
셀타젠 Genetic Genotyping

SMC1B Rabbit Polyclonal Antibody

SMC1B Rabbit Polyclonal Antibody

SMC1B Polyclonal Antibody

ABP60442-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SMC1B protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of SMC1B from Human. This SMC1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SMC1B protein at amino acid sequence of 110-190

SMC1B Polyclonal Antibody

27845-100ul 100ul
EUR 252

SMC1B Polyclonal Antibody

27845-50ul 50ul
EUR 187

SMC1B Rabbit pAb

A12905-100ul 100 ul
EUR 308

SMC1B Rabbit pAb

A12905-200ul 200 ul
EUR 459

SMC1B Rabbit pAb

A12905-20ul 20 ul
EUR 183

SMC1B Rabbit pAb

A12905-50ul 50 ul
EUR 223

SMC1B Polyclonal Conjugated Antibody

C27845 100ul
EUR 397

SMC1B antibody

22261-100ul 100ul
EUR 390

SMC1B antibody

70R-13457 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal SMC1B antibody

SMC1B Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

Anti-SMC1B antibody

STJ114771 100 µl
EUR 277

Anti-SMC1B antibody

STJ192510 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SMC1B


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA26039 50 ul
EUR 334
Description: Mouse polyclonal to SMC1B

SMC1B Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SMC1B Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SMC1B Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SMC1B cloning plasmid

CSB-CL854104HU-10ug 10ug
EUR 1235
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3486
  • Sequence: atggcccacctggagctgctgcttgtggaaaatttcaagtcgtggcggggccgccaggtcattggccccttccggaggttcacctgcatcatcggccccaacggctctggaaaatctaatgtaatggatgcacttagttttgtaatgggagagaaaatagctaatttaagagtga
  • Show more
Description: A cloning plasmid for the SMC1B gene.

Anti-SMC1B (6A10)

YF-MA18167 100 ug
EUR 363
Description: Mouse monoclonal to SMC1B

Mouse SMC1B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SMC1B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Smc1b ORF Vector (Mouse) (pORF)

ORF057963 1.0 ug DNA
EUR 506

Smc1b ORF Vector (Rat) (pORF)

ORF076690 1.0 ug DNA
EUR 506

SMC1B ORF Vector (Human) (pORF)

ORF014533 1.0 ug DNA
EUR 354

SMC1B sgRNA CRISPR Lentivector set (Human)

K2199901 3 x 1.0 ug
EUR 339

Smc1b sgRNA CRISPR Lentivector set (Rat)

K6148001 3 x 1.0 ug
EUR 339

Smc1b sgRNA CRISPR Lentivector set (Mouse)

K3886601 3 x 1.0 ug
EUR 339

SMC1B sgRNA CRISPR Lentivector (Human) (Target 1)

K2199902 1.0 ug DNA
EUR 154

SMC1B sgRNA CRISPR Lentivector (Human) (Target 2)

K2199903 1.0 ug DNA
EUR 154

SMC1B sgRNA CRISPR Lentivector (Human) (Target 3)

K2199904 1.0 ug DNA
EUR 154

Smc1b sgRNA CRISPR Lentivector (Rat) (Target 1)

K6148002 1.0 ug DNA
EUR 154

Smc1b sgRNA CRISPR Lentivector (Rat) (Target 2)

K6148003 1.0 ug DNA
EUR 154

Smc1b sgRNA CRISPR Lentivector (Rat) (Target 3)

K6148004 1.0 ug DNA
EUR 154

Smc1b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3886602 1.0 ug DNA
EUR 154

Smc1b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3886603 1.0 ug DNA
EUR 154

Smc1b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3886604 1.0 ug DNA
EUR 154

SMC1B Protein Vector (Human) (pPB-C-His)

PV058129 500 ng
EUR 481

SMC1B Protein Vector (Human) (pPB-N-His)

PV058130 500 ng
EUR 481

SMC1B Protein Vector (Human) (pPM-C-HA)

PV058131 500 ng
EUR 481

SMC1B Protein Vector (Human) (pPM-C-His)

PV058132 500 ng
EUR 481

SMC1B Protein Vector (Rat) (pPB-C-His)

PV306758 500 ng
EUR 1191

SMC1B Protein Vector (Rat) (pPB-N-His)

PV306759 500 ng
EUR 1191

SMC1B Protein Vector (Rat) (pPM-C-HA)

PV306760 500 ng
EUR 1191

SMC1B Protein Vector (Rat) (pPM-C-His)

PV306761 500 ng
EUR 1191

SMC1B Protein Vector (Mouse) (pPB-C-His)

PV231850 500 ng
EUR 1065

SMC1B Protein Vector (Mouse) (pPB-N-His)

PV231851 500 ng
EUR 1065

SMC1B Protein Vector (Mouse) (pPM-C-HA)

PV231852 500 ng
EUR 1065

SMC1B Protein Vector (Mouse) (pPM-C-His)

PV231853 500 ng
EUR 1065

Smc1b 3'UTR GFP Stable Cell Line

TU169312 1.0 ml Ask for price

SMC1B 3'UTR Luciferase Stable Cell Line

TU023719 1.0 ml
EUR 1394

Smc1b 3'UTR Luciferase Stable Cell Line

TU119312 1.0 ml Ask for price

SMC1B 3'UTR GFP Stable Cell Line

TU073719 1.0 ml
EUR 1394

Smc1b 3'UTR Luciferase Stable Cell Line

TU220826 1.0 ml Ask for price

Smc1b 3'UTR GFP Stable Cell Line

TU270826 1.0 ml Ask for price

Human Structural maintenance of chromosomes protein 1B, SMC1B EL

ELI-41471h 96 Tests
EUR 824

Mouse Structural maintenance of chromosomes protein 1B, Smc1b EL

ELI-42284m 96 Tests
EUR 865

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

SMC1B Rabbit Polyclonal Antibody