CelltaGen

셀타젠 Genetic Genotyping

SALL4 Rabbit Polyclonal Antibody

SALL4 Rabbit Polyclonal Antibody

SALL4 Polyclonal Antibody

ABP60322-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SALL4 protein at amino acid sequence of 891-940
  • Applications tips:
Description: A polyclonal antibody for detection of SALL4 from Human, Mouse. This SALL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SALL4 protein at amino acid sequence of 891-940

SALL4 Polyclonal Antibody

ABP60322-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SALL4 protein at amino acid sequence of 891-940
  • Applications tips:
Description: A polyclonal antibody for detection of SALL4 from Human, Mouse. This SALL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SALL4 protein at amino acid sequence of 891-940

SALL4 Polyclonal Antibody

ABP60322-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SALL4 protein at amino acid sequence of 891-940
  • Applications tips:
Description: A polyclonal antibody for detection of SALL4 from Human, Mouse. This SALL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SALL4 protein at amino acid sequence of 891-940

SALL4 Rabbit pAb

A7124-100ul 100 ul
EUR 308

SALL4 Rabbit pAb

A7124-200ul 200 ul
EUR 459

SALL4 Rabbit pAb

A7124-20ul 20 ul
EUR 183

SALL4 Rabbit pAb

A7124-50ul 50 ul
EUR 223

SALL4 Rabbit pAb

A5596-100ul 100 ul
EUR 308

SALL4 Rabbit pAb

A5596-200ul 200 ul
EUR 459

SALL4 Rabbit pAb

A5596-20ul 20 ul Ask for price

SALL4 Rabbit pAb

A5596-50ul 50 ul Ask for price

SALL4 Rabbit pAb

A16193-100ul 100 ul
EUR 308

SALL4 Rabbit pAb

A16193-200ul 200 ul
EUR 459

SALL4 Rabbit pAb

A16193-20ul 20 ul
EUR 183

SALL4 Rabbit pAb

A16193-50ul 50 ul
EUR 223

Polyclonal SALL4 Antibody (Center)

APR04792G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SALL4 (Center). This antibody is tested and proven to work in the following applications:

Sall4 Antibody

ABD7757 100 ug
EUR 438

Sall4 Antibody

45135-100ul 100ul
EUR 252

Sall4 Antibody

45135-50ul 50ul
EUR 187

Sall4 Antibody

DF7757 200ul
EUR 304
Description: Sall4 Antibody detects endogenous levels of total Sall4.

SALL4 Antibody

1-CSB-PA892126DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SALL4. Recognizes SALL4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SALL4 Antibody

P1052-01m 0.1m
EUR 158

SALL4 Antibody

P1052-1ml 1ml
EUR 470

Polyclonal SALL4 Antibody (aa28-42)

APR02192G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SALL4 (aa28-42). This antibody is tested and proven to work in the following applications:

Polyclonal SALL4 Antibody (C-term)

APR04764G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SALL4 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SALL4 Antibody (C-term)

APR14398G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SALL4 (C-term). This antibody is tested and proven to work in the following applications:

Sall4 (anti Sall4 antibody, clone# PPZ0601)

PP-PPZ0601-00 0.1mg/100uL
EUR 623
Description: The Sall4 (anti Sall4 antibody, clone# PPZ0601) is available in Europe and for worldwide shipping via Gentaur.

Sal-like 4 (SALL4) polyclonal antibody

ABP-PAB-11688 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

Sall4 Conjugated Antibody

C45135 100ul
EUR 397

anti- SALL4 antibody

FNab07583 100µg
EUR 585
  • Immunogen: sal-like 4(Drosophila)
  • Uniprot ID: Q9UJQ4
  • Gene ID: 57167
  • Research Area: Metabolism, Immunology, Cancer, Developmental biology, Stem Cells
Description: Antibody raised against SALL4

anti- SALL4 antibody

FNab07584 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • Immunogen: sal-like 4(Drosophila)
  • Uniprot ID: Q9UJQ4
  • Gene ID: 57167
  • Research Area: Metabolism, Immunology, Cancer, Developmental biology, Stem Cells
Description: Antibody raised against SALL4

Anti-Sall4 Antibody

A1692-100
EUR 479

Anti-SALL4 antibody

PAab07583 100 ug
EUR 412

Anti-SALL4 antibody

STJ29204 100 µl
EUR 277
Description: This gene encodes a zinc finger transcription factor thought to play a role in the development of abducens motor neurons. Defects in this gene are a cause of Duane-radial ray syndrome (DRRS). Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-SALL4 antibody

STJ111252 100 µl
EUR 277
Description: This gene encodes a zinc finger transcription factor thought to play a role in the development of abducens motor neurons. Defects in this gene are a cause of Duane-radial ray syndrome (DRRS). Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-SALL4 antibody

STJ118646 100 µl
EUR 277

Anti-SALL4 antibody

STJ160131 1 mL C
EUR 544

Anti-SALL4 antibody

STJ180237 0.1 ml
EUR 244

Anti-SALL4 antibody

STJ192552 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SALL4

SALL4 siRNA

20-abx932410
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SALL4 siRNA

20-abx932411
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SALL4

YF-PA26465 50 ul
EUR 334
Description: Mouse polyclonal to SALL4

Anti-Sall4 (mouse) antibody

STJ71177 100 µg
EUR 359

Sall4 Blocking Peptide

DF7757-BP 1mg
EUR 195

SALL4 cloning plasmid

CSB-CL892126HU-10ug 10ug
EUR 1164
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3162
  • Sequence: ATGTCGAGGCGCAAGCAGGCGAAACCCCAGCACATCAACTCGGAGGAGGACCAGGGCGAGCAGCAGCCGCAGCAGCAGACCCCGGAGTTTGCAGATGCGGCCCCAGCGGCGCCCGCGGCGGGGGAGCTGGGTGCTCCAGTGAACCACCCAGGGAATGACGAGGTGGCGAGTGAGG
  • Show more
Description: A cloning plasmid for the SALL4 gene.

Anti-SALL4 (6E3)

YF-MA11603 100 ug
EUR 363
Description: Mouse monoclonal to SALL4

Monoclonal SALL4 Antibody, Clone: 1E11A4

AMM03062G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human SALL4. The antibodies are raised in Mouse and are from clone 1E11A4. This antibody is applicable in WB and IHC, FC, ICC, E

Mouse SALL4 shRNA Plasmid

20-abx979406
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SALL4 ELISA KIT|Human

EF002699 96 Tests
EUR 689

Human SALL4 shRNA Plasmid

20-abx961370
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Sal-Like Protein 4 (SALL4) Antibody

20-abx127041
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Sal-Like Protein 4 (SALL4) Antibody

20-abx005379
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sal-Like Protein 4 (SALL4) Antibody

abx028391-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Sal-Like Protein 4 (SALL4) Antibody

abx028391-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Sal-Like Protein 4 (SALL4) Antibody

20-abx320299
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sal-Like Protein 4 (SALL4) Antibody

20-abx218433
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sal-Like Protein 4 (SALL4) Antibody

abx224198-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Sal-Like Protein 4 (SALL4) Antibody

abx432248-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Sal-Like Protein 4 (SALL4) Antibody

abx237583-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Sal-Like Protein 4 (SALL4) Antibody

abx237584-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

SALL4 (Sal-Like Protein 4)

MO47050 100 ug
EUR 349

Sall4 ORF Vector (Mouse) (pORF)

ORF056637 1.0 ug DNA
EUR 506

Sall4 ORF Vector (Mouse) (pORF)

ORF056638 1.0 ug DNA
EUR 506

Sall4 ORF Vector (Mouse) (pORF)

ORF056639 1.0 ug DNA
EUR 506

SALL4 ORF Vector (Human) (pORF)

ORF014359 1.0 ug DNA
EUR 354

pECMV-Sall4-m-FLAG Plasmid

PVT15326 2 ug
EUR 325

pECMV-Sall4-m-FLAG Plasmid

PVT15756 2 ug
EUR 325

SALL4 ELISA Kit (Human) (OKCA00803)

OKCA00803 96 Wells
EUR 833
Description: Description of target: Transcription factor with a key role in the maintenance and self-renewal of embryonic and hematopoietic stem cells.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.37 pg/mL

Mouse Anti-Human SALL4 monoclonal antibody, clone JID770

CABT-L2858-100uL500uL 100 uL, 500 uL
EUR 502

SALL4 sgRNA CRISPR Lentivector set (Human)

K2086501 3 x 1.0 ug
EUR 339

Sall4 sgRNA CRISPR Lentivector set (Mouse)

K3781801 3 x 1.0 ug
EUR 339

Human Sal Like Protein 4 (SALL4) Protein

20-abx654986
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

SALL4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2086502 1.0 ug DNA
EUR 154

SALL4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2086503 1.0 ug DNA
EUR 154

SALL4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2086504 1.0 ug DNA
EUR 154

Sall4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3781802 1.0 ug DNA
EUR 154

Sall4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3781803 1.0 ug DNA
EUR 154

Sall4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3781804 1.0 ug DNA
EUR 154

SALL4 Protein Vector (Human) (pPB-C-His)

PV057433 500 ng
EUR 329

SALL4 Protein Vector (Human) (pPB-N-His)

PV057434 500 ng
EUR 481

SALL4 Protein Vector (Human) (pPM-C-HA)

PV057435 500 ng
EUR 481

SALL4 Protein Vector (Human) (pPM-C-His)

PV057436 500 ng
EUR 481

SALL4 Protein Vector (Mouse) (pPB-C-His)

PV226546 500 ng
EUR 603

SALL4 Protein Vector (Mouse) (pPB-N-His)

PV226547 500 ng
EUR 603

SALL4 Protein Vector (Mouse) (pPM-C-HA)

PV226548 500 ng
EUR 603

SALL4 Protein Vector (Mouse) (pPM-C-His)

PV226549 500 ng
EUR 603

SALL4 Protein Vector (Mouse) (pPB-C-His)

PV226550 500 ng
EUR 1065

SALL4 Protein Vector (Mouse) (pPB-N-His)

PV226551 500 ng
EUR 1065

SALL4 Protein Vector (Mouse) (pPM-C-HA)

PV226552 500 ng
EUR 1065

SALL4 Protein Vector (Mouse) (pPM-C-His)

PV226553 500 ng
EUR 1065

SALL4 Protein Vector (Mouse) (pPB-C-His)

PV226554 500 ng
EUR 603

SALL4 Protein Vector (Mouse) (pPB-N-His)

PV226555 500 ng
EUR 603

SALL4 Protein Vector (Mouse) (pPM-C-HA)

PV226556 500 ng
EUR 603

SALL4 Protein Vector (Mouse) (pPM-C-His)

PV226557 500 ng
EUR 603

Sall4 3'UTR GFP Stable Cell Line

TU168323 1.0 ml Ask for price

SALL4 3'UTR Luciferase Stable Cell Line

TU022564 1.0 ml
EUR 1394

Sall4 3'UTR Luciferase Stable Cell Line

TU118323 1.0 ml Ask for price

SALL4 3'UTR GFP Stable Cell Line

TU072564 1.0 ml
EUR 1394

Human Sal- like protein 4, SALL4 ELISA KIT

ELI-29742h 96 Tests
EUR 824

Mouse Sal- like protein 4, Sall4 ELISA KIT

ELI-39251m 96 Tests
EUR 865

Human Sal-Like Protein 4 (SALL4) ELISA Kit

20-abx383011
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Sal-like protein 4(SALL4) ELISA kit

CSB-EL020676HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Sal-like protein 4 (SALL4) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Sal-like protein 4(SALL4) ELISA kit

1-CSB-EL020676HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Sal-like protein 4(SALL4) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

SALL4 Rabbit Polyclonal Antibody