SCO2 Rabbit Polyclonal Antibody

SCO2 Rabbit Polyclonal Antibody

SCO2 Polyclonal Antibody
ABP60349-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SCO2 protein at amino acid sequence of 181-230
  • Applications tips:
Description: A polyclonal antibody for detection of SCO2 from Human, Mouse. This SCO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SCO2 protein at amino acid sequence of 181-230

SCO2 Polyclonal Antibody
ABP60349-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SCO2 protein at amino acid sequence of 181-230
  • Applications tips:
Description: A polyclonal antibody for detection of SCO2 from Human, Mouse. This SCO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SCO2 protein at amino acid sequence of 181-230

SCO2 Polyclonal Antibody
ABP60349-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SCO2 protein at amino acid sequence of 181-230
  • Applications tips:
Description: A polyclonal antibody for detection of SCO2 from Human, Mouse. This SCO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SCO2 protein at amino acid sequence of 181-230

SCO2 Polyclonal Antibody
ES11415-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SCO2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SCO2 Polyclonal Antibody
ES11415-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SCO2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SCO2 Rabbit pAb
A7051-100ul 100 ul
EUR 308

SCO2 Rabbit pAb
A7051-200ul 200 ul
EUR 459

SCO2 Rabbit pAb
A7051-20ul 20 ul
EUR 183

SCO2 Rabbit pAb
A7051-50ul 50 ul
EUR 223

SCO2 Polyclonal Conjugated Antibody
C30804 100ul
EUR 397

SCO2 Antibody
24498-100ul 100ul
EUR 390

SCO2 antibody
70R-20118 50 ul
EUR 435
Description: Rabbit polyclonal SCO2 antibody

SCO2 Antibody
DF12731 200ul
EUR 304
Description: SCO2 Antibody detects endogenous levels of SCO2.

SCO2 Antibody
1-CSB-PA020853ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SCO2. Recognizes SCO2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SCO2 Antibody
1-CSB-PA020853GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SCO2. Recognizes SCO2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal SCO2 Antibody (C-Terminus)
AMR09838G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SCO2 (C-Terminus). This antibody is tested and proven to work in the following applications:

anti- SCO2 antibody
FNab07651 100µg
EUR 548.75
  • Immunogen: SCO cytochrome oxidase deficient homolog 2(yeast)
  • Uniprot ID: O43819
  • Gene ID: 9997
  • Research Area: Metabolism
Description: Antibody raised against SCO2

Anti-SCO2 antibody
PAab07651 100 ug
EUR 386

Anti-SCO2 antibody
STJ29131 100 µl
EUR 277
Description: Cytochrome c oxidase (COX) catalyzes the transfer of electrons from cytochrome c to molecular oxygen, which helps to maintain the proton gradient across the inner mitochondrial membrane that is necessary for aerobic ATP production. Human COX is a multimeric protein complex that requires several assembly factors; this gene encodes one of the COX assembly factors. The encoded protein is a metallochaperone that is involved in the biogenesis of cytochrome c oxidase subunit II. Mutations in this gene are associated with fatal infantile encephalocardiomyopathy and myopia 6.

Anti-SCO2 antibody
STJ192573 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SCO2

SCO2, Cytochrome C Oxidase Assembly Protein (SCO2) Antibody
20-abx006880
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

SCO2, Cytochrome C Oxidase Assembly Protein (SCO2) Antibody
20-abx142213
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

SCO2, Cytochrome C Oxidase Assembly Protein (SCO2) Antibody
abx029681-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SCO2, Cytochrome C Oxidase Assembly Protein (SCO2) Antibody
abx029681-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SCO2, Cytochrome C Oxidase Assembly Protein (SCO2) Antibody
abx237651-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

SCO2, Cytochrome C Oxidase Assembly Protein (SCO2) Antibody
20-abx320793
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Protein SCO2 homolog, mitochondrial (SCO2)
1-CSB-EP020853HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 41.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein SCO2 homolog, mitochondrial(SCO2) expressed in E.coli

SCO2 siRNA
20-abx932647
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SCO2 siRNA
20-abx932648
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SCO2
YF-PA16635 50 ug
EUR 363
Description: Mouse polyclonal to SCO2

Bovine Protein SCO2 homolog, mitochondrial, SCO2 ELISA KIT
ELI-20160b 96 Tests
EUR 928

Human Protein SCO2 homolog, mitochondrial, SCO2 ELISA KIT
ELI-29437h 96 Tests
EUR 824

SCO2, Cytochrome C Oxidase Assembly Protein (SCO2) Protein
20-abx262462
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Mouse Protein SCO2 homolog, mitochondrial, Sco2 ELISA KIT
ELI-35819m 96 Tests
EUR 865

SCO2 Blocking Peptide
DF12731-BP 1mg
EUR 195

SCO2 cloning plasmid
CSB-CL020853HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 801
  • Sequence: ATGCTGCTGCTGACTCGGAGCCCCACAGCTTGGCACAGGCTCTCTCAGCTCAAGCCTCGGGTCCTCCCTGGGACCCTGGGAGGCCAGGCCCTGCATCTGAGGTCCTGGCTTTTGTCAAGGCAGGGCCCTGCAGAGACAGGTGGGCAGGGCCAGCCCCAGGGCCCTGGGCTTCGAAC
  • Show more
Description: A cloning plasmid for the SCO2 gene.

Human SCO2, Cytochrome C Oxidase Assembly Protein (SCO2) ELISA Kit
abx383063-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

SCO2 protein (His tag)
80R-1626 50 ug
EUR 397
Description: Purified recombinant Human SCO2 protein

SCO2 ELISA KIT|Human
EF002762 96 Tests
EUR 689

Mouse SCO2 shRNA Plasmid
20-abx984320
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SCO2 shRNA Plasmid
20-abx956727
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SCO2 Recombinant Protein (Human)
RP043129 100 ug Ask for price

SCO2 Recombinant Protein (Mouse)
RP170336 100 ug Ask for price

SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Polyclonal Antibody (Human)
4-PAM192Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCO2 (Gly42~Ser266)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2)

SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Polyclonal Antibody (Human), APC
4-PAM192Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCO2 (Gly42~Ser266)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2). This antibody is labeled with APC.

SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Polyclonal Antibody (Human), Biotinylated
4-PAM192Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCO2 (Gly42~Ser266)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2). This antibody is labeled with Biotin.

SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Polyclonal Antibody (Human), Cy3
4-PAM192Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCO2 (Gly42~Ser266)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2). This antibody is labeled with Cy3.

SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Polyclonal Antibody (Human), FITC
4-PAM192Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCO2 (Gly42~Ser266)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2). This antibody is labeled with FITC.

SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Polyclonal Antibody (Human), HRP
4-PAM192Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCO2 (Gly42~Ser266)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2). This antibody is labeled with HRP.

SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Polyclonal Antibody (Human), PE
4-PAM192Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCO2 (Gly42~Ser266)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2). This antibody is labeled with PE.

SCO2 ORF Vector (Human) (pORF)
ORF014377 1.0 ug DNA
EUR 354

Sco2 ORF Vector (Mouse) (pORF)
ORF056780 1.0 ug DNA
EUR 506

SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Polyclonal Antibody (Human), APC-Cy7
4-PAM192Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCO2 (Gly42~Ser266)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2). This antibody is labeled with APC-Cy7.

SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2) Antibody
20-abx129130
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sco2 sgRNA CRISPR Lentivector set (Mouse)
K4323001 3 x 1.0 ug
EUR 339

SCO2 sgRNA CRISPR Lentivector set (Human)
K2104001 3 x 1.0 ug
EUR 339

Sco2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4323002 1.0 ug DNA
EUR 154

Sco2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4323003 1.0 ug DNA
EUR 154

Sco2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4323004 1.0 ug DNA
EUR 154

SCO2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2104002 1.0 ug DNA
EUR 154

SCO2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2104003 1.0 ug DNA
EUR 154

SCO2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2104004 1.0 ug DNA
EUR 154

SCO2 Protein Vector (Human) (pPB-C-His)
PV057505 500 ng
EUR 481

SCO2 Protein Vector (Human) (pPB-N-His)
PV057506 500 ng
EUR 481

SCO2 Protein Vector (Human) (pPM-C-HA)
PV057507 500 ng
EUR 481

SCO2 Protein Vector (Human) (pPM-C-His)
PV057508 500 ng
EUR 481

SCO2 Protein Vector (Mouse) (pPB-C-His)
PV227118 500 ng
EUR 603

SCO2 Protein Vector (Mouse) (pPB-N-His)
PV227119 500 ng
EUR 603

SCO2 Protein Vector (Mouse) (pPM-C-HA)
PV227120 500 ng
EUR 603

SCO2 Protein Vector (Mouse) (pPM-C-His)
PV227121 500 ng
EUR 603

Sco2 3'UTR Luciferase Stable Cell Line
TU118434 1.0 ml Ask for price

Sco2 3'UTR GFP Stable Cell Line
TU168434 1.0 ml Ask for price

SCO2 3'UTR GFP Stable Cell Line
TU072741 1.0 ml
EUR 1394

SCO2 3'UTR Luciferase Stable Cell Line
TU022741 1.0 ml
EUR 1394

Recombinant SCO Cytochrome Oxidase Deficient Homolog 2 (SCO2)
4-RPM192Hu01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O43819
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.0kDa
  • Isoelectric Point: 6.9
Description: Recombinant Human SCO Cytochrome Oxidase Deficient Homolog 2 expressed in: E.coli

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

SCO2 Rabbit Polyclonal Antibody