SPG7 Rabbit Polyclonal Antibody
SPG7 Polyclonal Antibody |
ABP60493-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human SPG7 protein at amino acid sequence of 71-120
- Applications tips:
|
Description: A polyclonal antibody for detection of SPG7 from Human. This SPG7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPG7 protein at amino acid sequence of 71-120 |
SPG7 Polyclonal Antibody |
ABP60493-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SPG7 protein at amino acid sequence of 71-120
- Applications tips:
|
Description: A polyclonal antibody for detection of SPG7 from Human. This SPG7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPG7 protein at amino acid sequence of 71-120 |
SPG7 Polyclonal Antibody |
ABP60493-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SPG7 protein at amino acid sequence of 71-120
- Applications tips:
|
Description: A polyclonal antibody for detection of SPG7 from Human. This SPG7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPG7 protein at amino acid sequence of 71-120 |
SPG7 Polyclonal Antibody |
27343-100ul |
SAB |
100ul |
EUR 252 |
SPG7 Polyclonal Antibody |
27343-50ul |
SAB |
50ul |
EUR 187 |
SPG7 Rabbit pAb |
A10249-100ul |
Abclonal |
100 ul |
EUR 308 |
SPG7 Rabbit pAb |
A10249-200ul |
Abclonal |
200 ul |
EUR 459 |
SPG7 Rabbit pAb |
A10249-20ul |
Abclonal |
20 ul |
EUR 183 |
SPG7 Rabbit pAb |
A10249-50ul |
Abclonal |
50 ul |
EUR 223 |
SPG7 Polyclonal Conjugated Antibody |
C27343 |
SAB |
100ul |
EUR 397 |
SPG7 antibody |
10R-7193 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal SPG7 antibody |
SPG7 antibody |
22251-100ul |
SAB |
100ul |
EUR 390 |
SPG7 antibody |
70R-13623 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal SPG7 antibody |
Paraplegin (SPG7) Antibody |
20-abx126627 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Anti-SPG7 antibody |
STJ112287 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. Mutations in this gene cause autosomal recessive spastic paraplegia 7. Two transcript variants encoding distinct isoforms have been identified. |
Anti-SPG7 antibody |
STJ192564 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SPG7 |
SPG7 siRNA |
20-abx905243 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SPG7 siRNA |
20-abx934940 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SPG7 siRNA |
20-abx934941 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-SPG7 |
YF-PA14753 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to SPG7 |
anti-SPG7 |
YF-PA14754 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to SPG7 |
SPG7 cloning plasmid |
CSB-CL892174HU-10ug |
Cusabio |
10ug |
EUR 469 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1284
- Sequence: atggccgtgctgctgctgctgctccgtgccctccgccggggtccaggcccgggtcctcggccgctgtggggcccaggcccggcctggagtccagggttccccgccaggcccgggagggggcggccgtacatggccagcaggcctccgggggacctcgccgaggctgtaggccgag
- Show more
|
Description: A cloning plasmid for the SPG7 gene. |
Rat SPG7 shRNA Plasmid |
20-abx990009 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SPG7 shRNA Plasmid |
20-abx954557 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse SPG7 shRNA Plasmid |
20-abx982165 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SPG7 Recombinant Protein (Human) |
RP029884 |
ABM |
100 ug |
Ask for price |
SPG7 Recombinant Protein (Rat) |
RP230786 |
ABM |
100 ug |
Ask for price |
SPG7 Recombinant Protein (Mouse) |
RP174980 |
ABM |
100 ug |
Ask for price |
Spg7 ORF Vector (Mouse) (pORF) |
ORF058328 |
ABM |
1.0 ug DNA |
EUR 506 |
SPG7 ORF Vector (Human) (pORF) |
ORF009962 |
ABM |
1.0 ug DNA |
EUR 95 |
Spg7 ORF Vector (Rat) (pORF) |
ORF076930 |
ABM |
1.0 ug DNA |
EUR 506 |
SPG7 sgRNA CRISPR Lentivector set (Human) |
K2271901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Spg7 sgRNA CRISPR Lentivector set (Mouse) |
K3569501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Spg7 sgRNA CRISPR Lentivector set (Rat) |
K6429701 |
ABM |
3 x 1.0 ug |
EUR 339 |
ELISA kit for Rat Paraplegin (SPG7) |
KTE100219-48T |
Abbkine |
48T |
EUR 332 |
- SPG7 gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, o
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Paraplegin (SPG7) |
KTE100219-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SPG7 gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, o
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Paraplegin (SPG7) |
KTE100219-96T |
Abbkine |
96T |
EUR 539 |
- SPG7 gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, o
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Paraplegin (SPG7) |
KTE60532-48T |
Abbkine |
48T |
EUR 332 |
- Paraplegin (SPG7) encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular mot
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Paraplegin (SPG7) |
KTE60532-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Paraplegin (SPG7) encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular mot
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Paraplegin (SPG7) |
KTE60532-96T |
Abbkine |
96T |
EUR 539 |
- Paraplegin (SPG7) encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular mot
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Paraplegin (SPG7) |
KTE70384-48T |
Abbkine |
48T |
EUR 332 |
- SPG7 encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organe
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Paraplegin (SPG7) |
KTE70384-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SPG7 encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organe
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Paraplegin (SPG7) |
KTE70384-96T |
Abbkine |
96T |
EUR 539 |
- SPG7 encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organe
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Paraplegin (SPG7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
SPG7 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2271902 |
ABM |
1.0 ug DNA |
EUR 154 |
SPG7 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2271903 |
ABM |
1.0 ug DNA |
EUR 154 |
SPG7 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2271904 |
ABM |
1.0 ug DNA |
EUR 154 |
Spg7 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3569502 |
ABM |
1.0 ug DNA |
EUR 154 |
Spg7 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3569503 |
ABM |
1.0 ug DNA |
EUR 154 |
Spg7 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3569504 |
ABM |
1.0 ug DNA |
EUR 154 |
Spg7 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6429702 |
ABM |
1.0 ug DNA |
EUR 154 |
Spg7 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6429703 |
ABM |
1.0 ug DNA |
EUR 154 |
Spg7 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6429704 |
ABM |
1.0 ug DNA |
EUR 154 |
SPG7 Protein Vector (Human) (pPB-C-His) |
PV039845 |
ABM |
500 ng |
EUR 329 |
SPG7 Protein Vector (Human) (pPB-N-His) |
PV039846 |
ABM |
500 ng |
EUR 329 |
SPG7 Protein Vector (Human) (pPM-C-HA) |
PV039847 |
ABM |
500 ng |
EUR 329 |
SPG7 Protein Vector (Human) (pPM-C-His) |
PV039848 |
ABM |
500 ng |
EUR 329 |
SPG7 Protein Vector (Rat) (pPB-C-His) |
PV307718 |
ABM |
500 ng |
EUR 1166 |
SPG7 Protein Vector (Rat) (pPB-N-His) |
PV307719 |
ABM |
500 ng |
EUR 1166 |
SPG7 Protein Vector (Rat) (pPM-C-HA) |
PV307720 |
ABM |
500 ng |
EUR 1166 |
SPG7 Protein Vector (Rat) (pPM-C-His) |
PV307721 |
ABM |
500 ng |
EUR 1166 |
SPG7 Protein Vector (Mouse) (pPB-C-His) |
PV233310 |
ABM |
500 ng |
EUR 1065 |
SPG7 Protein Vector (Mouse) (pPB-N-His) |
PV233311 |
ABM |
500 ng |
EUR 1065 |
SPG7 Protein Vector (Mouse) (pPM-C-HA) |
PV233312 |
ABM |
500 ng |
EUR 1065 |
SPG7 Protein Vector (Mouse) (pPM-C-His) |
PV233313 |
ABM |
500 ng |
EUR 1065 |
Spg7 3'UTR GFP Stable Cell Line |
TU169578 |
ABM |
1.0 ml |
Ask for price |
Spg7 3'UTR Luciferase Stable Cell Line |
TU119578 |
ABM |
1.0 ml |
Ask for price |
SPG7 3'UTR GFP Stable Cell Line |
TU074453 |
ABM |
1.0 ml |
EUR 1394 |
SPG7 3'UTR Luciferase Stable Cell Line |
TU024453 |
ABM |
1.0 ml |
EUR 1394 |
Spg7 3'UTR Luciferase Stable Cell Line |
TU221076 |
ABM |
1.0 ml |
Ask for price |
Spg7 3'UTR GFP Stable Cell Line |
TU271076 |
ABM |
1.0 ml |
Ask for price |
SPG7 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV666031 |
ABM |
1.0 ug DNA |
EUR 1355 |
SPG7 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV666035 |
ABM |
1.0 ug DNA |
EUR 1355 |
SPG7 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV666036 |
ABM |
1.0 ug DNA |
EUR 1355 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
SPG7 Rabbit Polyclonal Antibody