SNAI3 Rabbit Polyclonal Antibody
SNAI3 Polyclonal Antibody |
ABP60449-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SNAI3 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of SNAI3 from Human, Mouse. This SNAI3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SNAI3 protein at amino acid sequence of 30-110 |
SNAI3 Rabbit pAb |
A17854-100ul |
Abclonal |
100 ul |
EUR 308 |
SNAI3 Rabbit pAb |
A17854-200ul |
Abclonal |
200 ul |
EUR 459 |
SNAI3 Rabbit pAb |
A17854-20ul |
Abclonal |
20 ul |
EUR 183 |
SNAI3 Rabbit pAb |
A17854-50ul |
Abclonal |
50 ul |
EUR 223 |
SNAI3 Antibody |
40110-100ul |
SAB |
100ul |
EUR 252 |
SNAI3 Antibody |
1-CSB-PA613772 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SNAI3. Recognizes SNAI3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
SNAI3 Antibody |
1-CSB-PA558561 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SNAI3. Recognizes SNAI3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50 |
SNAI3 Conjugated Antibody |
C40110 |
SAB |
100ul |
EUR 397 |
anti- SNAI3 antibody |
FNab08053 |
FN Test |
100µg |
EUR 585 |
- Immunogen: snail homolog 3(Drosophila)
- Uniprot ID: Q3KNW1
- Gene ID: 333929
- Research Area: Metabolism
|
Description: Antibody raised against SNAI3 |
Anti-SNAI3 Antibody |
PB9440 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-SNAI3 antibody |
STJ119867 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: SNAI3 is a member of the SNAIL gene family, named for the Drosophila snail gene, which plays roles in mesodermal formation during embryogenesis (Katoh and Katoh, 2003 [PubMed 12579345]).[supplied by OMIM, Apr 2009] |
Anti-SNAI3 antibody |
STJ192488 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SNAI3 |
SNAI3 siRNA |
20-abx934485 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SNAI3 siRNA |
20-abx934486 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mouse Zinc finger protein SNAI3, Snai3 ELISA KIT |
ELI-18154m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Zinc finger protein SNAI3, SNAI3 ELISA KIT |
ELI-53277h |
Lifescience Market |
96 Tests |
EUR 824 |
SNAI3 cloning plasmid |
CSB-CL660752HU-10ug |
Cusabio |
10ug |
EUR 356 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 879
- Sequence: ATGCCGCGCTCCTTCCTGGTGAAAACGCACTCCAGCCACAGGGTCCCCAACTACCGGCGGCTGGAGACGCAGAGAGAAATCAATGGTGCCTGCTCTGCCTGTGGGGGGCTGGTGGTGCCCCTCCTCCCCCGAGACAAGGAGGCCCCTTCTGTGCCCGGTGACCTTCCCCAGCCCTG
- Show more
|
Description: A cloning plasmid for the SNAI3 gene. |
Mouse SNAI3 shRNA Plasmid |
20-abx974042 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SNAI3 shRNA Plasmid |
20-abx967203 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SNAI3 Recombinant Protein (Human) |
RP043612 |
ABM |
100 ug |
Ask for price |
SNAI3 Recombinant Protein (Rat) |
RP230204 |
ABM |
100 ug |
Ask for price |
SNAI3 Recombinant Protein (Mouse) |
RP174122 |
ABM |
100 ug |
Ask for price |
Snail Family Transcriptional Repressor 3 (SNAI3) Antibody |
20-abx339113 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Snail Family Transcriptional Repressor 3 (SNAI3) Antibody |
abx238053-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Snail Family Transcriptional Repressor 3 (SNAI3) Antibody |
20-abx210577 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Snai3 ORF Vector (Mouse) (pORF) |
ORF058042 |
ABM |
1.0 ug DNA |
EUR 506 |
Snai3 ORF Vector (Rat) (pORF) |
ORF076736 |
ABM |
1.0 ug DNA |
EUR 506 |
SNAI3 ORF Vector (Human) (pORF) |
ORF014538 |
ABM |
1.0 ug DNA |
EUR 354 |
SNAI3 sgRNA CRISPR Lentivector set (Human) |
K0003701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Snai3 sgRNA CRISPR Lentivector set (Rat) |
K6118401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Snai3 sgRNA CRISPR Lentivector set (Mouse) |
K3940301 |
ABM |
3 x 1.0 ug |
EUR 339 |
SNAI3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0003702 |
ABM |
1.0 ug DNA |
EUR 154 |
SNAI3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0003703 |
ABM |
1.0 ug DNA |
EUR 154 |
SNAI3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0003704 |
ABM |
1.0 ug DNA |
EUR 154 |
Snai3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6118402 |
ABM |
1.0 ug DNA |
EUR 154 |
Snai3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6118403 |
ABM |
1.0 ug DNA |
EUR 154 |
Snai3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6118404 |
ABM |
1.0 ug DNA |
EUR 154 |
Snai3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3940302 |
ABM |
1.0 ug DNA |
EUR 154 |
Snai3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3940303 |
ABM |
1.0 ug DNA |
EUR 154 |
Snai3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3940304 |
ABM |
1.0 ug DNA |
EUR 154 |
SNAI3 Protein Vector (Human) (pPB-C-His) |
PV058149 |
ABM |
500 ng |
EUR 481 |
SNAI3 Protein Vector (Human) (pPB-N-His) |
PV058150 |
ABM |
500 ng |
EUR 481 |
SNAI3 Protein Vector (Human) (pPM-C-HA) |
PV058151 |
ABM |
500 ng |
EUR 481 |
SNAI3 Protein Vector (Human) (pPM-C-His) |
PV058152 |
ABM |
500 ng |
EUR 481 |
SNAI3 Protein Vector (Rat) (pPB-C-His) |
PV306942 |
ABM |
500 ng |
EUR 603 |
SNAI3 Protein Vector (Rat) (pPB-N-His) |
PV306943 |
ABM |
500 ng |
EUR 603 |
SNAI3 Protein Vector (Rat) (pPM-C-HA) |
PV306944 |
ABM |
500 ng |
EUR 603 |
SNAI3 Protein Vector (Rat) (pPM-C-His) |
PV306945 |
ABM |
500 ng |
EUR 603 |
SNAI3 Protein Vector (Mouse) (pPB-C-His) |
PV232166 |
ABM |
500 ng |
EUR 603 |
SNAI3 Protein Vector (Mouse) (pPB-N-His) |
PV232167 |
ABM |
500 ng |
EUR 603 |
SNAI3 Protein Vector (Mouse) (pPM-C-HA) |
PV232168 |
ABM |
500 ng |
EUR 603 |
SNAI3 Protein Vector (Mouse) (pPM-C-His) |
PV232169 |
ABM |
500 ng |
EUR 603 |
Snai3 3'UTR GFP Stable Cell Line |
TU169366 |
ABM |
1.0 ml |
Ask for price |
SNAI3 3'UTR Luciferase Stable Cell Line |
TU023774 |
ABM |
1.0 ml |
EUR 1394 |
Snai3 3'UTR Luciferase Stable Cell Line |
TU119366 |
ABM |
1.0 ml |
Ask for price |
SNAI3 3'UTR GFP Stable Cell Line |
TU073774 |
ABM |
1.0 ml |
EUR 1394 |
Snai3 3'UTR Luciferase Stable Cell Line |
TU220874 |
ABM |
1.0 ml |
Ask for price |
Snai3 3'UTR GFP Stable Cell Line |
TU270874 |
ABM |
1.0 ml |
Ask for price |
Human Snail Family Transcriptional Repressor 3 (SNAI3) ELISA Kit |
abx383331-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
SNAI3 Rabbit Polyclonal Antibody