SCO2 Rabbit Polyclonal Antibody
SCO2 Polyclonal Antibody |
ABP60349-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human SCO2 protein at amino acid sequence of 181-230
- Applications tips:
|
Description: A polyclonal antibody for detection of SCO2 from Human, Mouse. This SCO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SCO2 protein at amino acid sequence of 181-230 |
SCO2 Polyclonal Antibody |
ABP60349-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SCO2 protein at amino acid sequence of 181-230
- Applications tips:
|
Description: A polyclonal antibody for detection of SCO2 from Human, Mouse. This SCO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SCO2 protein at amino acid sequence of 181-230 |
SCO2 Polyclonal Antibody |
ABP60349-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SCO2 protein at amino acid sequence of 181-230
- Applications tips:
|
Description: A polyclonal antibody for detection of SCO2 from Human, Mouse. This SCO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SCO2 protein at amino acid sequence of 181-230 |
SCO2 Polyclonal Antibody |
ES11415-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against SCO2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SCO2 Polyclonal Antibody |
ES11415-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against SCO2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SCO2 Rabbit pAb |
A7051-100ul |
Abclonal |
100 ul |
EUR 308 |
SCO2 Rabbit pAb |
A7051-200ul |
Abclonal |
200 ul |
EUR 459 |
SCO2 Rabbit pAb |
A7051-20ul |
Abclonal |
20 ul |
EUR 183 |
SCO2 Rabbit pAb |
A7051-50ul |
Abclonal |
50 ul |
EUR 223 |
SCO2 Polyclonal Conjugated Antibody |
C30804 |
SAB |
100ul |
EUR 397 |
SCO2 Antibody |
24498-100ul |
SAB |
100ul |
EUR 390 |
SCO2 antibody |
70R-20118 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SCO2 antibody |
SCO2 Antibody |
DF12731 |
Affbiotech |
200ul |
EUR 304 |
Description: SCO2 Antibody detects endogenous levels of SCO2. |
SCO2 Antibody |
1-CSB-PA020853ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against SCO2. Recognizes SCO2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
SCO2 Antibody |
1-CSB-PA020853GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against SCO2. Recognizes SCO2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Polyclonal SCO2 Antibody (C-Terminus) |
AMR09838G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SCO2 (C-Terminus). This antibody is tested and proven to work in the following applications: |
anti- SCO2 antibody |
FNab07651 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: SCO cytochrome oxidase deficient homolog 2(yeast)
- Uniprot ID: O43819
- Gene ID: 9997
- Research Area: Metabolism
|
Description: Antibody raised against SCO2 |
Anti-SCO2 antibody |
STJ29131 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Cytochrome c oxidase (COX) catalyzes the transfer of electrons from cytochrome c to molecular oxygen, which helps to maintain the proton gradient across the inner mitochondrial membrane that is necessary for aerobic ATP production. Human COX is a multimeric protein complex that requires several assembly factors; this gene encodes one of the COX assembly factors. The encoded protein is a metallochaperone that is involved in the biogenesis of cytochrome c oxidase subunit II. Mutations in this gene are associated with fatal infantile encephalocardiomyopathy and myopia 6. |
Anti-SCO2 antibody |
STJ192573 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SCO2 |
SCO2, Cytochrome C Oxidase Assembly Protein (SCO2) Antibody |
20-abx006880 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
SCO2, Cytochrome C Oxidase Assembly Protein (SCO2) Antibody |
20-abx142213 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
SCO2, Cytochrome C Oxidase Assembly Protein (SCO2) Antibody |
abx029681-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
SCO2, Cytochrome C Oxidase Assembly Protein (SCO2) Antibody |
abx029681-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
SCO2, Cytochrome C Oxidase Assembly Protein (SCO2) Antibody |
abx237651-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
SCO2, Cytochrome C Oxidase Assembly Protein (SCO2) Antibody |
20-abx320793 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Protein SCO2 homolog, mitochondrial (SCO2) |
1-CSB-EP020853HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 41.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Protein SCO2 homolog, mitochondrial(SCO2) expressed in E.coli |
SCO2 siRNA |
20-abx932647 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SCO2 siRNA |
20-abx932648 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-SCO2 |
YF-PA16635 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to SCO2 |
Bovine Protein SCO2 homolog, mitochondrial, SCO2 ELISA KIT |
ELI-20160b |
Lifescience Market |
96 Tests |
EUR 928 |
Human Protein SCO2 homolog, mitochondrial, SCO2 ELISA KIT |
ELI-29437h |
Lifescience Market |
96 Tests |
EUR 824 |
SCO2, Cytochrome C Oxidase Assembly Protein (SCO2) Protein |
20-abx262462 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Mouse Protein SCO2 homolog, mitochondrial, Sco2 ELISA KIT |
ELI-35819m |
Lifescience Market |
96 Tests |
EUR 865 |
SCO2 Blocking Peptide |
DF12731-BP |
Affbiotech |
1mg |
EUR 195 |
SCO2 cloning plasmid |
CSB-CL020853HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 801
- Sequence: ATGCTGCTGCTGACTCGGAGCCCCACAGCTTGGCACAGGCTCTCTCAGCTCAAGCCTCGGGTCCTCCCTGGGACCCTGGGAGGCCAGGCCCTGCATCTGAGGTCCTGGCTTTTGTCAAGGCAGGGCCCTGCAGAGACAGGTGGGCAGGGCCAGCCCCAGGGCCCTGGGCTTCGAAC
- Show more
|
Description: A cloning plasmid for the SCO2 gene. |
Human SCO2, Cytochrome C Oxidase Assembly Protein (SCO2) ELISA Kit |
abx383063-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
SCO2 protein (His tag) |
80R-1626 |
Fitzgerald |
50 ug |
EUR 397 |
Description: Purified recombinant Human SCO2 protein |
Mouse SCO2 shRNA Plasmid |
20-abx984320 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SCO2 shRNA Plasmid |
20-abx956727 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SCO2 Recombinant Protein (Human) |
RP043129 |
ABM |
100 ug |
Ask for price |
SCO2 Recombinant Protein (Mouse) |
RP170336 |
ABM |
100 ug |
Ask for price |
SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Polyclonal Antibody (Human) |
4-PAM192Hu01 |
Cloud-Clone |
-
EUR 261.00
-
EUR 2734.00
-
EUR 676.00
-
EUR 330.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCO2 (Gly42~Ser266)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) |
SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Polyclonal Antibody (Human), APC |
4-PAM192Hu01-APC |
Cloud-Clone |
-
EUR 367.00
-
EUR 3581.00
-
EUR 989.00
-
EUR 470.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCO2 (Gly42~Ser266)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2). This antibody is labeled with APC. |
SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Polyclonal Antibody (Human), Biotinylated |
4-PAM192Hu01-Biotin |
Cloud-Clone |
-
EUR 327.00
-
EUR 2684.00
-
EUR 783.00
-
EUR 403.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCO2 (Gly42~Ser266)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2). This antibody is labeled with Biotin. |
SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Polyclonal Antibody (Human), Cy3 |
4-PAM192Hu01-Cy3 |
Cloud-Clone |
-
EUR 447.00
-
EUR 4733.00
-
EUR 1277.00
-
EUR 585.00
-
EUR 263.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCO2 (Gly42~Ser266)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2). This antibody is labeled with Cy3. |
SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Polyclonal Antibody (Human), FITC |
4-PAM192Hu01-FITC |
Cloud-Clone |
-
EUR 313.00
-
EUR 2884.00
-
EUR 811.00
-
EUR 396.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCO2 (Gly42~Ser266)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2). This antibody is labeled with FITC. |
SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Polyclonal Antibody (Human), HRP |
4-PAM192Hu01-HRP |
Cloud-Clone |
-
EUR 334.00
-
EUR 3120.00
-
EUR 873.00
-
EUR 424.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCO2 (Gly42~Ser266)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2). This antibody is labeled with HRP. |
SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Polyclonal Antibody (Human), PE |
4-PAM192Hu01-PE |
Cloud-Clone |
-
EUR 313.00
-
EUR 2884.00
-
EUR 811.00
-
EUR 396.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCO2 (Gly42~Ser266)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2). This antibody is labeled with PE. |
SCO2 ORF Vector (Human) (pORF) |
ORF014377 |
ABM |
1.0 ug DNA |
EUR 354 |
Sco2 ORF Vector (Mouse) (pORF) |
ORF056780 |
ABM |
1.0 ug DNA |
EUR 506 |
SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAM192Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 614.00
-
EUR 7042.00
-
EUR 1858.00
-
EUR 821.00
-
EUR 337.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCO2 (Gly42~Ser266)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2). This antibody is labeled with APC-Cy7. |
SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Antibody |
20-abx129130 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Sco2 sgRNA CRISPR Lentivector set (Mouse) |
K4323001 |
ABM |
3 x 1.0 ug |
EUR 339 |
SCO2 sgRNA CRISPR Lentivector set (Human) |
K2104001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Sco2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4323002 |
ABM |
1.0 ug DNA |
EUR 154 |
Sco2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4323003 |
ABM |
1.0 ug DNA |
EUR 154 |
Sco2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4323004 |
ABM |
1.0 ug DNA |
EUR 154 |
SCO2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2104002 |
ABM |
1.0 ug DNA |
EUR 154 |
SCO2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2104003 |
ABM |
1.0 ug DNA |
EUR 154 |
SCO2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2104004 |
ABM |
1.0 ug DNA |
EUR 154 |
SCO2 Protein Vector (Human) (pPB-C-His) |
PV057505 |
ABM |
500 ng |
EUR 481 |
SCO2 Protein Vector (Human) (pPB-N-His) |
PV057506 |
ABM |
500 ng |
EUR 481 |
SCO2 Protein Vector (Human) (pPM-C-HA) |
PV057507 |
ABM |
500 ng |
EUR 481 |
SCO2 Protein Vector (Human) (pPM-C-His) |
PV057508 |
ABM |
500 ng |
EUR 481 |
SCO2 Protein Vector (Mouse) (pPB-C-His) |
PV227118 |
ABM |
500 ng |
EUR 603 |
SCO2 Protein Vector (Mouse) (pPB-N-His) |
PV227119 |
ABM |
500 ng |
EUR 603 |
SCO2 Protein Vector (Mouse) (pPM-C-HA) |
PV227120 |
ABM |
500 ng |
EUR 603 |
SCO2 Protein Vector (Mouse) (pPM-C-His) |
PV227121 |
ABM |
500 ng |
EUR 603 |
Sco2 3'UTR Luciferase Stable Cell Line |
TU118434 |
ABM |
1.0 ml |
Ask for price |
Sco2 3'UTR GFP Stable Cell Line |
TU168434 |
ABM |
1.0 ml |
Ask for price |
SCO2 3'UTR GFP Stable Cell Line |
TU072741 |
ABM |
1.0 ml |
EUR 1394 |
SCO2 3'UTR Luciferase Stable Cell Line |
TU022741 |
ABM |
1.0 ml |
EUR 1394 |
Recombinant SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) |
4-RPM192Hu01 |
Cloud-Clone |
-
EUR 490.66
-
EUR 234.00
-
EUR 1564.96
-
EUR 588.32
-
EUR 1076.64
-
EUR 391.00
-
EUR 3762.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O43819
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.0kDa
- Isoelectric Point: 6.9
|
Description: Recombinant Human SCO Cytochrome Oxidase Deficient Homolog 2 expressed in: E.coli |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
SCO2 Rabbit Polyclonal Antibody