SPAG8 Rabbit Polyclonal Antibody
SPAG8 Polyclonal Antibody |
ABP60486-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SPAG8 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SPAG8 from Human . This SPAG8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPAG8 protein |
SPAG8 Polyclonal Antibody |
A69155 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
SPAG8 Rabbit pAb |
A8943-100ul |
Abclonal |
100 ul |
EUR 308 |
SPAG8 Rabbit pAb |
A8943-200ul |
Abclonal |
200 ul |
EUR 459 |
SPAG8 Rabbit pAb |
A8943-20ul |
Abclonal |
20 ul |
EUR 183 |
SPAG8 Rabbit pAb |
A8943-50ul |
Abclonal |
50 ul |
EUR 223 |
SPAG8 antibody |
70R-2385 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal SPAG8 antibody raised against the N terminal of SPAG8 |
SPAG8 antibody |
70R-2386 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal SPAG8 antibody raised against the middle region of SPAG8 |
SPAG8 Antibody |
35927-100ul |
SAB |
100ul |
EUR 252 |
SPAG8 antibody |
70R-20476 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SPAG8 antibody |
SPAG8 Antibody |
1-CSB-PA269500 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100 |
SPAG8 Antibody |
1-CSB-PA858730LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
SPAG8 Antibody |
1-CSB-PA209919 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100 |
SPAG8 Antibody |
1-CSB-PA022469GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
SPAG8 Polyclonal Antibody, HRP Conjugated |
A69156 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
SPAG8 Polyclonal Antibody, FITC Conjugated |
A69157 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
SPAG8 Polyclonal Antibody, Biotin Conjugated |
A69158 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
SPAG8 Conjugated Antibody |
C35927 |
SAB |
100ul |
EUR 397 |
anti- SPAG8 antibody |
FNab08146 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: sperm associated antigen 8
- Uniprot ID: Q99932
- Gene ID: 26206
- Research Area: Stem Cells
|
Description: Antibody raised against SPAG8 |
Anti-SPAG8 antibody |
STJ113600 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein encoded by this gene is recognized by sperm agglutinating antibodies from an infertile woman. This protein is localized in germ cells of the testis at all stages of spermatogenesis and is localized to the acrosomal region of mature spermatozoa. This protein interacts with ACT (activator of CREM in testis) and may play a role in CREM (cAMP response element modulator)-ACT-mediated gene transcription during spermatogenesis. This protein may also play a role in spermatogenesis by regulating microtubule formation and cell division. Alternatively spliced variants that encode different protein isoforms have been described but the full-length sequences of only two have been determined. |
Anti-SPAG8 antibody |
STJ192199 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SPAG8 |
SPAG8 siRNA |
20-abx934799 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-SPAG8 |
YF-PA18238 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to SPAG8 |
anti-SPAG8 |
YF-PA18239 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to SPAG8 |
SPAG8 Antibody, HRP conjugated |
1-CSB-PA858730LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SPAG8 Antibody, FITC conjugated |
1-CSB-PA858730LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SPAG8 Antibody, Biotin conjugated |
1-CSB-PA858730LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
SPAG8 Blocking Peptide |
33R-6974 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPAG8 antibody, catalog no. 70R-2386 |
SPAG8 Blocking Peptide |
33R-8479 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPAG8 antibody, catalog no. 70R-2385 |
SPAG8 cloning plasmid |
CSB-CL858730HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1506
- Sequence: atggagaccaacgggtctacggagggatcgcggtcgcggtcgcgatctttagacatacagcccagctccgaaggactggggcccacttcggaaccgtttccttcttcagatgacagtcccaggtcggccctggcagctgcaaccgcagcagctgcagcggctgcatcagctgctg
- Show more
|
Description: A cloning plasmid for the SPAG8 gene. |
Anti-SPAG8 (2F12) |
YF-MA18062 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to SPAG8 |
Human SPAG8 shRNA Plasmid |
20-abx958755 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SPAG8 Recombinant Protein (Human) |
RP029767 |
ABM |
100 ug |
Ask for price |
SPAG8 Recombinant Protein (Rat) |
RP230627 |
ABM |
100 ug |
Ask for price |
SPAG8 Recombinant Protein (Mouse) |
RP174728 |
ABM |
100 ug |
Ask for price |
Sperm-Associated Antigen 8 (SPAG8) Antibody |
20-abx124599 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Sperm Associated Antigen 8 (SPAG8) Antibody |
20-abx115763 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sperm-Associated Antigen 8 (SPAG8) Antibody |
abx122908-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Sperm-Associated Antigen 8 (SPAG8) Antibody |
20-abx339750 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sperm-Associated Antigen 8 (SPAG8) Antibody |
20-abx339751 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sperm-Associated Antigen 8 (SPAG8) Antibody |
20-abx333753 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Sperm-Associated Antigen 8 (SPAG8) Antibody |
abx238146-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Sperm-Associated Antigen 8 (SPAG8) Antibody (HRP) |
20-abx337781 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Sperm-Associated Antigen 8 (SPAG8) Antibody (FITC) |
20-abx337782 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Sperm-Associated Antigen 8 (SPAG8) Antibody (Biotin) |
20-abx337783 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Spag8 ORF Vector (Mouse) (pORF) |
ORF058244 |
ABM |
1.0 ug DNA |
EUR 506 |
SPAG8 ORF Vector (Human) (pORF) |
ORF009923 |
ABM |
1.0 ug DNA |
EUR 95 |
Spag8 ORF Vector (Rat) (pORF) |
ORF076877 |
ABM |
1.0 ug DNA |
EUR 506 |
SPAG8 sgRNA CRISPR Lentivector set (Human) |
K2264601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Spag8 sgRNA CRISPR Lentivector set (Rat) |
K6142601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Spag8 sgRNA CRISPR Lentivector set (Mouse) |
K3028801 |
ABM |
3 x 1.0 ug |
EUR 339 |
SPAG8 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2264602 |
ABM |
1.0 ug DNA |
EUR 154 |
SPAG8 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2264603 |
ABM |
1.0 ug DNA |
EUR 154 |
SPAG8 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2264604 |
ABM |
1.0 ug DNA |
EUR 154 |
Spag8 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6142602 |
ABM |
1.0 ug DNA |
EUR 154 |
Spag8 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6142603 |
ABM |
1.0 ug DNA |
EUR 154 |
Spag8 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6142604 |
ABM |
1.0 ug DNA |
EUR 154 |
Spag8 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3028802 |
ABM |
1.0 ug DNA |
EUR 154 |
Spag8 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3028803 |
ABM |
1.0 ug DNA |
EUR 154 |
Spag8 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3028804 |
ABM |
1.0 ug DNA |
EUR 154 |
SPAG8 Protein Vector (Human) (pPB-C-His) |
PV039689 |
ABM |
500 ng |
EUR 329 |
SPAG8 Protein Vector (Human) (pPB-N-His) |
PV039690 |
ABM |
500 ng |
EUR 329 |
SPAG8 Protein Vector (Human) (pPM-C-HA) |
PV039691 |
ABM |
500 ng |
EUR 329 |
SPAG8 Protein Vector (Human) (pPM-C-His) |
PV039692 |
ABM |
500 ng |
EUR 329 |
SPAG8 Protein Vector (Rat) (pPB-C-His) |
PV307506 |
ABM |
500 ng |
EUR 603 |
SPAG8 Protein Vector (Rat) (pPB-N-His) |
PV307507 |
ABM |
500 ng |
EUR 603 |
SPAG8 Protein Vector (Rat) (pPM-C-HA) |
PV307508 |
ABM |
500 ng |
EUR 603 |
SPAG8 Protein Vector (Rat) (pPM-C-His) |
PV307509 |
ABM |
500 ng |
EUR 603 |
SPAG8 Protein Vector (Mouse) (pPB-C-His) |
PV232974 |
ABM |
500 ng |
EUR 603 |
SPAG8 Protein Vector (Mouse) (pPB-N-His) |
PV232975 |
ABM |
500 ng |
EUR 603 |
SPAG8 Protein Vector (Mouse) (pPM-C-HA) |
PV232976 |
ABM |
500 ng |
EUR 603 |
SPAG8 Protein Vector (Mouse) (pPM-C-His) |
PV232977 |
ABM |
500 ng |
EUR 603 |
Spag8 3'UTR GFP Stable Cell Line |
TU169522 |
ABM |
1.0 ml |
Ask for price |
Spag8 3'UTR Luciferase Stable Cell Line |
TU119522 |
ABM |
1.0 ml |
Ask for price |
SPAG8 3'UTR GFP Stable Cell Line |
TU074378 |
ABM |
1.0 ml |
EUR 1521 |
SPAG8 3'UTR Luciferase Stable Cell Line |
TU024378 |
ABM |
1.0 ml |
EUR 1521 |
Spag8 3'UTR Luciferase Stable Cell Line |
TU221024 |
ABM |
1.0 ml |
Ask for price |
Spag8 3'UTR GFP Stable Cell Line |
TU271024 |
ABM |
1.0 ml |
Ask for price |
Human Sperm- associated antigen 8, SPAG8 ELISA KIT |
ELI-29622h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Sperm-Associated Antigen 8 (SPAG8) ELISA Kit |
abx383397-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
SPAG8 Rabbit Polyclonal Antibody