SLPI Rabbit Polyclonal Antibody
SLPI Polyclonal Antibody |
ABP60433-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human SLPI protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SLPI from Human, Mouse. This SLPI antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SLPI protein |
SLPI Polyclonal Antibody |
ABP60433-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SLPI protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SLPI from Human, Mouse. This SLPI antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SLPI protein |
SLPI Polyclonal Antibody |
ABP60433-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SLPI protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SLPI from Human, Mouse. This SLPI antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SLPI protein |
SLPI Polyclonal Antibody |
ES11078-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against SLPI from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SLPI Polyclonal Antibody |
ES11078-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against SLPI from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SLPI Rabbit pAb |
A1897-100ul |
Abclonal |
100 ul |
EUR 308 |
SLPI Rabbit pAb |
A1897-200ul |
Abclonal |
200 ul |
EUR 459 |
SLPI Rabbit pAb |
A1897-20ul |
Abclonal |
20 ul |
EUR 183 |
SLPI Rabbit pAb |
A1897-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit |
DLR-SLPI-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretory Leukocyte Peptidase Inhibitor (SLPI) in samples from serum, plasma or other biological fluids. |
Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit |
DLR-SLPI-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretory Leukocyte Peptidase Inhibitor (SLPI) in samples from serum, plasma or other biological fluids. |
Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit |
DLR-SLPI-Mu-48T |
DL Develop |
48T |
EUR 508 |
- Should the Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit |
DLR-SLPI-Mu-96T |
DL Develop |
96T |
EUR 661 |
- Should the Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit |
RD-SLPI-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit |
RD-SLPI-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit |
RD-SLPI-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit |
RD-SLPI-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit |
RDR-SLPI-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit |
RDR-SLPI-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit |
RDR-SLPI-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit |
RDR-SLPI-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Rabbit SLPI ELISA Kit |
ERTS0123 |
Abclonal |
96Tests |
EUR 521 |
SLPI Polyclonal Antibody, HRP Conjugated |
A51963 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
SLPI Polyclonal Antibody, FITC Conjugated |
A51964 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
SLPI Polyclonal Antibody, Biotin Conjugated |
A51965 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
SLPI Antibody |
24542-100ul |
SAB |
100ul |
EUR 390 |
SLPI Antibody |
24543-100ul |
SAB |
100ul |
EUR 390 |
SLPI antibody |
70R-15411 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal SLPI antibody |
SLPI antibody |
38316-100ul |
SAB |
100ul |
EUR 252 |
SLPI Antibody |
1-CSB-PA07154A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SLPI. Recognizes SLPI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
SLPI antibody |
70R-9706 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal SLPI antibody |
SLPI antibody (HRP) |
60R-2044 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal SLPI antibody (HRP) |
SLPI antibody (FITC) |
60R-2045 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal SLPI antibody (FITC) |
SLPI antibody (biotin) |
60R-2046 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal SLPI antibody (biotin) |
Anti-SLPI Antibody |
A01682-1 |
BosterBio |
100ug/vial |
EUR 334 |
Antileukoproteinase (SLPI) Antibody |
20-abx109544 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
SLPI Conjugated Antibody |
C38316 |
SAB |
100ul |
EUR 397 |
Anti-SLPI antibody |
STJ11100591 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a secreted inhibitor which protects epithelial tissues from serine proteases. It is found in various secretions including seminal plasma, cervical mucus, and bronchial secretions, and has affinity for trypsin, leukocyte elastase, and cathepsin G. Its inhibitory effect contributes to the immune response by protecting epithelial surfaces from attack by endogenous proteolytic enzymes. This antimicrobial protein has antibacterial, antifungal and antiviral activity. |
Anti-SLPI antibody |
STJ192236 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SLPI |
SLPI siRNA |
20-abx934267 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SLPI siRNA |
20-abx934268 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-SLPI |
YF-PA24724 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to SLPI |
anti-SLPI |
YF-PA27362 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to SLPI |
SLPI Antibody, HRP conjugated |
1-CSB-PA07154B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SLPI. Recognizes SLPI from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SLPI Antibody, FITC conjugated |
1-CSB-PA07154C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SLPI. Recognizes SLPI from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SLPI Antibody, Biotin conjugated |
1-CSB-PA07154D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SLPI. Recognizes SLPI from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse) |
4-PAB312Mu01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SLPI (Pro20~Met131)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) |
SLPI cloning plasmid |
CSB-CL021781HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 399
- Sequence: atgaagtccagcggcctcttccccttcctggtgctgcttgccctgggaactctggcaccttgggctgtggaaggctctggaaagtccttcaaagctggagtctgtcctcctaagaaatctgcccagtgccttagatacaagaaacctgagtgccagagtgactggcagtgtccagg
- Show more
|
Description: A cloning plasmid for the SLPI gene. |
Anti-SLPI (3C6) |
YF-MA15457 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to SLPI |
Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), APC |
4-PAB312Mu01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SLPI (Pro20~Met131)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with APC. |
Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), Biotinylated |
4-PAB312Mu01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SLPI (Pro20~Met131)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with Biotin. |
Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), Cy3 |
4-PAB312Mu01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SLPI (Pro20~Met131)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with Cy3. |
Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), FITC |
4-PAB312Mu01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SLPI (Pro20~Met131)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with FITC. |
Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), HRP |
4-PAB312Mu01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SLPI (Pro20~Met131)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with HRP. |
Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), PE |
4-PAB312Mu01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SLPI (Pro20~Met131)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with PE. |
Rabbit Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit |
abx363252-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAB312Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SLPI (Pro20~Met131)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with APC-Cy7. |
Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody |
20-abx178335 |
Abbexa |
|
|
|
Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody |
20-abx178336 |
Abbexa |
|
|
|
Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody |
20-abx104088 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody |
20-abx174486 |
Abbexa |
|
|
|
Secretory Leukocyte Protease Inhibitor (SLPI) Antibody |
abx411960-01mg |
Abbexa |
0.1 mg |
EUR 509 |
|
SLPI protein (His tag) |
80R-1362 |
Fitzgerald |
50 ug |
EUR 397 |
Description: Purified recombinant Human SLPI protein |
Human SLPI ELISA Kit |
EHS0123 |
Abclonal |
96Tests |
EUR 521 |
Bovine SLPI ELISA Kit |
EBS0123 |
Abclonal |
96Tests |
EUR 521 |
Anserini SLPI ELISA Kit |
EAS0123 |
Abclonal |
96Tests |
EUR 521 |
Chicken SLPI ELISA Kit |
ECKS0123 |
Abclonal |
96Tests |
EUR 521 |
Canine SLPI ELISA Kit |
ECS0123 |
Abclonal |
96Tests |
EUR 521 |
Goat SLPI ELISA Kit |
EGTS0123 |
Abclonal |
96Tests |
EUR 521 |
Mouse SLPI shRNA Plasmid |
20-abx972769 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SLPI shRNA Plasmid |
20-abx954476 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Porcine SLPI ELISA Kit |
EPS0123 |
Abclonal |
96Tests |
EUR 521 |
Sheep SLPI ELISA Kit |
ESS0123 |
Abclonal |
96Tests |
EUR 521 |
Rat SLPI ELISA Kit |
ERS0123 |
Abclonal |
96Tests |
EUR 521 |
Monkey SLPI ELISA Kit |
EMKS0123 |
Abclonal |
96Tests |
EUR 521 |
Mouse SLPI ELISA Kit |
EMS0123 |
Abclonal |
96Tests |
EUR 521 |
SLPI Recombinant Protein (Rat) |
RP229982 |
ABM |
100 ug |
Ask for price |
SLPI Recombinant Protein (Human) |
RP029323 |
ABM |
100 ug |
Ask for price |
SLPI Recombinant Protein (Mouse) |
RP173741 |
ABM |
100 ug |
Ask for price |
Secretory Leukocyte Protease Inhibitor (SLPI) Antibody Pair |
abx117629-1pair5x96wellplates |
Abbexa |
1 pair (5x96 well plates) |
EUR 1010 |
- Shipped within 5-10 working days.
|
Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody (Biotin) |
20-abx272778 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1288.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody Pair |
20-abx370266 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody (FITC) |
20-abx273938 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1386.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse SLPI PicoKine ELISA Kit |
EK1996 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse SLPI in cell culture supernates, serum and plasma (heparin, EDTA). |
Guinea Pig SLPI ELISA Kit |
EGS0123 |
Abclonal |
96Tests |
EUR 521 |
Human SLPI/ Antileukoproteinase ELISA Kit |
E2340Hu |
Sunlong |
1 Kit |
EUR 537 |
Porcine Antileukoproteinase, SLPI ELISA KIT |
ELI-04342p |
Lifescience Market |
96 Tests |
EUR 928 |
Slpi ORF Vector (Rat) (pORF) |
ORF076662 |
ABM |
1.0 ug DNA |
EUR 506 |
SLPI ORF Vector (Human) (pORF) |
ORF009775 |
ABM |
1.0 ug DNA |
EUR 95 |
Slpi ORF Vector (Mouse) (pORF) |
ORF057915 |
ABM |
1.0 ug DNA |
EUR 506 |
SLPI ELISA Kit (Mouse) (OKAN05921) |
OKAN05921 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.3 pg/mL |
SLPI ELISA Kit (Human) (OKAN06205) |
OKAN06205 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a secreted inhibitor which protects epithelial tissues from serine proteases. It is found in various secretions including seminal plasma, cervical mucus, and bronchial secretions, and has affinity for trypsin, leukocyte elastase, and cathepsin G. Its inhibitory effect contributes to the immune response by protecting epithelial surfaces from attack by endogenous proteolytic enzymes. This antimicrobial protein has antibacterial, antifungal and antiviral activity.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 27.1 pg/mL |
Slpi ELISA Kit (Mouse) (OKBB01366) |
OKBB01366 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Antileukoproteinase, also known as secretory leukocyte protease inhibitor (SLPI), is an enzyme that in humans is encoded by the SLPI gene. It is mapped to 2; 2 H3. SLPI is a highly cationic single-chain protein with eight intramolecular disulfide bonds. It is found in large quantities in bronchial, cervical, and nasal mucosa, saliva, and seminal fluids. SLPI inhibits human leukocyte elastase, human cathepsin G, human trypsin, neutrophil elastase, and mast cell chymase. X-ray crystallography has shown that SLPI has two homologous domains of 53 and 54 amino acids, one of which exhibits anti-protease activity (C-terminal domain). The other domain (N-terminal domain) is not known to have any function.This gene encodes a secreted inhibitor which protects epithelial tissues from serine proteases. It is found in various secretions including seminal plasma, cervical mucus, and bronchial secretions, and has affinity for trypsin, leukocyte elastase, and cathepsin G. Its inhibitory effect contributes to the immune response by protecting epithelial surfaces from attack by endogenous proteolytic enzymes; the protein is also thought to have broad-spectrum anti-biotic activity.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
SLPI ELISA Kit (Mouse) (OKCD00172) |
OKCD00172 |
Aviva Systems Biology |
96 Wells |
EUR 818 |
Description: Description of target: Acid-stable proteinase inhibitor with strong affinities for trypsin, chymotrypsin, elastase, and cathepsin G. Modulates the innate immune response after bacterial infection. Contributes to regulate the inflammatory and immune responses to the intracellular parasite L.major. Down-regulates responses to bacterial lipopolysaccharide (LPS). Plays a role in regulating the activation of NF-kappa-B and inflammatory responses. Has antimicrobial activity against mycobacteria, but not against salmonella. Contributes to normal resistance against infection by M.tuberculosis. Required for normal resistance to L.major. Required for normal wound healing, probably by preventing tissue damage by limiting protease activity. Together with ELANE, required for normal differentiation and proliferation of bone marrow myeloid cells.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.5 pg/mL |
SLPI ELISA Kit (Human) (OKCD07307) |
OKCD07307 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: This gene encodes a secreted inhibitor which protects epithelial tissues from serine proteases. It is found in various secretions including seminal plasma, cervical mucus, and bronchial secretions, and has affinity for trypsin, leukocyte elastase, and cathepsin G. Its inhibitory effect contributes to the immune response by protecting epithelial surfaces from attack by endogenous proteolytic enzymes; the protein is also thought to have broad-spectrum anti-biotic activity.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 27.1pg/mL |
SLPI ELISA Kit (Mouse) (OKEH06411) |
OKEH06411 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Acid-stable proteinase inhibitor with strong affinities for trypsin, chymotrypsin, elastase, and cathepsin G. Modulates the innate immune response after bacterial infection. Contributes to regulate the inflammatory and immune responses to the intracellular parasite L.major. Down-regulates responses to bacterial lipopolysaccharide (LPS). Plays a role in regulating the activation of NF-kappa-B and inflammatory responses. Has antimicrobial activity against mycobacteria, but not against salmonella. Contributes to normal resistance against infection by M.tuberculosis. Required for normal resistance to L.major. Required for normal wound healing, probably by preventing tissue damage by limiting protease activity. Together with ELANE, required for normal differentiation and proliferation of bone marrow myeloid cells.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL |
SLPI ELISA Kit (Rat) (OKEI00834) |
OKEI00834 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL |
SLPI ELISA Kit (Human) (OKEH04022) |
OKEH04022 |
Aviva Systems Biology |
96 Wells |
EUR 544 |
Description: Description of target: This gene encodes a secreted inhibitor which protects epithelial tissues from serine proteases. It is found in various secretions including seminal plasma, cervical mucus, and bronchial secretions, and has affinity for trypsin, leukocyte elastase, and cathepsin G. Its inhibitory effect contributes to the immune response by protecting epithelial surfaces from attack by endogenous proteolytic enzymes. This antimicrobial protein has antibacterial, antifungal and antiviral activity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12 pg/mL |
Secretory Leukocyte Protease Inhibitor (SLPI) Protein |
20-abx262896 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Slpi sgRNA CRISPR Lentivector set (Rat) |
K7074101 |
ABM |
3 x 1.0 ug |
EUR 339 |
SLPI sgRNA CRISPR Lentivector set (Human) |
K2197001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Slpi sgRNA CRISPR Lentivector set (Mouse) |
K3720101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Secretory Leukocyte Peptidase Inhibitor (SLPI) |
4-RPB312Mu01 |
Cloud-Clone |
-
EUR 548.00
-
EUR 250.00
-
EUR 1780.00
-
EUR 660.00
-
EUR 1220.00
-
EUR 430.00
-
EUR 4300.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P97430
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.1kDa
- Isoelectric Point: 8.7
|
Description: Recombinant Mouse Secretory Leukocyte Peptidase Inhibitor expressed in: E.coli |
Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) Protein |
20-abx069004 |
Abbexa |
-
EUR 759.00
-
EUR 300.00
-
EUR 2388.00
-
EUR 913.00
-
EUR 537.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Secretory Leukocyte Peptidase Inhibitor (SLPI) Protein |
20-abx655013 |
Abbexa |
-
EUR 425.00
-
EUR 230.00
-
EUR 1149.00
-
EUR 495.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Slpi sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7074102 |
ABM |
1.0 ug DNA |
EUR 154 |
Slpi sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7074103 |
ABM |
1.0 ug DNA |
EUR 154 |
Slpi sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7074104 |
ABM |
1.0 ug DNA |
EUR 154 |
SLPI sgRNA CRISPR Lentivector (Human) (Target 1) |
K2197002 |
ABM |
1.0 ug DNA |
EUR 154 |
SLPI sgRNA CRISPR Lentivector (Human) (Target 2) |
K2197003 |
ABM |
1.0 ug DNA |
EUR 154 |
SLPI sgRNA CRISPR Lentivector (Human) (Target 3) |
K2197004 |
ABM |
1.0 ug DNA |
EUR 154 |
Slpi sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3720102 |
ABM |
1.0 ug DNA |
EUR 154 |
Slpi sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3720103 |
ABM |
1.0 ug DNA |
EUR 154 |
Slpi sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3720104 |
ABM |
1.0 ug DNA |
EUR 154 |
SLPI Protein Vector (Rat) (pPB-C-His) |
PV306646 |
ABM |
500 ng |
EUR 603 |
SLPI Protein Vector (Rat) (pPB-N-His) |
PV306647 |
ABM |
500 ng |
EUR 603 |
SLPI Protein Vector (Rat) (pPM-C-HA) |
PV306648 |
ABM |
500 ng |
EUR 603 |
SLPI Protein Vector (Rat) (pPM-C-His) |
PV306649 |
ABM |
500 ng |
EUR 603 |
SLPI Protein Vector (Human) (pPB-C-His) |
PV039097 |
ABM |
500 ng |
EUR 329 |
SLPI Protein Vector (Human) (pPB-N-His) |
PV039098 |
ABM |
500 ng |
EUR 329 |
SLPI Protein Vector (Human) (pPM-C-HA) |
PV039099 |
ABM |
500 ng |
EUR 329 |
SLPI Protein Vector (Human) (pPM-C-His) |
PV039100 |
ABM |
500 ng |
EUR 329 |
SLPI Protein Vector (Mouse) (pPB-C-His) |
PV231658 |
ABM |
500 ng |
EUR 603 |
SLPI Protein Vector (Mouse) (pPB-N-His) |
PV231659 |
ABM |
500 ng |
EUR 603 |
SLPI Protein Vector (Mouse) (pPM-C-HA) |
PV231660 |
ABM |
500 ng |
EUR 603 |
SLPI Protein Vector (Mouse) (pPM-C-His) |
PV231661 |
ABM |
500 ng |
EUR 603 |
Recombinant Human SLPI Protein, His, E.coli-10ug |
QP13524-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human SLPI Protein, His, E.coli-1mg |
QP13524-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Human SLPI Protein, His, E.coli-2ug |
QP13524-2ug |
EnQuireBio |
2ug |
EUR 155 |
Slpi 3'UTR Luciferase Stable Cell Line |
TU119278 |
ABM |
1.0 ml |
Ask for price |
Slpi 3'UTR GFP Stable Cell Line |
TU169278 |
ABM |
1.0 ml |
Ask for price |
Slpi 3'UTR Luciferase Stable Cell Line |
TU220796 |
ABM |
1.0 ml |
Ask for price |
Slpi 3'UTR GFP Stable Cell Line |
TU270796 |
ABM |
1.0 ml |
Ask for price |
SLPI 3'UTR GFP Stable Cell Line |
TU073688 |
ABM |
1.0 ml |
EUR 1394 |
SLPI 3'UTR Luciferase Stable Cell Line |
TU023688 |
ABM |
1.0 ml |
EUR 1394 |
SLPI Chemi-Luminescent ELISA Kit (Mouse) (OKCD03926) |
OKCD03926 |
Aviva Systems Biology |
96 Wells |
EUR 1027 |
Description: Description of target: Acid-stable proteinase inhibitor with strong affinities for trypsin, chymotrypsin, elastase, and cathepsin G . Modulates the innate immune response after bacterial infection . Contributes to regulate the inflammatory and immune responses to the intracellular parasite L.major . Down-regulates responses to bacterial lipopolysaccharide (LPS) . Plays a role in regulating the activation of NF-kappa-B and inflammatory responses . Has antimicrobial activity against mycobacteria, but not against salmonella . Contributes to normal resistance against infection by M.tuberculosis . Required for normal resistance to L.major . Required for normal wound healing, probably by preventing tissue damage by limiting protease activity . Together with ELANE, required for normal differentiation and proliferation of bone marrow myeloid cells .;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
SLPI Rabbit Polyclonal Antibody