CelltaGen
셀타젠 Genetic Genotyping

SMC1B Rabbit Polyclonal Antibody

SMC1B Polyclonal Antibody

ABP60442-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SMC1B protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of SMC1B from Human. This SMC1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SMC1B protein at amino acid sequence of 110-190

SMC1B Polyclonal Antibody

ES11352-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SMC1B from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

SMC1B Polyclonal Antibody

ES11352-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SMC1B from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

SMC1B Rabbit pAb

A12905-100ul 100 ul
EUR 308

SMC1B Rabbit pAb

A12905-200ul 200 ul
EUR 459

SMC1B Rabbit pAb

A12905-20ul 20 ul
EUR 183

SMC1B Rabbit pAb

A12905-50ul 50 ul
EUR 223

SMC1B Polyclonal Conjugated Antibody

C27845 100ul
EUR 397

SMC1B antibody

22261-100ul 100ul
EUR 390

SMC1B antibody

70R-13457 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal SMC1B antibody

SMC1B Antibody

1-CSB-PA854104LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

Anti-SMC1B antibody

STJ114771 100 µl
EUR 277

Anti-SMC1B antibody

STJ192510 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SMC1B

SMC1B siRNA

20-abx934334
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SMC1B siRNA

20-abx934335
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SMC1B

YF-PA26039 50 ul
EUR 334
Description: Mouse polyclonal to SMC1B

SMC1B Antibody, HRP conjugated

1-CSB-PA854104LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SMC1B Antibody, FITC conjugated

1-CSB-PA854104LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SMC1B Antibody, Biotin conjugated

1-CSB-PA854104LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SMC1B cloning plasmid

CSB-CL854104HU-10ug 10ug
EUR 1235
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3486
  • Sequence: atggcccacctggagctgctgcttgtggaaaatttcaagtcgtggcggggccgccaggtcattggccccttccggaggttcacctgcatcatcggccccaacggctctggaaaatctaatgtaatggatgcacttagttttgtaatgggagagaaaatagctaatttaagagtga
  • Show more
Description: A cloning plasmid for the SMC1B gene.

Anti-SMC1B (6A10)

YF-MA18167 100 ug
EUR 363
Description: Mouse monoclonal to SMC1B

Human SMC1B shRNA Plasmid

20-abx958980
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SMC1B shRNA Plasmid

20-abx980255
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Smc1b ORF Vector (Rat) (pORF)

ORF076690 1.0 ug DNA
EUR 506

SMC1B ORF Vector (Human) (pORF)

ORF014533 1.0 ug DNA
EUR 354

Smc1b ORF Vector (Mouse) (pORF)

ORF057963 1.0 ug DNA
EUR 506

Smc1b sgRNA CRISPR Lentivector set (Rat)

K6148001 3 x 1.0 ug
EUR 339

SMC1B sgRNA CRISPR Lentivector set (Human)

K2199901 3 x 1.0 ug
EUR 339

Smc1b sgRNA CRISPR Lentivector set (Mouse)

K3886601 3 x 1.0 ug
EUR 339

Smc1b sgRNA CRISPR Lentivector (Rat) (Target 1)

K6148002 1.0 ug DNA
EUR 154

Smc1b sgRNA CRISPR Lentivector (Rat) (Target 2)

K6148003 1.0 ug DNA
EUR 154

Smc1b sgRNA CRISPR Lentivector (Rat) (Target 3)

K6148004 1.0 ug DNA
EUR 154

SMC1B sgRNA CRISPR Lentivector (Human) (Target 1)

K2199902 1.0 ug DNA
EUR 154

SMC1B sgRNA CRISPR Lentivector (Human) (Target 2)

K2199903 1.0 ug DNA
EUR 154

SMC1B sgRNA CRISPR Lentivector (Human) (Target 3)

K2199904 1.0 ug DNA
EUR 154

Smc1b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3886602 1.0 ug DNA
EUR 154

Smc1b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3886603 1.0 ug DNA
EUR 154

Smc1b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3886604 1.0 ug DNA
EUR 154

SMC1B Protein Vector (Rat) (pPB-C-His)

PV306758 500 ng
EUR 1191

SMC1B Protein Vector (Rat) (pPB-N-His)

PV306759 500 ng
EUR 1191

SMC1B Protein Vector (Rat) (pPM-C-HA)

PV306760 500 ng
EUR 1191

SMC1B Protein Vector (Rat) (pPM-C-His)

PV306761 500 ng
EUR 1191

SMC1B Protein Vector (Human) (pPB-C-His)

PV058129 500 ng
EUR 481

SMC1B Protein Vector (Human) (pPB-N-His)

PV058130 500 ng
EUR 481

SMC1B Protein Vector (Human) (pPM-C-HA)

PV058131 500 ng
EUR 481

SMC1B Protein Vector (Human) (pPM-C-His)

PV058132 500 ng
EUR 481

SMC1B Protein Vector (Mouse) (pPB-C-His)

PV231850 500 ng
EUR 1065

SMC1B Protein Vector (Mouse) (pPB-N-His)

PV231851 500 ng
EUR 1065

SMC1B Protein Vector (Mouse) (pPM-C-HA)

PV231852 500 ng
EUR 1065

SMC1B Protein Vector (Mouse) (pPM-C-His)

PV231853 500 ng
EUR 1065

Smc1b 3'UTR Luciferase Stable Cell Line

TU119312 1.0 ml Ask for price

Smc1b 3'UTR GFP Stable Cell Line

TU169312 1.0 ml Ask for price

Smc1b 3'UTR Luciferase Stable Cell Line

TU220826 1.0 ml Ask for price

Smc1b 3'UTR GFP Stable Cell Line

TU270826 1.0 ml Ask for price

SMC1B 3'UTR GFP Stable Cell Line

TU073719 1.0 ml
EUR 1394

SMC1B 3'UTR Luciferase Stable Cell Line

TU023719 1.0 ml
EUR 1394

Mouse Structural maintenance of chromosomes protein 1B, Smc1b EL

ELI-42284m 96 Tests
EUR 865

Human Structural maintenance of chromosomes protein 1B, SMC1B EL

ELI-41471h 96 Tests
EUR 824

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

SMC1B Rabbit Polyclonal Antibody