RTN4R Rabbit Polyclonal Antibody
RTN4R Polyclonal Antibody |
ES11347-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RTN4R from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RTN4R Polyclonal Antibody |
ES11347-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RTN4R from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RTN4R Rabbit pAb |
A5847-100ul |
Abclonal |
100 ul |
EUR 308 |
RTN4R Rabbit pAb |
A5847-200ul |
Abclonal |
200 ul |
EUR 459 |
RTN4R Rabbit pAb |
A5847-20ul |
Abclonal |
20 ul |
EUR 183 |
RTN4R Rabbit pAb |
A5847-50ul |
Abclonal |
50 ul |
EUR 223 |
RTN4R antibody |
70R-20040 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RTN4R antibody |
RTN4R Antibody |
33085-100ul |
SAB |
100ul |
EUR 252 |
RTN4R Antibody |
1-CSB-PA880152ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against RTN4R. Recognizes RTN4R from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
RTN4R Antibody |
1-CSB-PA580390 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RTN4R. Recognizes RTN4R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
RTN4R antibody |
70R-51087 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal RTN4R antibody |
RTN4R Antibody |
1-CSB-PA020574GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against RTN4R. Recognizes RTN4R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
RTN4R Conjugated Antibody |
C33085 |
SAB |
100ul |
EUR 397 |
Anti-RTN4R antibody |
STJ28410 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes the receptor for reticulon 4, oligodendrocyte myelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system. |
Anti-RTN4R antibody |
STJ192505 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RTN4R |
RTN4R siRNA |
20-abx904742 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RTN4R siRNA |
20-abx932260 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RTN4R siRNA |
20-abx932261 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RTN4R Blocking Peptide |
20-abx063962 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RTN4R cloning plasmid |
CSB-CL880152HU-10ug |
Cusabio |
10ug |
EUR 507 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1422
- Sequence: atgaagagggcgtccgctggagggagccggctgctggcatgggtgctgtggctgcaggcctggcaggtggcagccccatgcccaggtgcctgcgtatgctacaatgagcccaaggtgacgacaagctgcccccagcagggcctgcaggctgtgcccgtgggcatccctgctgcca
- Show more
|
Description: A cloning plasmid for the RTN4R gene. |
Reticulon 4 Receptor (RTN4R) Antibody |
20-abx008053 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Reticulon 4 Receptor (RTN4R) Antibody |
20-abx004484 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Reticulon 4 Receptor (RTN4R) Antibody |
20-abx115139 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Reticulon 4 Receptor (RTN4R) Antibody |
20-abx241707 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Reticulon 4 Receptor (RTN4R) Antibody |
20-abx321708 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mouse RTN4R shRNA Plasmid |
20-abx975322 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat RTN4R shRNA Plasmid |
20-abx987116 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RTN4R shRNA Plasmid |
20-abx962173 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RTN4R Recombinant Protein (Human) |
RP027400 |
ABM |
100 ug |
Ask for price |
RTN4R Recombinant Protein (Rat) |
RP227240 |
ABM |
100 ug |
Ask for price |
RTN4R Recombinant Protein (Mouse) |
RP169604 |
ABM |
100 ug |
Ask for price |
Mouse RTN4R PicoKine ELISA Kit |
EK2066 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse RTN4R in cell culture supernates, serum and plasma (heparin, EDTA, citrate). |
Rtn4r ORF Vector (Rat) (pORF) |
ORF075748 |
ABM |
1.0 ug DNA |
EUR 506 |
RTN4R ORF Vector (Human) (pORF) |
ORF009134 |
ABM |
1.0 ug DNA |
EUR 95 |
Rtn4r ORF Vector (Mouse) (pORF) |
ORF056536 |
ABM |
1.0 ug DNA |
EUR 506 |
RTN4R ELISA Kit (Human) (OKCD01887) |
OKCD01887 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Receptor for RTN4, OMG and MAG. Signaling mediates activation of Rho and downstream reorganization of the actin cytoskeleton. Mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system. Acts in conjunction with RTN4 and LINGO1 in regulating neuronal precursor cell motility during cortical development.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.123 ng/mL |
Rtn4r ELISA Kit (Mouse) (OKBB01433) |
OKBB01433 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Reticulon 4 receptor (RTN4R) also known as Nogo-66 Receptor (NgR) or Nogo receptor 1 is a protein which in humans is encoded by the RTN4R gene. It is mapped to 16; 16 A3. This gene encodes the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml |
RTN4R ELISA Kit (Human) (OKCA02140) |
OKCA02140 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: Receptor for RTN4, OMG and MAG. Signaling mediates activation of Rho and downstream reorganization of the actin cytoskeleton. Mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system. Acts in conjunction with RTN4 and LINGO1 in regulating neuronal precursor cell motility during cortical development.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7 pg/mL |
Rtn4r sgRNA CRISPR Lentivector set (Rat) |
K7066201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rtn4r sgRNA CRISPR Lentivector set (Mouse) |
K4654301 |
ABM |
3 x 1.0 ug |
EUR 339 |
RTN4R sgRNA CRISPR Lentivector set (Human) |
K2076801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Reticulon 4 Receptor (RTN4R) ELISA Kit |
20-abx156874 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Reticulon- 4 receptor, Rtn4r ELISA KIT |
ELI-18409m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Reticulon- 4 receptor, RTN4R ELISA KIT |
ELI-29471h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Reticulon 4 Receptor (RTN4R) CLIA Kit |
20-abx495072 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rtn4r sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7066202 |
ABM |
1.0 ug DNA |
EUR 154 |
Rtn4r sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7066203 |
ABM |
1.0 ug DNA |
EUR 154 |
Rtn4r sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7066204 |
ABM |
1.0 ug DNA |
EUR 154 |
Rtn4r sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4654302 |
ABM |
1.0 ug DNA |
EUR 154 |
Rtn4r sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4654303 |
ABM |
1.0 ug DNA |
EUR 154 |
Rtn4r sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4654304 |
ABM |
1.0 ug DNA |
EUR 154 |
RTN4R sgRNA CRISPR Lentivector (Human) (Target 1) |
K2076802 |
ABM |
1.0 ug DNA |
EUR 154 |
RTN4R sgRNA CRISPR Lentivector (Human) (Target 2) |
K2076803 |
ABM |
1.0 ug DNA |
EUR 154 |
RTN4R sgRNA CRISPR Lentivector (Human) (Target 3) |
K2076804 |
ABM |
1.0 ug DNA |
EUR 154 |
RTN4R Reticulon 4 Receptor Human Recombinant Protein |
PROTQ9BZR6 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: RTN4R produced in Sf9 Baculovirus cells is a single,glycosylated polypeptide chain containing 429 amino acids (27-447 a.a.) andhaving a molecular mass of 46.3kDa (Molecular size on SDS-PAGE will appear atapproximately 40-57 kDa). RTN4R is expressed with a 8 amino acid His tag atC-Terminus and purified by proprietary chromatographic techniques. |
RTN4R Protein Vector (Rat) (pPB-C-His) |
PV302990 |
ABM |
500 ng |
EUR 603 |
RTN4R Protein Vector (Rat) (pPB-N-His) |
PV302991 |
ABM |
500 ng |
EUR 603 |
RTN4R Protein Vector (Rat) (pPM-C-HA) |
PV302992 |
ABM |
500 ng |
EUR 603 |
RTN4R Protein Vector (Rat) (pPM-C-His) |
PV302993 |
ABM |
500 ng |
EUR 603 |
RTN4R Protein Vector (Mouse) (pPB-C-His) |
PV226142 |
ABM |
500 ng |
EUR 603 |
RTN4R Protein Vector (Mouse) (pPB-N-His) |
PV226143 |
ABM |
500 ng |
EUR 603 |
RTN4R Protein Vector (Mouse) (pPM-C-HA) |
PV226144 |
ABM |
500 ng |
EUR 603 |
RTN4R Protein Vector (Mouse) (pPM-C-His) |
PV226145 |
ABM |
500 ng |
EUR 603 |
RTN4R Protein Vector (Human) (pPB-C-His) |
PV036533 |
ABM |
500 ng |
EUR 329 |
RTN4R Protein Vector (Human) (pPB-N-His) |
PV036534 |
ABM |
500 ng |
EUR 329 |
RTN4R Protein Vector (Human) (pPM-C-HA) |
PV036535 |
ABM |
500 ng |
EUR 329 |
RTN4R Protein Vector (Human) (pPM-C-His) |
PV036536 |
ABM |
500 ng |
EUR 329 |
Recombinant Human RTN4R Protein, His, Insect-10ug |
QP13370-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human RTN4R Protein, His, Insect-1mg |
QP13370-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Human RTN4R Protein, His, Insect-2ug |
QP13370-2ug |
EnQuireBio |
2ug |
EUR 155 |
Rtn4r 3'UTR Luciferase Stable Cell Line |
TU118245 |
ABM |
1.0 ml |
Ask for price |
Human Reticulon 4 Receptor (RTN4R) ELISA Kit |
SEF991Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids. |
Human Reticulon 4 Receptor (RTN4R) ELISA Kit |
SEF991Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids. |
Human Reticulon 4 Receptor (RTN4R) ELISA Kit |
SEF991Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids. |
Human Reticulon 4 Receptor (RTN4R) ELISA Kit |
SEF991Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids. |
Human Reticulon 4 Receptor (RTN4R) ELISA Kit |
4-SEF991Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Reticulon 4 Receptor elisa. Alternative names of the recognized antigen: NGR
- NOGOR
- Nogo-66 Receptor
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulon 4 Receptor (RTN4R) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rtn4r 3'UTR GFP Stable Cell Line |
TU168245 |
ABM |
1.0 ml |
Ask for price |
Rtn4r 3'UTR Luciferase Stable Cell Line |
TU219831 |
ABM |
1.0 ml |
Ask for price |
Rtn4r 3'UTR GFP Stable Cell Line |
TU269831 |
ABM |
1.0 ml |
Ask for price |
RTN4R Rabbit Polyclonal Antibody