REG1B Rabbit Polyclonal Antibody

REG1B Rabbit Polyclonal Antibody

REG1B antibody
70R-19852 50 ul
EUR 435
Description: Rabbit polyclonal REG1B antibody

REG1B Antibody
47386-100ul 100ul
EUR 252

REG1B antibody
70R-5333 50 ug
EUR 467
Description: Rabbit polyclonal REG1B antibody raised against the N terminal of REG1B

REG1B Antibody
1-CSB-PA019547GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against REG1B. Recognizes REG1B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Human Regenerating Islet Derived Protein 1 Beta (REG1b) ELISA Kit
DLR-REG1b-Hu-48T 48T
EUR 517
  • Should the Human Regenerating Islet Derived Protein 1 Beta (REG1b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Regenerating Islet Derived Protein 1 Beta (REG1b) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Regenerating Islet Derived Protein 1 Beta (REG1b) ELISA Kit
DLR-REG1b-Hu-96T 96T
EUR 673
  • Should the Human Regenerating Islet Derived Protein 1 Beta (REG1b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Regenerating Islet Derived Protein 1 Beta (REG1b) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Regenerating Islet Derived Protein 1 Beta (REG1b) ELISA Kit
RDR-REG1b-Hu-48Tests 48 Tests
EUR 544

Human Regenerating Islet Derived Protein 1 Beta (REG1b) ELISA Kit
RDR-REG1b-Hu-96Tests 96 Tests
EUR 756

Human Regenerating Islet Derived Protein 1 Beta (REG1b) ELISA Kit
RD-REG1b-Hu-48Tests 48 Tests
EUR 521

Human Regenerating Islet Derived Protein 1 Beta (REG1b) ELISA Kit
RD-REG1b-Hu-96Tests 96 Tests
EUR 723

REG1B Conjugated Antibody
C47386 100ul
EUR 397

Anti-REG1B antibody
STJ192254 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to REG1B

REG1B Protein
20-abx262151
  • EUR 328.00
  • EUR 5311.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

REG1B siRNA
20-abx931229
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

REG1B Blocking Peptide
33R-5728 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of REG1B antibody, catalog no. 70R-5333

REG1B cloning plasmid
CSB-CL019547HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 501
  • Sequence: atggctcagaccaactcgttcttcatgctgatctcctccctgatgttcctgtctctgagccaaggccaggagtcccagacagagctgcctaatccccgaatcagctgcccagaaggcaccaatgcctatcgctcctactgctactactttaatgaagaccctgagacctgggttga
  • Show more
Description: A cloning plasmid for the REG1B gene.

Human REG1B shRNA Plasmid
20-abx954039
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-REG1B Plasmid
PVT16380 2 ug
EUR 325

REG1B Recombinant Protein (Human)
RP026155 100 ug Ask for price

Regenerating Islet Derived Protein 1 Beta (REG1b) Polyclonal Antibody (Human, Mouse)
4-PAE674Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REG1b (Gln23~Asn166)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Regenerating Islet Derived Protein 1 Beta (REG1b)

REG1B ORF Vector (Human) (pORF)
ORF008719 1.0 ug DNA
EUR 95

REG1B ELISA Kit (Human) (OKCD08682)
OKCD08682 96 Wells
EUR 975
Description: Description of target: REG1B might act as an inhibitor of spontaneous calcium carbonate precipitation. REG1B may be associated with neuronal sprouting in brain, and with brain and pancreas regeneration.This gene is a type I subclass member of the Reg gene family. The Reg gene family is a multigene family grouped into four subclasses, types I, II, III and IV based on the primary structures of the encoded proteins. This gene encodes a protein secreted by the exocrine pancreas that is highly similar to the REG1A protein. The related REG1A protein is associated with islet cell regeneration and diabetogenesis, and may be involved in pancreatic lithogenesis. Reg family members REG1A, REGL, PAP and this gene are tandemly clustered on chromosome 2p12 and may have arisen from the same ancestral gene by gene duplication. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.65ng/mL

Rabbit Regenerating Islet Derived Protein 1 Beta (REG1b) ELISA Kit
abx362955-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Regenerating Islet Derived Protein 1 Beta (REG1b) Polyclonal Antibody (Human, Mouse), APC
4-PAE674Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REG1b (Gln23~Asn166)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Regenerating Islet Derived Protein 1 Beta (REG1b). This antibody is labeled with APC.

Regenerating Islet Derived Protein 1 Beta (REG1b) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAE674Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REG1b (Gln23~Asn166)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Regenerating Islet Derived Protein 1 Beta (REG1b). This antibody is labeled with Biotin.

Regenerating Islet Derived Protein 1 Beta (REG1b) Polyclonal Antibody (Human, Mouse), Cy3
4-PAE674Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REG1b (Gln23~Asn166)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Regenerating Islet Derived Protein 1 Beta (REG1b). This antibody is labeled with Cy3.

Regenerating Islet Derived Protein 1 Beta (REG1b) Polyclonal Antibody (Human, Mouse), FITC
4-PAE674Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REG1b (Gln23~Asn166)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Regenerating Islet Derived Protein 1 Beta (REG1b). This antibody is labeled with FITC.

Regenerating Islet Derived Protein 1 Beta (REG1b) Polyclonal Antibody (Human, Mouse), HRP
4-PAE674Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REG1b (Gln23~Asn166)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Regenerating Islet Derived Protein 1 Beta (REG1b). This antibody is labeled with HRP.

Regenerating Islet Derived Protein 1 Beta (REG1b) Polyclonal Antibody (Human, Mouse), PE
4-PAE674Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REG1b (Gln23~Asn166)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Regenerating Islet Derived Protein 1 Beta (REG1b). This antibody is labeled with PE.

Regenerating Islet Derived Protein 1 Beta (REG1b) Antibody
20-abx178229
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Regenerating Islet Derived Protein 1 Beta (REG1b) Antibody
20-abx178230
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Regenerating Islet Derived Protein 1 Beta (REG1B) Antibody
20-abx115096
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Regenerating Islet Derived Protein 1 Beta (REG1b) Antibody
20-abx128637
  • EUR 314.00
  • EUR 133.00
  • EUR 815.00
  • EUR 425.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Regenerating Islet Derived Protein 1 Beta (REG1b) Antibody
20-abx174354
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

REG1B sgRNA CRISPR Lentivector set (Human)
K1807201 3 x 1.0 ug
EUR 339

Regenerating Islet Derived Protein 1 Beta (REG1b) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAE674Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REG1b (Gln23~Asn166)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Regenerating Islet Derived Protein 1 Beta (REG1b). This antibody is labeled with APC-Cy7.

Regenerating Islet Derived Protein 1 Beta (REG1b) Antibody Pair
20-abx370611
  • EUR 1748.00
  • EUR 1121.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Human Lithostathine-1-beta(REG1B) ELISA kit
CSB-EL019547HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Lithostathine-1-beta (REG1B) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Lithostathine-1-beta(REG1B) ELISA kit
1-CSB-EL019547HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Lithostathine-1-beta(REG1B) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Lithostathine-1-beta, REG1B ELISA Kit
ELA-E0323h 96 Tests
EUR 824

Human REG1B/ Lithostathine-1-beta ELISA Kit
E2135Hu 1 Kit
EUR 571

REG1B sgRNA CRISPR Lentivector (Human) (Target 1)
K1807202 1.0 ug DNA
EUR 154

REG1B sgRNA CRISPR Lentivector (Human) (Target 2)
K1807203 1.0 ug DNA
EUR 154

REG1B sgRNA CRISPR Lentivector (Human) (Target 3)
K1807204 1.0 ug DNA
EUR 154

REG1B Protein Vector (Human) (pPB-C-His)
PV034873 500 ng
EUR 329

REG1B Protein Vector (Human) (pPB-N-His)
PV034874 500 ng
EUR 329

REG1B Protein Vector (Human) (pPM-C-HA)
PV034875 500 ng
EUR 329

REG1B Protein Vector (Human) (pPM-C-His)
PV034876 500 ng
EUR 329

Recombinant Human REG1B Protein, His, E.coli-10ug
QP13293-10ug 10ug
EUR 201

Recombinant Human REG1B Protein, His, E.coli-1mg
QP13293-1mg 1mg
EUR 3954

Recombinant Human REG1B Protein, His, E.coli-2ug
QP13293-2ug 2ug
EUR 155

REG1B 3'UTR GFP Stable Cell Line
TU069736 1.0 ml
EUR 1394

REG1B 3'UTR Luciferase Stable Cell Line
TU019736 1.0 ml
EUR 1394

REG1B ELISA Kit (Human) : 96 Wells (OKEH00380)
OKEH00380 96 Wells
EUR 662
Description: Description of target: Might act as an inhibitor of spontaneous calcium carbonate precipitation. May be associated with neuronal sprouting in brain, and with brain and pancreas regeneration.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

Recombinant Regenerating Islet Derived Protein 1 Beta (REG1b)
4-RPE674Hu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P48304
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.9kDa
  • Isoelectric Point: 7.1
Description: Recombinant Human Regenerating Islet Derived Protein 1 Beta expressed in: E.coli

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

REG1B Rabbit Polyclonal Antibody