SNAI3 Rabbit Polyclonal Antibody

SNAI3 Polyclonal Antibody
ABP60449-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human SNAI3 protein at amino acid sequence of 30-110 Applications tips:
Description: A polyclonal antibody for detection of SNAI3 from Human, Mouse. This SNAI3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SNAI3 protein at amino acid sequence of 30-110

SNAI3 Rabbit pAb
A17854-100ul	Abclonal	100 ul	EUR 308

SNAI3 Rabbit pAb
A17854-200ul	Abclonal	200 ul	EUR 459

SNAI3 Rabbit pAb
A17854-20ul	Abclonal	20 ul	EUR 183

SNAI3 Rabbit pAb
A17854-50ul	Abclonal	50 ul	EUR 223

SNAI3 Antibody
40110-100ul	SAB	100ul	EUR 252

SNAI3 Antibody
1-CSB-PA613772	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SNAI3. Recognizes SNAI3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

SNAI3 Antibody
1-CSB-PA558561	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SNAI3. Recognizes SNAI3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

SNAI3 Conjugated Antibody
C40110	SAB	100ul	EUR 397

anti- SNAI3 antibody
FNab08053	FN Test	100µg	EUR 585
Immunogen: snail homolog 3(Drosophila) Uniprot ID: Q3KNW1 Gene ID: 333929 Research Area: Metabolism
Description: Antibody raised against SNAI3

Anti-SNAI3 Antibody
PB9440	BosterBio	100ug/vial	EUR 294

Anti-SNAI3 antibody
PAab08053	Lifescience Market	100 ug	EUR 412

Anti-SNAI3 antibody
STJ119867	St John's Laboratory	100 µl	EUR 277
Description: SNAI3 is a member of the SNAIL gene family, named for the Drosophila snail gene, which plays roles in mesodermal formation during embryogenesis (Katoh and Katoh, 2003 [PubMed 12579345]).[supplied by OMIM, Apr 2009]

Anti-SNAI3 antibody
STJ192488	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to SNAI3

SNAI3 siRNA
20-abx934485	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SNAI3 siRNA
20-abx934486	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Mouse Zinc finger protein SNAI3, Snai3 ELISA KIT
ELI-18154m	Lifescience Market	96 Tests	EUR 865

Human Zinc finger protein SNAI3, SNAI3 ELISA KIT
ELI-53277h	Lifescience Market	96 Tests	EUR 824

SNAI3 cloning plasmid
CSB-CL660752HU-10ug	Cusabio	10ug	EUR 356
Formulation: 10 μg plasmid + 200μl Glycerol Length: 879 Sequence: ATGCCGCGCTCCTTCCTGGTGAAAACGCACTCCAGCCACAGGGTCCCCAACTACCGGCGGCTGGAGACGCAGAGAGAAATCAATGGTGCCTGCTCTGCCTGTGGGGGGCTGGTGGTGCCCCTCCTCCCCCGAGACAAGGAGGCCCCTTCTGTGCCCGGTGACCTTCCCCAGCCCTG Show more
Description: A cloning plasmid for the SNAI3 gene.

Mouse SNAI3 shRNA Plasmid
20-abx974042	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SNAI3 ELISA KIT|Human
EF003085	Lifescience Market	96 Tests	EUR 689

Human SNAI3 shRNA Plasmid
20-abx967203	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SNAI3 Recombinant Protein (Human)
RP043612	ABM	100 ug	Ask for price

SNAI3 Recombinant Protein (Rat)
RP230204	ABM	100 ug	Ask for price

SNAI3 Recombinant Protein (Mouse)
RP174122	ABM	100 ug	Ask for price

pCR-BluntII-TOPO-SNAI3
PVT17972	Lifescience Market	2 ug	EUR 231

Snail Family Transcriptional Repressor 3 (SNAI3) Antibody
20-abx339113	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 3 (SNAI3) Antibody
abx238053-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Snail Family Transcriptional Repressor 3 (SNAI3) Antibody
20-abx210577	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Snai3 ORF Vector (Mouse) (pORF)
ORF058042	ABM	1.0 ug DNA	EUR 506

Snai3 ORF Vector (Rat) (pORF)
ORF076736	ABM	1.0 ug DNA	EUR 506

SNAI3 ORF Vector (Human) (pORF)
ORF014538	ABM	1.0 ug DNA	EUR 354

SNAI3 sgRNA CRISPR Lentivector set (Human)
K0003701	ABM	3 x 1.0 ug	EUR 339

Snai3 sgRNA CRISPR Lentivector set (Rat)
K6118401	ABM	3 x 1.0 ug	EUR 339

Snai3 sgRNA CRISPR Lentivector set (Mouse)
K3940301	ABM	3 x 1.0 ug	EUR 339

SNAI3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0003702	ABM	1.0 ug DNA	EUR 154

SNAI3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0003703	ABM	1.0 ug DNA	EUR 154

SNAI3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0003704	ABM	1.0 ug DNA	EUR 154

Snai3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6118402	ABM	1.0 ug DNA	EUR 154

Snai3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6118403	ABM	1.0 ug DNA	EUR 154

Snai3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6118404	ABM	1.0 ug DNA	EUR 154

Snai3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3940302	ABM	1.0 ug DNA	EUR 154

Snai3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3940303	ABM	1.0 ug DNA	EUR 154

Snai3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3940304	ABM	1.0 ug DNA	EUR 154

SNAI3 Protein Vector (Human) (pPB-C-His)
PV058149	ABM	500 ng	EUR 481

SNAI3 Protein Vector (Human) (pPB-N-His)
PV058150	ABM	500 ng	EUR 481

SNAI3 Protein Vector (Human) (pPM-C-HA)
PV058151	ABM	500 ng	EUR 481

SNAI3 Protein Vector (Human) (pPM-C-His)
PV058152	ABM	500 ng	EUR 481

SNAI3 Protein Vector (Rat) (pPB-C-His)
PV306942	ABM	500 ng	EUR 603

SNAI3 Protein Vector (Rat) (pPB-N-His)
PV306943	ABM	500 ng	EUR 603

SNAI3 Protein Vector (Rat) (pPM-C-HA)
PV306944	ABM	500 ng	EUR 603

SNAI3 Protein Vector (Rat) (pPM-C-His)
PV306945	ABM	500 ng	EUR 603

SNAI3 Protein Vector (Mouse) (pPB-C-His)
PV232166	ABM	500 ng	EUR 603

SNAI3 Protein Vector (Mouse) (pPB-N-His)
PV232167	ABM	500 ng	EUR 603

SNAI3 Protein Vector (Mouse) (pPM-C-HA)
PV232168	ABM	500 ng	EUR 603

SNAI3 Protein Vector (Mouse) (pPM-C-His)
PV232169	ABM	500 ng	EUR 603

Snai3 3'UTR GFP Stable Cell Line
TU169366	ABM	1.0 ml	Ask for price

SNAI3 3'UTR Luciferase Stable Cell Line
TU023774	ABM	1.0 ml	EUR 1394

Snai3 3'UTR Luciferase Stable Cell Line
TU119366	ABM	1.0 ml	Ask for price

SNAI3 3'UTR GFP Stable Cell Line
TU073774	ABM	1.0 ml	EUR 1394

Snai3 3'UTR Luciferase Stable Cell Line
TU220874	ABM	1.0 ml	Ask for price

Snai3 3'UTR GFP Stable Cell Line
TU270874	ABM	1.0 ml	Ask for price

Human Snail Family Transcriptional Repressor 3 (SNAI3) ELISA Kit
abx383331-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

SNAI3 Rabbit Polyclonal Antibody