
셀타젠 Genetic Genotyping

RSPO3 Rabbit Polyclonal Antibody

RSPO3 Rabbit Polyclonal Antibody

RSPO3 Polyclonal Antibody

ABP60272-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RSPO3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RSPO3 from Human, Mouse. This RSPO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO3 protein

RSPO3 Polyclonal Antibody

ABP60272-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RSPO3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RSPO3 from Human, Mouse. This RSPO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO3 protein

RSPO3 Polyclonal Antibody

ABP60272-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RSPO3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RSPO3 from Human, Mouse. This RSPO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO3 protein

RSPO3 Polyclonal Antibody

ES11202-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RSPO3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RSPO3 Polyclonal Antibody

ES11202-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RSPO3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human R-Spondin 3 (RSPO3) ELISA Kit

DLR-RSPO3-Hu-48T 48T
EUR 554
  • Should the Human R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human R-Spondin 3 (RSPO3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human R-Spondin 3 (RSPO3) ELISA Kit

DLR-RSPO3-Hu-96T 96T
EUR 725
  • Should the Human R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human R-Spondin 3 (RSPO3) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse R-Spondin 3 (RSPO3) ELISA Kit

DLR-RSPO3-Mu-48T 48T
EUR 566
  • Should the Mouse R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse R-Spondin 3 (RSPO3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse R-Spondin 3 (RSPO3) ELISA Kit

DLR-RSPO3-Mu-96T 96T
EUR 741
  • Should the Mouse R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse R-Spondin 3 (RSPO3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human R-Spondin 3 (RSPO3) ELISA Kit

RDR-RSPO3-Hu-48Tests 48 Tests
EUR 589

Human R-Spondin 3 (RSPO3) ELISA Kit

RDR-RSPO3-Hu-96Tests 96 Tests
EUR 820

Human R-Spondin 3 (RSPO3) ELISA Kit

RD-RSPO3-Hu-48Tests 48 Tests
EUR 563

Human R-Spondin 3 (RSPO3) ELISA Kit

RD-RSPO3-Hu-96Tests 96 Tests
EUR 783

Mouse R-Spondin 3 (RSPO3) ELISA Kit

RD-RSPO3-Mu-48Tests 48 Tests
EUR 577

Mouse R-Spondin 3 (RSPO3) ELISA Kit

RD-RSPO3-Mu-96Tests 96 Tests
EUR 802

RSPO3 Rabbit pAb

A8389-100ul 100 ul
EUR 308

RSPO3 Rabbit pAb

A8389-200ul 200 ul
EUR 459

RSPO3 Rabbit pAb

A8389-20ul 20 ul
EUR 183

RSPO3 Rabbit pAb

A8389-50ul 50 ul
EUR 223

RSPO3 Polyclonal Conjugated Antibody

C31537 100ul
EUR 397

RSPO3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RSPO3 Antibody

DF12728 200ul
EUR 304
Description: RSPO3 Antibody detects endogenous levels of RSPO3.

Polyclonal RSPO3 Antibody (C-Term)

APR04974G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RSPO3 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal RSPO3 Antibody (internal region)

APG00723G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RSPO3 (internal region). This antibody is tested and proven to work in the following applications:

RSPO3 Polyclonal Antibody, HRP Conjugated

A67931 100 µg
EUR 570.55
Description: fast delivery possible

RSPO3 Polyclonal Antibody, FITC Conjugated

A67932 100 µg
EUR 570.55
Description: reagents widely cited

RSPO3 Polyclonal Antibody, Biotin Conjugated

A67933 100 µg
EUR 570.55
Description: Ask the seller for details

RSPO3 Polyclonal Antibody, Biotin Conjugated

A60723 100 µg
EUR 570.55
Description: kits suitable for this type of research

RSPO3 Polyclonal Antibody, FITC Conjugated

A60724 100 µg
EUR 570.55
Description: fast delivery possible

RSPO3 Polyclonal Antibody, HRP Conjugated

A60725 100 µg
EUR 570.55
Description: reagents widely cited

anti- RSPO3 antibody

FNab07512 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:100-1:400
  • Immunogen: R-spondin 3 homolog
  • Uniprot ID: Q9BXY4
  • Gene ID: 84870
  • Research Area: Neuroscience
Description: Antibody raised against RSPO3

Anti-RSPO3 antibody

PAab07512 100 ug
EUR 386

Anti-RSPO3 antibody

STJ110687 100 µl
EUR 277
Description: This gene belongs to the R-spondin family. The encoded protein plays a role in the regulation of Wnt (wingless-type MMTV integration site family)/beta-catenin and Wnt/planar cell polarity (PCP) signaling pathways, which are involved in development, cell growth and disease pathogenesis. Genome-wide association studies suggest a correlation of this gene with bone mineral density and risk of fracture. This gene may be involved in tumor development.

Anti-RSPO3 antibody

STJ192360 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RSPO3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RSPO3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RSPO3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RSPO3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig)

  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3)

RSPO3 Blocking Peptide

DF12728-BP 1mg
EUR 195

RSPO3 cloning plasmid

CSB-CL887154HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 819
  • Sequence: atgcacttgcgactgatttcttggctttttatcattttgaactttatggaatacatcggcagccaaaacgcctcccggggaaggcgccagcgaagaatgcatcctaacgttagtcaaggctgccaaggaggctgtgcaacatgctcagattacaatggatgtttgtcatgtaagcc
  • Show more
Description: A cloning plasmid for the RSPO3 gene.

R-Spondin 3 (RSPO3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

R-Spondin 3 (RSPO3) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

R-Spondin 3 (RSPO3) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

R-Spondin 3 (RSPO3) Antibody

abx237512-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

R-Spondin 3 (RSPO3) Antibody

abx432159-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

R-Spondin 3 (RSPO3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), APC

  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with APC.

R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), Biotinylated

  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with Biotin.

R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), Cy3

  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with Cy3.

R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), FITC

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with FITC.

R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), HRP

  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with HRP.

R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), PE

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with PE.

R-Spondin 3 (RSPO3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

R-Spondin 3 (RSPO3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

R-Spondin 3 (RSPO3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


EF002662 96 Tests
EUR 689

Mouse RSPO3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RSPO3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RSPO3 Recombinant Protein (Human)

RP027346 100 ug Ask for price

RSPO3 Recombinant Protein (Rat)

RP227030 100 ug Ask for price

RSPO3 Recombinant Protein (Mouse)

RP169490 100 ug Ask for price

R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), APC-Cy7

  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with APC-Cy7.

Rspo3 ORF Vector (Rat) (pORF)

ORF075678 1.0 ug DNA
EUR 506

RSPO3 ORF Vector (Human) (pORF)

ORF009116 1.0 ug DNA
EUR 95

Rspo3 ORF Vector (Mouse) (pORF)

ORF056498 1.0 ug DNA
EUR 506

Recombinant R-Spondin 3 (RSPO3)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9BXY4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human R-Spondin 3 expressed in: E.coli

RSPO3 Rabbit Polyclonal Antibody