SPG7 Rabbit Polyclonal Antibody
 SPG7 Polyclonal Antibody |
|
ABP60493-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human SPG7 protein at amino acid sequence of 71-120
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SPG7 from Human. This SPG7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPG7 protein at amino acid sequence of 71-120 |
SPG7 Polyclonal Antibody |
|
ABP60493-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SPG7 protein at amino acid sequence of 71-120
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SPG7 from Human. This SPG7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPG7 protein at amino acid sequence of 71-120 |
SPG7 Polyclonal Antibody |
|
ABP60493-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SPG7 protein at amino acid sequence of 71-120
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SPG7 from Human. This SPG7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPG7 protein at amino acid sequence of 71-120 |
SPG7 Polyclonal Antibody |
|
ES11406-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against SPG7 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SPG7 Polyclonal Antibody |
|
ES11406-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against SPG7 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 SPG7 Rabbit pAb |
|
A10249-100ul |
Abclonal |
100 ul |
EUR 308 |
SPG7 Rabbit pAb |
|
A10249-200ul |
Abclonal |
200 ul |
EUR 459 |
SPG7 Rabbit pAb |
|
A10249-20ul |
Abclonal |
20 ul |
EUR 183 |
SPG7 Rabbit pAb |
|
A10249-50ul |
Abclonal |
50 ul |
EUR 223 |
 SPG7 Polyclonal Conjugated Antibody |
|
C27343 |
SAB |
100ul |
EUR 397 |
 SPG7 antibody |
|
22251-100ul |
SAB |
100ul |
EUR 390 |
SPG7 antibody |
|
70R-13623 |
Fitzgerald |
100 ul |
EUR 457 |
|
Description: Affinity purified Rabbit polyclonal SPG7 antibody |
SPG7 antibody |
|
10R-7193 |
Fitzgerald |
100 ul |
EUR 691 |
|
Description: Mouse monoclonal SPG7 antibody |
 Antibody) Paraplegin (SPG7) Antibody |
|
20-abx126627 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
 Anti-SPG7 antibody |
|
STJ112287 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. Mutations in this gene cause autosomal recessive spastic paraplegia 7. Two transcript variants encoding distinct isoforms have been identified. |
Anti-SPG7 antibody |
|
STJ192564 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to SPG7 |
 SPG7 siRNA |
|
20-abx905243 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SPG7 siRNA |
|
20-abx934940 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SPG7 siRNA |
|
20-abx934941 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-SPG7 |
|
YF-PA14753 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to SPG7 |
anti-SPG7 |
|
YF-PA14754 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to SPG7 |
 SPG7 cloning plasmid |
|
CSB-CL892174HU-10ug |
Cusabio |
10ug |
EUR 469 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1284
- Sequence: atggccgtgctgctgctgctgctccgtgccctccgccggggtccaggcccgggtcctcggccgctgtggggcccaggcccggcctggagtccagggttccccgccaggcccgggagggggcggccgtacatggccagcaggcctccgggggacctcgccgaggctgtaggccgag
- Show more
|
|
Description: A cloning plasmid for the SPG7 gene. |
 Rat SPG7 shRNA Plasmid |
|
20-abx990009 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human SPG7 shRNA Plasmid |
|
20-abx954557 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse SPG7 shRNA Plasmid |
|
20-abx982165 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) SPG7 Recombinant Protein (Rat) |
|
RP230786 |
ABM |
100 ug |
Ask for price |
) SPG7 Recombinant Protein (Human) |
|
RP029884 |
ABM |
100 ug |
Ask for price |
) SPG7 Recombinant Protein (Mouse) |
|
RP174980 |
ABM |
100 ug |
Ask for price |
 (pORF)) Spg7 ORF Vector (Rat) (pORF) |
|
ORF076930 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) SPG7 ORF Vector (Human) (pORF) |
|
ORF009962 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Spg7 ORF Vector (Mouse) (pORF) |
|
ORF058328 |
ABM |
1.0 ug DNA |
EUR 506 |
) ELISA kit for Rat Paraplegin (SPG7) |
|
KTE100219-48T |
Abbkine |
48T |
EUR 332 |
- SPG7 gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, o
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Paraplegin (SPG7) |
|
KTE100219-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SPG7 gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, o
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Paraplegin (SPG7) |
|
KTE100219-96T |
Abbkine |
96T |
EUR 539 |
- SPG7 gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, o
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
) Spg7 sgRNA CRISPR Lentivector set (Rat) |
|
K6429701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Spg7 sgRNA CRISPR Lentivector set (Mouse) |
|
K3569501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) SPG7 sgRNA CRISPR Lentivector set (Human) |
|
K2271901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) ELISA kit for Human Paraplegin (SPG7) |
|
KTE60532-48T |
Abbkine |
48T |
EUR 332 |
- Paraplegin (SPG7) encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular mot
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Paraplegin (SPG7) |
|
KTE60532-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Paraplegin (SPG7) encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular mot
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Paraplegin (SPG7) |
|
KTE60532-96T |
Abbkine |
96T |
EUR 539 |
- Paraplegin (SPG7) encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular mot
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
) ELISA kit for Mouse Paraplegin (SPG7) |
|
KTE70384-48T |
Abbkine |
48T |
EUR 332 |
- SPG7 encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organe
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Paraplegin (SPG7) |
|
KTE70384-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SPG7 encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organe
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Paraplegin (SPG7) |
|
KTE70384-96T |
Abbkine |
96T |
EUR 539 |
- SPG7 encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organe
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 (Target 1)) Spg7 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6429702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Spg7 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6429703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Spg7 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6429704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Spg7 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3569502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Spg7 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3569503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Spg7 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3569504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) SPG7 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2271902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) SPG7 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2271903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) SPG7 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2271904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) SPG7 Protein Vector (Rat) (pPB-C-His) |
|
PV307718 |
ABM |
500 ng |
EUR 1166 |
 (pPB-N-His)) SPG7 Protein Vector (Rat) (pPB-N-His) |
|
PV307719 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-HA)) SPG7 Protein Vector (Rat) (pPM-C-HA) |
|
PV307720 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-His)) SPG7 Protein Vector (Rat) (pPM-C-His) |
|
PV307721 |
ABM |
500 ng |
EUR 1166 |
 (pPB-C-His)) SPG7 Protein Vector (Human) (pPB-C-His) |
|
PV039845 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) SPG7 Protein Vector (Human) (pPB-N-His) |
|
PV039846 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) SPG7 Protein Vector (Human) (pPM-C-HA) |
|
PV039847 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) SPG7 Protein Vector (Human) (pPM-C-His) |
|
PV039848 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) SPG7 Protein Vector (Mouse) (pPB-C-His) |
|
PV233310 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) SPG7 Protein Vector (Mouse) (pPB-N-His) |
|
PV233311 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) SPG7 Protein Vector (Mouse) (pPM-C-HA) |
|
PV233312 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) SPG7 Protein Vector (Mouse) (pPM-C-His) |
|
PV233313 |
ABM |
500 ng |
EUR 1065 |
 Spg7 3'UTR Luciferase Stable Cell Line |
|
TU119578 |
ABM |
1.0 ml |
Ask for price |
 Spg7 3'UTR GFP Stable Cell Line |
|
TU169578 |
ABM |
1.0 ml |
Ask for price |
Spg7 3'UTR Luciferase Stable Cell Line |
|
TU221076 |
ABM |
1.0 ml |
Ask for price |
 SPG7 3'UTR GFP Stable Cell Line |
|
TU074453 |
ABM |
1.0 ml |
EUR 1394 |
Spg7 3'UTR GFP Stable Cell Line |
|
TU271076 |
ABM |
1.0 ml |
Ask for price |
 SPG7 3'UTR Luciferase Stable Cell Line |
|
TU024453 |
ABM |
1.0 ml |
EUR 1394 |
 (CMV) (pLenti-GIII-CMV)) SPG7 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV666031 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (UbC) (pLenti-GIII-UbC)) SPG7 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV666035 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (EF1a) (pLenti-GIII-EF1a)) SPG7 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV666036 |
ABM |
1.0 ug DNA |
EUR 1355 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
 HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
 HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
 JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
 JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
 JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
 JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
 MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
SPG7 Rabbit Polyclonal Antibody
