셀타젠 Genetic Genotyping

SOX15 Rabbit Polyclonal Antibody

SOX15 Polyclonal Antibody

ABP60471-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SOX15 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of SOX15 from Human, Mouse. This SOX15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SOX15 protein at amino acid sequence of 30-110

SOX15 Polyclonal Antibody

ABP60471-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SOX15 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of SOX15 from Human, Mouse. This SOX15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SOX15 protein at amino acid sequence of 30-110

SOX15 Polyclonal Antibody

ABP60471-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SOX15 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of SOX15 from Human, Mouse. This SOX15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SOX15 protein at amino acid sequence of 30-110

SOX15 Rabbit pAb

A18385-100ul 100 ul
EUR 308

SOX15 Rabbit pAb

A18385-200ul 200 ul
EUR 459

SOX15 Rabbit pAb

A18385-20ul 20 ul
EUR 183

SOX15 Rabbit pAb

A18385-50ul 50 ul
EUR 223

anti- SOX15 antibody

FNab08123 100µg
EUR 548.75
  • Immunogen: SRY(sex determining region Y)-box 15
  • Uniprot ID: O60248
  • Gene ID: 6665
  • Research Area: Epigenetics, Stem Cells, Metabolism
Description: Antibody raised against SOX15

Anti-SOX15 Antibody

A07722-1 100ug/vial
EUR 334

Anti-SOX15 antibody

PAab08123 100 ug
EUR 386

Anti-SOX15 antibody

STJ71392 100 µg
EUR 359

Anti-SOX15 antibody

STJ11100338 100 µl
EUR 277

Anti-SOX15 antibody

STJ192369 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SOX15


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA24753 50 ul
EUR 334
Description: Mouse polyclonal to SOX15

SOX15 cloning plasmid

CSB-CL022423HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 702
  • Sequence: atggcgctaccaggctcctcacaggaccaggcctggagcctggagcctccggctgccacggctgctgcctcctcatcttcgggaccccaggagcgggagggcgctgggagccccgcggcccccgggacgctgcccctggagaaggtgaagcggccgatgaacgcgttcatggtgtg
  • Show more
Description: A cloning plasmid for the SOX15 gene.


PVT12428 2 ug
EUR 391

Anti-SOX15 (1B3)

YF-MA15533 100 ug
EUR 363
Description: Mouse monoclonal to SOX15

Anti-SOX15 (2C1)

YF-MA10868 100 ug
EUR 363
Description: Mouse monoclonal to SOX15


EF003141 96 Tests
EUR 689

Human SOX15 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SOX15 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SOX15 Recombinant Protein (Human)

RP029716 100 ug Ask for price

SOX15 Recombinant Protein (Rat)

RP230525 100 ug Ask for price

SOX15 Recombinant Protein (Mouse)

RP174575 100 ug Ask for price


PVT13014 2 ug
EUR 325

Sox15 ORF Vector (Mouse) (pORF)

ORF058193 1.0 ug DNA
EUR 506

SOX15 ORF Vector (Human) (pORF)

ORF009906 1.0 ug DNA
EUR 95

Sox15 ORF Vector (Rat) (pORF)

ORF076843 1.0 ug DNA
EUR 506

SOX15 sgRNA CRISPR Lentivector set (Human)

K2261401 3 x 1.0 ug
EUR 339

Sox15 sgRNA CRISPR Lentivector set (Mouse)

K4695501 3 x 1.0 ug
EUR 339

Sox15 sgRNA CRISPR Lentivector set (Rat)

K6163301 3 x 1.0 ug
EUR 339

Sex Determining Region Y Box Protein 15 (SOX15) Antibody

abx026837-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Sex Determining Region Y Box Protein 15 (SOX15) Antibody

abx026837-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Sex Determining Region Y Box Protein 15 (SOX15) Antibody

abx433305-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Sex Determining Region Y Box Protein 15 (SOX15) Antibody

abx238123-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human Protein SOX- 15, SOX15 ELISA KIT

ELI-18231h 96 Tests
EUR 824

Mouse Protein SOX- 15, Sox15 ELISA KIT

ELI-46188m 96 Tests
EUR 865

SOX15 sgRNA CRISPR Lentivector (Human) (Target 1)

K2261402 1.0 ug DNA
EUR 154

SOX15 sgRNA CRISPR Lentivector (Human) (Target 2)

K2261403 1.0 ug DNA
EUR 154

SOX15 sgRNA CRISPR Lentivector (Human) (Target 3)

K2261404 1.0 ug DNA
EUR 154

Sox15 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4695502 1.0 ug DNA
EUR 154

Sox15 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4695503 1.0 ug DNA
EUR 154

Sox15 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4695504 1.0 ug DNA
EUR 154

Sox15 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6163302 1.0 ug DNA
EUR 154

Sox15 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6163303 1.0 ug DNA
EUR 154

Sox15 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6163304 1.0 ug DNA
EUR 154

SOX15 Protein Vector (Human) (pPB-C-His)

PV039621 500 ng
EUR 329

SOX15 Protein Vector (Human) (pPB-N-His)

PV039622 500 ng
EUR 329

SOX15 Protein Vector (Human) (pPM-C-HA)

PV039623 500 ng
EUR 329

SOX15 Protein Vector (Human) (pPM-C-His)

PV039624 500 ng
EUR 329

SOX15 Protein Vector (Rat) (pPB-C-His)

PV307370 500 ng
EUR 603

SOX15 Protein Vector (Rat) (pPB-N-His)

PV307371 500 ng
EUR 603

SOX15 Protein Vector (Rat) (pPM-C-HA)

PV307372 500 ng
EUR 603

SOX15 Protein Vector (Rat) (pPM-C-His)

PV307373 500 ng
EUR 603

SOX15 Protein Vector (Mouse) (pPB-C-His)

PV232770 500 ng
EUR 603

SOX15 Protein Vector (Mouse) (pPB-N-His)

PV232771 500 ng
EUR 603

SOX15 Protein Vector (Mouse) (pPM-C-HA)

PV232772 500 ng
EUR 603

SOX15 Protein Vector (Mouse) (pPM-C-His)

PV232773 500 ng
EUR 603

Sox15 3'UTR GFP Stable Cell Line

TU169483 1.0 ml Ask for price

Sox15 3'UTR Luciferase Stable Cell Line

TU119483 1.0 ml Ask for price

SOX15 3'UTR GFP Stable Cell Line

TU074347 1.0 ml
EUR 1394

SOX15 3'UTR Luciferase Stable Cell Line

TU024347 1.0 ml
EUR 1394

Sox15 3'UTR Luciferase Stable Cell Line

TU220987 1.0 ml Ask for price

Sox15 3'UTR GFP Stable Cell Line

TU270987 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

SOX15 Rabbit Polyclonal Antibody