SKAP1 Rabbit Polyclonal Antibody

SKAP1 Polyclonal Antibody
ABP60416-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human SKAP1 protein Applications tips:
Description: A polyclonal antibody for detection of SKAP1 from Human, Mouse, Rat. This SKAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SKAP1 protein

SKAP1 Polyclonal Antibody
ABP60416-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human SKAP1 protein Applications tips:
Description: A polyclonal antibody for detection of SKAP1 from Human, Mouse, Rat. This SKAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SKAP1 protein

SKAP1 Polyclonal Antibody
ABP60416-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human SKAP1 protein Applications tips:
Description: A polyclonal antibody for detection of SKAP1 from Human, Mouse, Rat. This SKAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SKAP1 protein

SKAP1 Polyclonal Antibody
ES10947-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against SKAP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SKAP1 Polyclonal Antibody
ES10947-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against SKAP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SKAP1 Rabbit pAb
A3345-100ul	Abclonal	100 ul	EUR 308

SKAP1 Rabbit pAb
A3345-200ul	Abclonal	200 ul	EUR 459

SKAP1 Rabbit pAb
A3345-20ul	Abclonal	20 ul	EUR 183

SKAP1 Rabbit pAb
A3345-50ul	Abclonal	50 ul	EUR 223

SKAP1 Polyclonal Conjugated Antibody
C30445	SAB	100ul	EUR 397

SKAP1 antibody
70R-21696	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SKAP1 antibody

SKAP1 Antibody
1-CSB-PA769799LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SKAP1. Recognizes SKAP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

SKAP1 antibody
70R-5761	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SKAP1 antibody raised against the N terminal of SKAP1

SKAP1 Antibody
1-CSB-PA021354GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SKAP1. Recognizes SKAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SKAP1 Polyclonal Antibody, Biotin Conjugated
A54277	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

SKAP1 Polyclonal Antibody, FITC Conjugated
A54278	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

SKAP1 Polyclonal Antibody, HRP Conjugated
A54279	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Skap1/ Rat Skap1 ELISA Kit
ELI-42265r	Lifescience Market	96 Tests	EUR 886

Anti-SKAP1 antibody
STJ116201	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a T cell adaptor protein, a class of intracellular molecules with modular domains capable of recruiting additional proteins but that exhibit no intrinsic enzymatic activity. The encoded protein contains a unique N-terminal region followed by a PH domain and C-terminal SH3 domain. Along with the adhesion and degranulation-promoting adaptor protein, the encoded protein plays a critical role in inside-out signaling by coupling T-cell antigen receptor stimulation to the activation of integrins.

Anti-SKAP1 antibody
STJ192105	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to SKAP1

SKAP1 siRNA
20-abx904950	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SKAP1 siRNA
20-abx933439	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SKAP1 siRNA
20-abx933440	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SKAP1 Antibody, HRP conjugated
1-CSB-PA769799LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SKAP1. Recognizes SKAP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SKAP1 Antibody, FITC conjugated
1-CSB-PA769799LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SKAP1. Recognizes SKAP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SKAP1 Antibody, Biotin conjugated
1-CSB-PA769799LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SKAP1. Recognizes SKAP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-SKAP55/SKAP1 Antibody
PB9890	BosterBio	100ug/vial	EUR 334

SKAP1 Blocking Peptide
33R-7848	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SKAP1 antibody, catalog no. 70R-5761

SKAP1 cloning plasmid
CSB-CL769799HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1077 Sequence: atgcaggccgccgccctccctgaggagatccgttggctcctggaagatgctgaagagtttctggcagaaggtttgcggaatgagaacctcagcgctgttgcaagggatcacagagaccatattctacggggctttcagcaaatcaaagccaggtactattgggattttcagcccc Show more
Description: A cloning plasmid for the SKAP1 gene.

Src Kinase Associated Phosphoprotein 1 (SKAP1) Polyclonal Antibody (Rat)
4-PAC846Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SKAP1 (Met1~Arg354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Src Kinase Associated Phosphoprotein 1 (SKAP1)

Rat SKAP1 shRNA Plasmid
20-abx988192	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse SKAP1 shRNA Plasmid
20-abx978908	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human SKAP1 shRNA Plasmid
20-abx955671	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SKAP1 Recombinant Protein (Human)
RP028627	ABM	100 ug	Ask for price

SKAP1 Recombinant Protein (Rat)
RP228818	ABM	100 ug	Ask for price

SKAP1 Recombinant Protein (Mouse)
RP172040	ABM	100 ug	Ask for price

SKAP1 Recombinant Protein (Mouse)
RP172043	ABM	100 ug	Ask for price

SKAP1 Recombinant Protein (Mouse)
RP172046	ABM	100 ug	Ask for price

Src Kinase Associated Phosphoprotein 1 (SKAP1) Polyclonal Antibody (Mouse, Rat)
4-PAC846Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SKAP1 (Met1~Ile355) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Src Kinase Associated Phosphoprotein 1 (SKAP1)

SKAP1 Rabbit Polyclonal Antibody