셀타젠 Genetic Genotyping

SKAP1 Rabbit Polyclonal Antibody

SKAP1 Polyclonal Antibody

ABP60416-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SKAP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SKAP1 from Human, Mouse, Rat. This SKAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SKAP1 protein

SKAP1 Polyclonal Antibody

ABP60416-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SKAP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SKAP1 from Human, Mouse, Rat. This SKAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SKAP1 protein

SKAP1 Polyclonal Antibody

A54280 100 µg
EUR 570.55
Description: fast delivery possible

SKAP1 Polyclonal Antibody

30445-100ul 100ul
EUR 252

SKAP1 Polyclonal Antibody

30445-50ul 50ul
EUR 187

SKAP1 Rabbit pAb

A3345-100ul 100 ul
EUR 308

SKAP1 Rabbit pAb

A3345-200ul 200 ul
EUR 459

SKAP1 Rabbit pAb

A3345-20ul 20 ul
EUR 183

SKAP1 Rabbit pAb

A3345-50ul 50 ul
EUR 223

SKAP1 Polyclonal Conjugated Antibody

C30445 100ul
EUR 397

SKAP1 antibody

70R-5761 50 ug
EUR 467
Description: Rabbit polyclonal SKAP1 antibody raised against the N terminal of SKAP1

SKAP1 antibody

70R-21696 50 ul
EUR 435
Description: Rabbit polyclonal SKAP1 antibody

SKAP1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SKAP1. Recognizes SKAP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

SKAP1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SKAP1. Recognizes SKAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SKAP1 Polyclonal Antibody, Biotin Conjugated

A54277 100 µg
EUR 570.55
Description: kits suitable for this type of research

SKAP1 Polyclonal Antibody, FITC Conjugated

A54278 100 µg
EUR 570.55
Description: fast delivery possible

SKAP1 Polyclonal Antibody, HRP Conjugated

A54279 100 µg
EUR 570.55
Description: reagents widely cited

Anti-SKAP1 antibody

STJ116201 100 µl
EUR 277
Description: This gene encodes a T cell adaptor protein, a class of intracellular molecules with modular domains capable of recruiting additional proteins but that exhibit no intrinsic enzymatic activity. The encoded protein contains a unique N-terminal region followed by a PH domain and C-terminal SH3 domain. Along with the adhesion and degranulation-promoting adaptor protein, the encoded protein plays a critical role in inside-out signaling by coupling T-cell antigen receptor stimulation to the activation of integrins.

Anti-SKAP1 antibody

STJ192105 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SKAP1

Skap1/ Rat Skap1 ELISA Kit

ELI-42265r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SKAP1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SKAP1. Recognizes SKAP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SKAP1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SKAP1. Recognizes SKAP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SKAP1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SKAP1. Recognizes SKAP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-SKAP55/SKAP1 Antibody

PB9890 100ug/vial
EUR 334

SKAP1 Blocking Peptide

33R-7848 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SKAP1 antibody, catalog no. 70R-5761

SKAP1 cloning plasmid

CSB-CL769799HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1077
  • Sequence: atgcaggccgccgccctccctgaggagatccgttggctcctggaagatgctgaagagtttctggcagaaggtttgcggaatgagaacctcagcgctgttgcaagggatcacagagaccatattctacggggctttcagcaaatcaaagccaggtactattgggattttcagcccc
  • Show more
Description: A cloning plasmid for the SKAP1 gene.

Src Kinase Associated Phosphoprotein 1 (SKAP1) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SKAP1 (Met1~Arg354)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Src Kinase Associated Phosphoprotein 1 (SKAP1)

Mouse SKAP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SKAP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SKAP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SKAP1 Recombinant Protein (Human)

RP028627 100 ug Ask for price

SKAP1 Recombinant Protein (Rat)

RP228818 100 ug Ask for price

SKAP1 Recombinant Protein (Mouse)

RP172040 100 ug Ask for price

SKAP1 Recombinant Protein (Mouse)

RP172043 100 ug Ask for price

SKAP1 Recombinant Protein (Mouse)

RP172046 100 ug Ask for price

Src Kinase Associated Phosphoprotein 1 (SKAP1) Polyclonal Antibody (Mouse, Rat)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SKAP1 (Met1~Ile355)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Src Kinase Associated Phosphoprotein 1 (SKAP1)

SKAP1 Rabbit Polyclonal Antibody