SALL4 Rabbit Polyclonal Antibody
SALL4 Polyclonal Antibody |
ABP60322-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SALL4 protein at amino acid sequence of 891-940
- Applications tips:
|
Description: A polyclonal antibody for detection of SALL4 from Human, Mouse. This SALL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SALL4 protein at amino acid sequence of 891-940 |
SALL4 Polyclonal Antibody |
ES11394-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against SALL4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SALL4 Polyclonal Antibody |
ES11394-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against SALL4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SALL4 Rabbit pAb |
A16193-100ul |
Abclonal |
100 ul |
EUR 308 |
SALL4 Rabbit pAb |
A16193-200ul |
Abclonal |
200 ul |
EUR 459 |
SALL4 Rabbit pAb |
A16193-20ul |
Abclonal |
20 ul |
EUR 183 |
SALL4 Rabbit pAb |
A16193-50ul |
Abclonal |
50 ul |
EUR 223 |
SALL4 Rabbit pAb |
A7124-100ul |
Abclonal |
100 ul |
EUR 308 |
SALL4 Rabbit pAb |
A7124-200ul |
Abclonal |
200 ul |
EUR 459 |
SALL4 Rabbit pAb |
A7124-20ul |
Abclonal |
20 ul |
EUR 183 |
SALL4 Rabbit pAb |
A7124-50ul |
Abclonal |
50 ul |
EUR 223 |
SALL4 Rabbit pAb |
A5596-100ul |
Abclonal |
100 ul |
EUR 308 |
SALL4 Rabbit pAb |
A5596-200ul |
Abclonal |
200 ul |
EUR 459 |
SALL4 Rabbit pAb |
A5596-20ul |
Abclonal |
20 ul |
Ask for price |
SALL4 Rabbit pAb |
A5596-50ul |
Abclonal |
50 ul |
Ask for price |
Polyclonal SALL4 Antibody (Center) |
APR04792G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SALL4 (Center). This antibody is tested and proven to work in the following applications: |
Sall4 Antibody |
45135-100ul |
SAB |
100ul |
EUR 252 |
Sall4 Antibody |
45135-50ul |
SAB |
50ul |
EUR 187 |
SALL4 Antibody |
1-CSB-PA892126DSR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against SALL4. Recognizes SALL4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Sall4 Antibody |
DF7757 |
Affbiotech |
200ul |
EUR 304 |
Description: Sall4 Antibody detects endogenous levels of total Sall4. |
SALL4 Antibody |
P1052-01m |
SAB |
0.1m |
EUR 158 |
SALL4 Antibody |
P1052-1ml |
SAB |
1ml |
EUR 470 |
Polyclonal SALL4 Antibody (C-term) |
APR04764G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SALL4 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal SALL4 Antibody (aa28-42) |
APR02192G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SALL4 (aa28-42). This antibody is tested and proven to work in the following applications: |
Polyclonal SALL4 Antibody (C-term) |
APR14398G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SALL4 (C-term). This antibody is tested and proven to work in the following applications: |
Sall4 (anti Sall4 antibody, clone# PPZ0601) |
PP-PPZ0601-00 |
Sceti |
0.1mg/100uL |
EUR 623 |
Description: The Sall4 (anti Sall4 antibody, clone# PPZ0601) is available in Europe and for worldwide shipping via Gentaur. |
Sal-like 4 (SALL4) polyclonal antibody |
ABP-PAB-11688 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
Sall4 Conjugated Antibody |
C45135 |
SAB |
100ul |
EUR 397 |
Anti-Sall4 Antibody |
A1692-100 |
Biovision |
|
EUR 479 |
anti- SALL4 antibody |
FNab07583 |
FN Test |
100µg |
EUR 585 |
- Immunogen: sal-like 4(Drosophila)
- Uniprot ID: Q9UJQ4
- Gene ID: 57167
- Research Area: Metabolism, Immunology, Cancer, Developmental biology, Stem Cells
|
Description: Antibody raised against SALL4 |
anti- SALL4 antibody |
FNab07584 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- Immunogen: sal-like 4(Drosophila)
- Uniprot ID: Q9UJQ4
- Gene ID: 57167
- Research Area: Metabolism, Immunology, Cancer, Developmental biology, Stem Cells
|
Description: Antibody raised against SALL4 |
Anti-SALL4 antibody |
STJ111252 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a zinc finger transcription factor thought to play a role in the development of abducens motor neurons. Defects in this gene are a cause of Duane-radial ray syndrome (DRRS). Alternative splicing results in multiple transcript variants encoding different isoforms. |
Anti-SALL4 antibody |
STJ29204 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a zinc finger transcription factor thought to play a role in the development of abducens motor neurons. Defects in this gene are a cause of Duane-radial ray syndrome (DRRS). Alternative splicing results in multiple transcript variants encoding different isoforms. |
Anti-SALL4 antibody |
STJ192552 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SALL4 |
SALL4 siRNA |
20-abx932410 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SALL4 siRNA |
20-abx932411 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-SALL4 |
YF-PA26465 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to SALL4 |
SALL4 cloning plasmid |
CSB-CL892126HU-10ug |
Cusabio |
10ug |
EUR 1164 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3162
- Sequence: ATGTCGAGGCGCAAGCAGGCGAAACCCCAGCACATCAACTCGGAGGAGGACCAGGGCGAGCAGCAGCCGCAGCAGCAGACCCCGGAGTTTGCAGATGCGGCCCCAGCGGCGCCCGCGGCGGGGGAGCTGGGTGCTCCAGTGAACCACCCAGGGAATGACGAGGTGGCGAGTGAGG
- Show more
|
Description: A cloning plasmid for the SALL4 gene. |
Sall4 Blocking Peptide |
DF7757-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-SALL4 (6E3) |
YF-MA11603 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to SALL4 |
Monoclonal SALL4 Antibody, Clone: 1E11A4 |
AMM03062G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human SALL4. The antibodies are raised in Mouse and are from clone 1E11A4. This antibody is applicable in WB and IHC, FC, ICC, E |
Human SALL4 shRNA Plasmid |
20-abx961370 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse SALL4 shRNA Plasmid |
20-abx979406 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Sal-Like Protein 4 (SALL4) Antibody |
20-abx005379 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Sal-Like Protein 4 (SALL4) Antibody |
20-abx218433 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sal-Like Protein 4 (SALL4) Antibody |
abx224198-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Sal-Like Protein 4 (SALL4) Antibody |
20-abx127041 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sal-Like Protein 4 (SALL4) Antibody |
abx028391-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Sal-Like Protein 4 (SALL4) Antibody |
abx028391-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Sal-Like Protein 4 (SALL4) Antibody |
abx237583-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Sal-Like Protein 4 (SALL4) Antibody |
abx237584-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Sal-Like Protein 4 (SALL4) Antibody |
20-abx320299 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sal-Like Protein 4 (SALL4) Antibody |
abx432248-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
SALL4 (Sal-Like Protein 4) |
MO47050 |
Neuromics |
100 ug |
EUR 349 |
SALL4 ORF Vector (Human) (pORF) |
ORF014359 |
ABM |
1.0 ug DNA |
EUR 354 |
Sall4 ORF Vector (Mouse) (pORF) |
ORF056637 |
ABM |
1.0 ug DNA |
EUR 506 |
Sall4 ORF Vector (Mouse) (pORF) |
ORF056638 |
ABM |
1.0 ug DNA |
EUR 506 |
Sall4 ORF Vector (Mouse) (pORF) |
ORF056639 |
ABM |
1.0 ug DNA |
EUR 506 |
SALL4 ELISA Kit (Human) (OKCA00803) |
OKCA00803 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: Transcription factor with a key role in the maintenance and self-renewal of embryonic and hematopoietic stem cells.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.37 pg/mL |
Mouse Anti-Human SALL4 monoclonal antibody, clone JID770 |
CABT-L2858-100uL500uL |
Creative Diagnostics |
100 uL, 500 uL |
EUR 502 |
Sall4 sgRNA CRISPR Lentivector set (Mouse) |
K3781801 |
ABM |
3 x 1.0 ug |
EUR 339 |
SALL4 sgRNA CRISPR Lentivector set (Human) |
K2086501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Sal Like Protein 4 (SALL4) Protein |
20-abx654986 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Sall4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3781802 |
ABM |
1.0 ug DNA |
EUR 154 |
Sall4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3781803 |
ABM |
1.0 ug DNA |
EUR 154 |
Sall4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3781804 |
ABM |
1.0 ug DNA |
EUR 154 |
SALL4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2086502 |
ABM |
1.0 ug DNA |
EUR 154 |
SALL4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2086503 |
ABM |
1.0 ug DNA |
EUR 154 |
SALL4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2086504 |
ABM |
1.0 ug DNA |
EUR 154 |
SALL4 Protein Vector (Human) (pPB-C-His) |
PV057433 |
ABM |
500 ng |
EUR 329 |
SALL4 Protein Vector (Human) (pPB-N-His) |
PV057434 |
ABM |
500 ng |
EUR 481 |
SALL4 Protein Vector (Human) (pPM-C-HA) |
PV057435 |
ABM |
500 ng |
EUR 481 |
SALL4 Protein Vector (Human) (pPM-C-His) |
PV057436 |
ABM |
500 ng |
EUR 481 |
SALL4 Protein Vector (Mouse) (pPB-C-His) |
PV226546 |
ABM |
500 ng |
EUR 603 |
SALL4 Protein Vector (Mouse) (pPB-N-His) |
PV226547 |
ABM |
500 ng |
EUR 603 |
SALL4 Protein Vector (Mouse) (pPM-C-HA) |
PV226548 |
ABM |
500 ng |
EUR 603 |
SALL4 Protein Vector (Mouse) (pPM-C-His) |
PV226549 |
ABM |
500 ng |
EUR 603 |
SALL4 Protein Vector (Mouse) (pPB-C-His) |
PV226550 |
ABM |
500 ng |
EUR 1065 |
SALL4 Protein Vector (Mouse) (pPB-N-His) |
PV226551 |
ABM |
500 ng |
EUR 1065 |
SALL4 Protein Vector (Mouse) (pPM-C-HA) |
PV226552 |
ABM |
500 ng |
EUR 1065 |
SALL4 Protein Vector (Mouse) (pPM-C-His) |
PV226553 |
ABM |
500 ng |
EUR 1065 |
SALL4 Protein Vector (Mouse) (pPB-C-His) |
PV226554 |
ABM |
500 ng |
EUR 603 |
SALL4 Protein Vector (Mouse) (pPB-N-His) |
PV226555 |
ABM |
500 ng |
EUR 603 |
SALL4 Protein Vector (Mouse) (pPM-C-HA) |
PV226556 |
ABM |
500 ng |
EUR 603 |
SALL4 Protein Vector (Mouse) (pPM-C-His) |
PV226557 |
ABM |
500 ng |
EUR 603 |
Sall4 3'UTR Luciferase Stable Cell Line |
TU118323 |
ABM |
1.0 ml |
Ask for price |
Sall4 3'UTR GFP Stable Cell Line |
TU168323 |
ABM |
1.0 ml |
Ask for price |
SALL4 3'UTR GFP Stable Cell Line |
TU072564 |
ABM |
1.0 ml |
EUR 1394 |
SALL4 3'UTR Luciferase Stable Cell Line |
TU022564 |
ABM |
1.0 ml |
EUR 1394 |
Human Sal-like protein 4(SALL4) ELISA kit |
CSB-EL020676HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Sal-like protein 4 (SALL4) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Sal-like protein 4(SALL4) ELISA kit |
1-CSB-EL020676HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Sal-like protein 4(SALL4) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Sal-Like Protein 4 (SALL4) ELISA Kit |
20-abx383011 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
SALL4 Rabbit Polyclonal Antibody