SOX15 Rabbit Polyclonal Antibody

SOX15 Rabbit Polyclonal Antibody

SOX15 Polyclonal Antibody
ABP60471-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human SOX15 protein at amino acid sequence of 30-110 Applications tips:
Description: A polyclonal antibody for detection of SOX15 from Human, Mouse. This SOX15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SOX15 protein at amino acid sequence of 30-110

SOX15 Polyclonal Antibody
ES11211-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against SOX15 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SOX15 Polyclonal Antibody
ES11211-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against SOX15 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SOX15 Rabbit pAb
A18385-100ul	Abclonal	100 ul	EUR 308

SOX15 Rabbit pAb
A18385-200ul	Abclonal	200 ul	EUR 459

SOX15 Rabbit pAb
A18385-20ul	Abclonal	20 ul	EUR 183

SOX15 Rabbit pAb
A18385-50ul	Abclonal	50 ul	EUR 223

Anti-SOX15 Antibody
A07722-1	BosterBio	100ug/vial	EUR 334

anti- SOX15 antibody
FNab08123	FN Test	100µg	EUR 548.75
Immunogen: SRY(sex determining region Y)-box 15 Uniprot ID: O60248 Gene ID: 6665 Research Area: Epigenetics, Stem Cells, Metabolism
Description: Antibody raised against SOX15

Anti-SOX15 antibody
PAab08123	Lifescience Market	100 ug	EUR 386

Anti-SOX15 antibody
STJ11100338	St John's Laboratory	100 µl	EUR 277

Anti-SOX15 antibody
STJ71392	St John's Laboratory	100 µg	EUR 359

Anti-SOX15 antibody
STJ192369	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to SOX15

SOX15 siRNA
20-abx934718	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SOX15 siRNA
20-abx934719	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-SOX15
YF-PA24753	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to SOX15

SOX15 cloning plasmid
CSB-CL022423HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 702 Sequence: atggcgctaccaggctcctcacaggaccaggcctggagcctggagcctccggctgccacggctgctgcctcctcatcttcgggaccccaggagcgggagggcgctgggagccccgcggcccccgggacgctgcccctggagaaggtgaagcggccgatgaacgcgttcatggtgtg Show more
Description: A cloning plasmid for the SOX15 gene.

pCMV-SPORT6-SOX15
PVT12428	Lifescience Market	2 ug	EUR 391

Anti-SOX15 (2C1)
YF-MA10868	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SOX15

Anti-SOX15 (1B3)
YF-MA15533	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SOX15

SOX15 ELISA KIT|Human
EF003141	Lifescience Market	96 Tests	EUR 689

Mouse SOX15 shRNA Plasmid
20-abx972829	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human SOX15 shRNA Plasmid
20-abx954544	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SOX15 Recombinant Protein (Rat)
RP230525	ABM	100 ug	Ask for price

pECMV-3-FLAG-SOX15
PVT13014	Lifescience Market	2 ug	EUR 325

SOX15 Recombinant Protein (Human)
RP029716	ABM	100 ug	Ask for price

SOX15 Recombinant Protein (Mouse)
RP174575	ABM	100 ug	Ask for price

Sox15 ORF Vector (Rat) (pORF)
ORF076843	ABM	1.0 ug DNA	EUR 506

SOX15 ORF Vector (Human) (pORF)
ORF009906	ABM	1.0 ug DNA	EUR 95

Sox15 ORF Vector (Mouse) (pORF)
ORF058193	ABM	1.0 ug DNA	EUR 506

Sox15 sgRNA CRISPR Lentivector set (Rat)
K6163301	ABM	3 x 1.0 ug	EUR 339

SOX15 sgRNA CRISPR Lentivector set (Human)
K2261401	ABM	3 x 1.0 ug	EUR 339

Sox15 sgRNA CRISPR Lentivector set (Mouse)
K4695501	ABM	3 x 1.0 ug	EUR 339

Sex Determining Region Y Box Protein 15 (SOX15) Antibody
abx026837-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Sex Determining Region Y Box Protein 15 (SOX15) Antibody
abx026837-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Sex Determining Region Y Box Protein 15 (SOX15) Antibody
abx238123-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Sex Determining Region Y Box Protein 15 (SOX15) Antibody
abx433305-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Human Protein SOX- 15, SOX15 ELISA KIT
ELI-18231h	Lifescience Market	96 Tests	EUR 824

Mouse Protein SOX- 15, Sox15 ELISA KIT
ELI-46188m	Lifescience Market	96 Tests	EUR 865

Sox15 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6163302	ABM	1.0 ug DNA	EUR 154

Sox15 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6163303	ABM	1.0 ug DNA	EUR 154

Sox15 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6163304	ABM	1.0 ug DNA	EUR 154

SOX15 sgRNA CRISPR Lentivector (Human) (Target 1)
K2261402	ABM	1.0 ug DNA	EUR 154

SOX15 sgRNA CRISPR Lentivector (Human) (Target 2)
K2261403	ABM	1.0 ug DNA	EUR 154

SOX15 sgRNA CRISPR Lentivector (Human) (Target 3)
K2261404	ABM	1.0 ug DNA	EUR 154

Sox15 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4695502	ABM	1.0 ug DNA	EUR 154

Sox15 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4695503	ABM	1.0 ug DNA	EUR 154

Sox15 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4695504	ABM	1.0 ug DNA	EUR 154

SOX15 Protein Vector (Rat) (pPB-C-His)
PV307370	ABM	500 ng	EUR 603

SOX15 Protein Vector (Rat) (pPB-N-His)
PV307371	ABM	500 ng	EUR 603

SOX15 Protein Vector (Rat) (pPM-C-HA)
PV307372	ABM	500 ng	EUR 603

SOX15 Protein Vector (Rat) (pPM-C-His)
PV307373	ABM	500 ng	EUR 603

SOX15 Protein Vector (Human) (pPB-C-His)
PV039621	ABM	500 ng	EUR 329

SOX15 Protein Vector (Human) (pPB-N-His)
PV039622	ABM	500 ng	EUR 329

SOX15 Protein Vector (Human) (pPM-C-HA)
PV039623	ABM	500 ng	EUR 329

SOX15 Protein Vector (Human) (pPM-C-His)
PV039624	ABM	500 ng	EUR 329

SOX15 Protein Vector (Mouse) (pPB-C-His)
PV232770	ABM	500 ng	EUR 603

SOX15 Protein Vector (Mouse) (pPB-N-His)
PV232771	ABM	500 ng	EUR 603

SOX15 Protein Vector (Mouse) (pPM-C-HA)
PV232772	ABM	500 ng	EUR 603

SOX15 Protein Vector (Mouse) (pPM-C-His)
PV232773	ABM	500 ng	EUR 603

Sox15 3'UTR Luciferase Stable Cell Line
TU119483	ABM	1.0 ml	Ask for price

Sox15 3'UTR GFP Stable Cell Line
TU169483	ABM	1.0 ml	Ask for price

Sox15 3'UTR Luciferase Stable Cell Line
TU220987	ABM	1.0 ml	Ask for price

Sox15 3'UTR GFP Stable Cell Line
TU270987	ABM	1.0 ml	Ask for price

SOX15 3'UTR GFP Stable Cell Line
TU074347	ABM	1.0 ml	EUR 1394

SOX15 3'UTR Luciferase Stable Cell Line
TU024347	ABM	1.0 ml	EUR 1394

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

SOX15 Rabbit Polyclonal Antibody