SMC1B Rabbit Polyclonal Antibody
 SMC1B Polyclonal Antibody |
|
ABP60442-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SMC1B protein at amino acid sequence of 110-190
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SMC1B from Human. This SMC1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SMC1B protein at amino acid sequence of 110-190 |
SMC1B Polyclonal Antibody |
|
27845-100ul |
SAB |
100ul |
EUR 252 |
SMC1B Polyclonal Antibody |
|
27845-50ul |
SAB |
50ul |
EUR 187 |
 SMC1B Rabbit pAb |
|
A12905-100ul |
Abclonal |
100 ul |
EUR 308 |
SMC1B Rabbit pAb |
|
A12905-200ul |
Abclonal |
200 ul |
EUR 459 |
SMC1B Rabbit pAb |
|
A12905-20ul |
Abclonal |
20 ul |
EUR 183 |
SMC1B Rabbit pAb |
|
A12905-50ul |
Abclonal |
50 ul |
EUR 223 |
 SMC1B Polyclonal Conjugated Antibody |
|
C27845 |
SAB |
100ul |
EUR 397 |
 SMC1B antibody |
|
22261-100ul |
SAB |
100ul |
EUR 390 |
SMC1B antibody |
|
70R-13457 |
Fitzgerald |
100 ul |
EUR 457 |
|
Description: Affinity purified Rabbit polyclonal SMC1B antibody |
 SMC1B Antibody |
|
1-CSB-PA854104LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500 |
 Anti-SMC1B antibody |
|
STJ192510 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to SMC1B |
 SMC1B siRNA |
|
20-abx934334 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SMC1B siRNA |
|
20-abx934335 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-SMC1B |
|
YF-PA26039 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to SMC1B |
 SMC1B Antibody, HRP conjugated |
|
1-CSB-PA854104LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 SMC1B Antibody, FITC conjugated |
|
1-CSB-PA854104LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 SMC1B Antibody, Biotin conjugated |
|
1-CSB-PA854104LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 SMC1B cloning plasmid |
|
CSB-CL854104HU-10ug |
Cusabio |
10ug |
EUR 1235 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3486
- Sequence: atggcccacctggagctgctgcttgtggaaaatttcaagtcgtggcggggccgccaggtcattggccccttccggaggttcacctgcatcatcggccccaacggctctggaaaatctaatgtaatggatgcacttagttttgtaatgggagagaaaatagctaatttaagagtga
- Show more
|
|
Description: A cloning plasmid for the SMC1B gene. |
) Anti-SMC1B (6A10) |
|
YF-MA18167 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to SMC1B |
 Mouse SMC1B shRNA Plasmid |
|
20-abx980255 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human SMC1B shRNA Plasmid |
|
20-abx958980 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 (pORF)) Smc1b ORF Vector (Mouse) (pORF) |
|
ORF057963 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Smc1b ORF Vector (Rat) (pORF) |
|
ORF076690 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) SMC1B ORF Vector (Human) (pORF) |
|
ORF014533 |
ABM |
1.0 ug DNA |
EUR 354 |
) SMC1B sgRNA CRISPR Lentivector set (Human) |
|
K2199901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Smc1b sgRNA CRISPR Lentivector set (Rat) |
|
K6148001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Smc1b sgRNA CRISPR Lentivector set (Mouse) |
|
K3886601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) SMC1B sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2199902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) SMC1B sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2199903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) SMC1B sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2199904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Smc1b sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6148002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Smc1b sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6148003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Smc1b sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6148004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Smc1b sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3886602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Smc1b sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3886603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Smc1b sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3886604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) SMC1B Protein Vector (Human) (pPB-C-His) |
|
PV058129 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) SMC1B Protein Vector (Human) (pPB-N-His) |
|
PV058130 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) SMC1B Protein Vector (Human) (pPM-C-HA) |
|
PV058131 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) SMC1B Protein Vector (Human) (pPM-C-His) |
|
PV058132 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) SMC1B Protein Vector (Rat) (pPB-C-His) |
|
PV306758 |
ABM |
500 ng |
EUR 1191 |
 (pPB-N-His)) SMC1B Protein Vector (Rat) (pPB-N-His) |
|
PV306759 |
ABM |
500 ng |
EUR 1191 |
 (pPM-C-HA)) SMC1B Protein Vector (Rat) (pPM-C-HA) |
|
PV306760 |
ABM |
500 ng |
EUR 1191 |
 (pPM-C-His)) SMC1B Protein Vector (Rat) (pPM-C-His) |
|
PV306761 |
ABM |
500 ng |
EUR 1191 |
 (pPB-C-His)) SMC1B Protein Vector (Mouse) (pPB-C-His) |
|
PV231850 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) SMC1B Protein Vector (Mouse) (pPB-N-His) |
|
PV231851 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) SMC1B Protein Vector (Mouse) (pPM-C-HA) |
|
PV231852 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) SMC1B Protein Vector (Mouse) (pPM-C-His) |
|
PV231853 |
ABM |
500 ng |
EUR 1065 |
 Smc1b 3'UTR GFP Stable Cell Line |
|
TU169312 |
ABM |
1.0 ml |
Ask for price |
 SMC1B 3'UTR Luciferase Stable Cell Line |
|
TU023719 |
ABM |
1.0 ml |
EUR 1394 |
 Smc1b 3'UTR Luciferase Stable Cell Line |
|
TU119312 |
ABM |
1.0 ml |
Ask for price |
 SMC1B 3'UTR GFP Stable Cell Line |
|
TU073719 |
ABM |
1.0 ml |
EUR 1394 |
Smc1b 3'UTR Luciferase Stable Cell Line |
|
TU220826 |
ABM |
1.0 ml |
Ask for price |
Smc1b 3'UTR GFP Stable Cell Line |
|
TU270826 |
ABM |
1.0 ml |
Ask for price |
 Human Structural maintenance of chromosomes protein 1B, SMC1B EL |
|
ELI-41471h |
Lifescience Market |
96 Tests |
EUR 824 |
 Mouse Structural maintenance of chromosomes protein 1B, Smc1b EL |
|
ELI-42284m |
Lifescience Market |
96 Tests |
EUR 865 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
SMC1B Rabbit Polyclonal Antibody