUR 393 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for REEP1 |
|
SMC-480D-APC |
Stressmarq |
0.1mg |
EUR 398 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with APC. |
Monoclonal antibody for REEP1 |
|
SMC-480D-APCCY7 |
Stressmarq |
0.1mg |
EUR 470 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with APC/Cy7. |
Monoclonal antibody for REEP1 |
|
SMC-480D-BI |
Stressmarq |
0.1mg |
EUR 395 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Biotin. |
Monoclonal antibody for REEP1 |
|
SMC-480D-DY350 |
Stressmarq |
0.1mg |
EUR 413 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 350. |
Monoclonal antibody for REEP1 |
|
SMC-480D-DY405 |
Stressmarq |
0.1mg |
EUR 402 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 405. |
Monoclonal antibody for REEP1 |
|
SMC-480D-DY488 |
Stressmarq |
0.1mg |
EUR 392 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 488. |
Monoclonal antibody for REEP1 |
|
SMC-480D-DY594 |
Stressmarq |
0.1mg |
EUR 394 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 594. |
Monoclonal antibody for REEP1 |
|
SMC-480D-DY633 |
Stressmarq |
0.1mg |
EUR 389 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 633. |
Monoclonal antibody for REEP1 |
|
SMC-480D-FITC |
Stressmarq |
0.1mg |
EUR 391 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with FITC. |
Monoclonal antibody for REEP1 |
|
SMC-480D-HRP |
Stressmarq |
0.1mg |
EUR 387 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with HRP. |
Monoclonal antibody for REEP1 |
|
SMC-480D-P594 |
Stressmarq |
0.1mg |
EUR 406 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with PE/ATTO 594. |
Monoclonal antibody for REEP1 |
|
SMC-480D-PCP |
Stressmarq |
0.1mg |
EUR 398 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with PerCP. |
Monoclonal antibody for REEP1 |
|
SMC-480D-RPE |
Stressmarq |
0.1mg |
EUR 396 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with RPE. |
Monoclonal antibody for REEP1 |
|
SMC-480D-STR |
Stressmarq |
0.1mg |
EUR 397 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Streptavidin. |
Monoclonal antibody for REEP1 |
|
SMC-480S |
Stressmarq |
0.012mg |
EUR 65 |
- REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
- Show more
|
|
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is not conjugated. |
 REEP1 Blocking Peptide |
|
33R-1288 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADCYAP1R1 antibody, catalog no. 70R-9939 |
REEP1 Blocking Peptide |
|
33R-2704 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of REEP1 antibody, catalog no. 70R-7467 |
 REEP1 cloning plasmid |
|
CSB-CL862045HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 606
- Sequence: atggtgtcatggatcatctccaggctggtggtgcttatatttggcaccctttaccctgcgtattattcctacaaggctgtgaaatcaaaggacattaaggaatatgtcaaatggatgatgtactggattatatttgcacttttcaccacagcagagacattcacagacatcttcct
- Show more
|
|
Description: A cloning plasmid for the REEP1 gene. |
REEP1 Blocking Peptide |
|
DF12719-BP |
Affbiotech |
1mg |
EUR 195 |
 Monoclonal antibody for REEP1/2 |
|
SMC-482D |
Stressmarq |
0.1mg |
EUR 353 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is not conjugated. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-A390 |
Stressmarq |
0.1mg |
EUR 400 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 390. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-A488 |
Stressmarq |
0.1mg |
EUR 399 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 488. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-A565 |
Stressmarq |
0.1mg |
EUR 399 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 565. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-A594 |
Stressmarq |
0.1mg |
EUR 399 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 594. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-A633 |
Stressmarq |
0.1mg |
EUR 399 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 633. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-A655 |
Stressmarq |
0.1mg |
EUR 399 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 655. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-A680 |
Stressmarq |
0.1mg |
EUR 399 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 680. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-A700 |
Stressmarq |
0.1mg |
EUR 399 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 700. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-ALP |
Stressmarq |
0.1mg |
EUR 393 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-APC |
Stressmarq |
0.1mg |
EUR 398 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with APC. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-APCCY7 |
Stressmarq |
0.1mg |
EUR 470 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with APC/Cy7. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-BI |
Stressmarq |
0.1mg |
EUR 395 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Biotin. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-DY350 |
Stressmarq |
0.1mg |
EUR 413 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 350. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-DY405 |
Stressmarq |
0.1mg |
EUR 402 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 405. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-DY488 |
Stressmarq |
0.1mg |
EUR 392 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 488. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-DY594 |
Stressmarq |
0.1mg |
EUR 394 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 594. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-DY633 |
Stressmarq |
0.1mg |
EUR 389 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 633. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-FITC |
Stressmarq |
0.1mg |
EUR 391 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with FITC. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-HRP |
Stressmarq |
0.1mg |
EUR 387 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with HRP. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-P594 |
Stressmarq |
0.1mg |
EUR 406 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with PE/ATTO 594. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-PCP |
Stressmarq |
0.1mg |
EUR 398 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with PerCP. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-RPE |
Stressmarq |
0.1mg |
EUR 396 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with RPE. |
Monoclonal antibody for REEP1/2 |
|
SMC-482D-STR |
Stressmarq |
0.1mg |
EUR 397 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Streptavidin. |
Monoclonal antibody for REEP1/2 |
|
SMC-482S |
Stressmarq |
0.012mg |
EUR 65 |
|
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is not conjugated. |
 Antibody) Receptor Accessory Protein 1 (REEP1) Antibody |
|
20-abx115085 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Receptor Accessory Protein 1 (REEP1) Antibody |
|
20-abx142193 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Receptor Accessory Protein 1 (REEP1) Antibody |
|
20-abx007076 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Receptor Accessory Protein 1 (REEP1) Antibody |
|
20-abx322525 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Receptor Accessory Protein 1 (REEP1) Antibody |
|
20-abx322526 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Receptor Accessory Protein 1 (REEP1) Antibody |
|
abx445089-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
Receptor Accessory Protein 1 (REEP1) Antibody |
|
abx237229-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 Mouse REEP1 shRNA Plasmid |
|
20-abx974224 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human REEP1 shRNA Plasmid |
|
20-abx962166 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) REEP1 Recombinant Protein (Human) |
|
RP026134 |
ABM |
100 ug |
Ask for price |
) REEP1 Recombinant Protein (Rat) |
|
RP224024 |
ABM |
100 ug |
Ask for price |
) REEP1 Recombinant Protein (Mouse) |
|
RP167513 |
ABM |
100 ug |
Ask for price |
 Antibody (ALP)) Receptor Accessory Protein 1 (REEP1) Antibody (ALP) |
|
abx442486-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (APC)) Receptor Accessory Protein 1 (REEP1) Antibody (APC) |
|
abx442767-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (Biotin)) Receptor Accessory Protein 1 (REEP1) Antibody (Biotin) |
|
abx443047-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (FITC)) Receptor Accessory Protein 1 (REEP1) Antibody (FITC) |
|
abx443327-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
 Antibody (HRP)) Receptor Accessory Protein 1 (REEP1) Antibody (HRP) |
|
abx443608-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
 Antibody (PerCP)) Receptor Accessory Protein 1 (REEP1) Antibody (PerCP) |
|
abx444170-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (RPE)) Receptor Accessory Protein 1 (REEP1) Antibody (RPE) |
|
abx444451-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (Streptavidin)) Receptor Accessory Protein 1 (REEP1) Antibody (Streptavidin) |
|
abx444732-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 (pORF)) REEP1 ORF Vector (Human) (pORF) |
|
ORF008712 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Reep1 ORF Vector (Rat) (pORF) |
|
ORF074676 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Reep1 ORF Vector (Mouse) (pORF) |
|
ORF055839 |
ABM |
1.0 ug DNA |
EUR 506 |
 Antibody (ATTO 390)) Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 390) |
|
abx440238-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 488)) Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 488) |
|
abx440519-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 565)) Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 565) |
|
abx440800-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 594)) Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 594) |
|
abx441081-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 633)) Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 633) |
|
abx441362-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 655)) Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 655) |
|
abx441643-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 680)) Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 680) |
|
abx441924-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 700)) Receptor Accessory Protein 1 (REEP1) Antibody (ATTO 700) |
|
abx442205-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
) REEP1 sgRNA CRISPR Lentivector set (Human) |
|
K1806501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Reep1 sgRNA CRISPR Lentivector set (Rat) |
|
K6152501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Reep1 sgRNA CRISPR Lentivector set (Mouse) |
|
K3329701 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody (PE/ATTO 594)) Receptor Accessory Protein 1 (REEP1) Antibody (PE/ATTO 594) |
|
abx443889-100ug |
Abbexa |
100 ug |
EUR 592 |
- Shipped within 5-12 working days.
|
 Antibody) Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody |
|
abx445091-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
 (Target 1)) REEP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1806502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) REEP1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1806503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) REEP1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1806504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Reep1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6152502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Reep1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6152503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Reep1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6152504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Reep1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3329702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Reep1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3329703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Reep1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3329704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) REEP1 Protein Vector (Human) (pPB-C-His) |
|
PV034845 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) REEP1 Protein Vector (Human) (pPB-N-His) |
|
PV034846 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) REEP1 Protein Vector (Human) (pPM-C-HA) |
|
PV034847 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) REEP1 Protein Vector (Human) (pPM-C-His) |
|
PV034848 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) REEP1 Protein Vector (Rat) (pPB-C-His) |
|
PV298702 |
ABM |
500 ng |
EUR 1166 |
 (pPB-N-His)) REEP1 Protein Vector (Rat) (pPB-N-His) |
|
PV298703 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-HA)) REEP1 Protein Vector (Rat) (pPM-C-HA) |
|
PV298704 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-His)) REEP1 Protein Vector (Rat) (pPM-C-His) |
|
PV298705 |
ABM |
500 ng |
EUR 1166 |
 (pPB-C-His)) REEP1 Protein Vector (Mouse) (pPB-C-His) |
|
PV223354 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) REEP1 Protein Vector (Mouse) (pPB-N-His) |
|
PV223355 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) REEP1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV223356 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) REEP1 Protein Vector (Mouse) (pPM-C-His) |
|
PV223357 |
ABM |
500 ng |
EUR 603 |
 Reep1 3'UTR GFP Stable Cell Line |
|
TU167699 |
ABM |
1.0 ml |
Ask for price |
 REEP1 3'UTR Luciferase Stable Cell Line |
|
TU019729 |
ABM |
1.0 ml |
EUR 2333 |
 Reep1 3'UTR Luciferase Stable Cell Line |
|
TU117699 |
ABM |
1.0 ml |
Ask for price |
 REEP1 3'UTR GFP Stable Cell Line |
|
TU069729 |
ABM |
1.0 ml |
EUR 2333 |
Reep1 3'UTR GFP Stable Cell Line |
|
TU267455 |
ABM |
1.0 ml |
Ask for price |
Reep1 3'UTR Luciferase Stable Cell Line |
|
TU217455 |
ABM |
1.0 ml |
Ask for price |
 Antibody (ALP)) Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (ALP) |
|
abx442488-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (APC)) Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (APC) |
|
abx442769-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (Biotin)) Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (Biotin) |
|
abx443049-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (FITC)) Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (FITC) |
|
abx443329-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
 Antibody (HRP)) Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (HRP) |
|
abx443610-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
 Antibody (PerCP)) Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (PerCP) |
|
abx444172-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (RPE)) Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (RPE) |
|
abx444453-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (Streptavidin)) Receptor Expression-Enhancing Protein 1/2 (REEP1/2) Antibody (Streptavidin) |
|
abx444734-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
REEP1 Rabbit Polyclonal Antibody
