SMC1B Rabbit Polyclonal Antibody
 SMC1B Polyclonal Antibody |
|
ABP60442-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SMC1B protein at amino acid sequence of 110-190
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SMC1B from Human. This SMC1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SMC1B protein at amino acid sequence of 110-190 |
SMC1B Polyclonal Antibody |
|
ES11352-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against SMC1B from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SMC1B Polyclonal Antibody |
|
ES11352-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against SMC1B from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 SMC1B Rabbit pAb |
|
A12905-100ul |
Abclonal |
100 ul |
EUR 308 |
SMC1B Rabbit pAb |
|
A12905-200ul |
Abclonal |
200 ul |
EUR 459 |
SMC1B Rabbit pAb |
|
A12905-20ul |
Abclonal |
20 ul |
EUR 183 |
SMC1B Rabbit pAb |
|
A12905-50ul |
Abclonal |
50 ul |
EUR 223 |
 SMC1B Polyclonal Conjugated Antibody |
|
C27845 |
SAB |
100ul |
EUR 397 |
 SMC1B antibody |
|
22261-100ul |
SAB |
100ul |
EUR 390 |
SMC1B antibody |
|
70R-13457 |
Fitzgerald |
100 ul |
EUR 457 |
|
Description: Affinity purified Rabbit polyclonal SMC1B antibody |
 SMC1B Antibody |
|
1-CSB-PA854104LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500 |
 Anti-SMC1B antibody |
|
STJ192510 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to SMC1B |
 SMC1B siRNA |
|
20-abx934334 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SMC1B siRNA |
|
20-abx934335 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-SMC1B |
|
YF-PA26039 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to SMC1B |
 SMC1B Antibody, HRP conjugated |
|
1-CSB-PA854104LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 SMC1B Antibody, FITC conjugated |
|
1-CSB-PA854104LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 SMC1B Antibody, Biotin conjugated |
|
1-CSB-PA854104LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 SMC1B cloning plasmid |
|
CSB-CL854104HU-10ug |
Cusabio |
10ug |
EUR 1235 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3486
- Sequence: atggcccacctggagctgctgcttgtggaaaatttcaagtcgtggcggggccgccaggtcattggccccttccggaggttcacctgcatcatcggccccaacggctctggaaaatctaatgtaatggatgcacttagttttgtaatgggagagaaaatagctaatttaagagtga
- Show more
|
|
Description: A cloning plasmid for the SMC1B gene. |
) Anti-SMC1B (6A10) |
|
YF-MA18167 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to SMC1B |
 Human SMC1B shRNA Plasmid |
|
20-abx958980 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse SMC1B shRNA Plasmid |
|
20-abx980255 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 (pORF)) Smc1b ORF Vector (Rat) (pORF) |
|
ORF076690 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) SMC1B ORF Vector (Human) (pORF) |
|
ORF014533 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Smc1b ORF Vector (Mouse) (pORF) |
|
ORF057963 |
ABM |
1.0 ug DNA |
EUR 506 |
) Smc1b sgRNA CRISPR Lentivector set (Rat) |
|
K6148001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) SMC1B sgRNA CRISPR Lentivector set (Human) |
|
K2199901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Smc1b sgRNA CRISPR Lentivector set (Mouse) |
|
K3886601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Smc1b sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6148002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Smc1b sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6148003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Smc1b sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6148004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) SMC1B sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2199902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) SMC1B sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2199903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) SMC1B sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2199904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Smc1b sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3886602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Smc1b sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3886603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Smc1b sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3886604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) SMC1B Protein Vector (Rat) (pPB-C-His) |
|
PV306758 |
ABM |
500 ng |
EUR 1191 |
 (pPB-N-His)) SMC1B Protein Vector (Rat) (pPB-N-His) |
|
PV306759 |
ABM |
500 ng |
EUR 1191 |
 (pPM-C-HA)) SMC1B Protein Vector (Rat) (pPM-C-HA) |
|
PV306760 |
ABM |
500 ng |
EUR 1191 |
 (pPM-C-His)) SMC1B Protein Vector (Rat) (pPM-C-His) |
|
PV306761 |
ABM |
500 ng |
EUR 1191 |
 (pPB-C-His)) SMC1B Protein Vector (Human) (pPB-C-His) |
|
PV058129 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) SMC1B Protein Vector (Human) (pPB-N-His) |
|
PV058130 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) SMC1B Protein Vector (Human) (pPM-C-HA) |
|
PV058131 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) SMC1B Protein Vector (Human) (pPM-C-His) |
|
PV058132 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) SMC1B Protein Vector (Mouse) (pPB-C-His) |
|
PV231850 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) SMC1B Protein Vector (Mouse) (pPB-N-His) |
|
PV231851 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) SMC1B Protein Vector (Mouse) (pPM-C-HA) |
|
PV231852 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) SMC1B Protein Vector (Mouse) (pPM-C-His) |
|
PV231853 |
ABM |
500 ng |
EUR 1065 |
 Smc1b 3'UTR Luciferase Stable Cell Line |
|
TU119312 |
ABM |
1.0 ml |
Ask for price |
 Smc1b 3'UTR GFP Stable Cell Line |
|
TU169312 |
ABM |
1.0 ml |
Ask for price |
Smc1b 3'UTR Luciferase Stable Cell Line |
|
TU220826 |
ABM |
1.0 ml |
Ask for price |
Smc1b 3'UTR GFP Stable Cell Line |
|
TU270826 |
ABM |
1.0 ml |
Ask for price |
 SMC1B 3'UTR GFP Stable Cell Line |
|
TU073719 |
ABM |
1.0 ml |
EUR 1394 |
 SMC1B 3'UTR Luciferase Stable Cell Line |
|
TU023719 |
ABM |
1.0 ml |
EUR 1394 |
 Mouse Structural maintenance of chromosomes protein 1B, Smc1b EL |
|
ELI-42284m |
Lifescience Market |
96 Tests |
EUR 865 |
 Human Structural maintenance of chromosomes protein 1B, SMC1B EL |
|
ELI-41471h |
Lifescience Market |
96 Tests |
EUR 824 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
SMC1B Rabbit Polyclonal Antibody
