STC1 Rabbit Polyclonal Antibody
STC1 Polyclonal Antibody |
ABP60537-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human STC1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of STC1 from Human, Mouse, Rat. This STC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC1 protein |
STC1 Polyclonal Antibody |
ABP60537-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human STC1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of STC1 from Human, Mouse, Rat. This STC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC1 protein |
STC1 Polyclonal Antibody |
A61178 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Human Stanniocalcin 1 (STC1) ELISA Kit |
DLR-STC1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Stanniocalcin 1 (STC1) ELISA Kit |
DLR-STC1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
DLR-STC1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids. |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
DLR-STC1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids. |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
DLR-STC1-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids. |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
DLR-STC1-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids. |
Human Stanniocalcin 1 (STC1) ELISA Kit |
RD-STC1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Stanniocalcin 1 (STC1) ELISA Kit |
RD-STC1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
RD-STC1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
RD-STC1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
RD-STC1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
RD-STC1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Stanniocalcin 1 (STC1) ELISA Kit |
RDR-STC1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Stanniocalcin 1 (STC1) ELISA Kit |
RDR-STC1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
RDR-STC1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
RDR-STC1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
RDR-STC1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
RDR-STC1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
STC1 Rabbit pAb |
A16976-100ul |
Abclonal |
100 ul |
EUR 308 |
STC1 Rabbit pAb |
A16976-200ul |
Abclonal |
200 ul |
EUR 459 |
STC1 Rabbit pAb |
A16976-20ul |
Abclonal |
20 ul |
EUR 183 |
STC1 Rabbit pAb |
A16976-50ul |
Abclonal |
50 ul |
EUR 223 |
STC1 Rabbit pAb |
A6755-100ul |
Abclonal |
100 ul |
EUR 308 |
STC1 Rabbit pAb |
A6755-200ul |
Abclonal |
200 ul |
EUR 459 |
STC1 Rabbit pAb |
A6755-20ul |
Abclonal |
20 ul |
EUR 183 |
STC1 Rabbit pAb |
A6755-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal STC1 Antibody (C-term) |
APR10288G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STC1 (C-term). This antibody is tested and proven to work in the following applications: |
Stanniocalcin 1 Polyclonal (STC1) Antibody |
20-abx116920 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STC1 Polyclonal Antibody, Biotin Conjugated |
A61179 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
STC1 Polyclonal Antibody, FITC Conjugated |
A61180 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
STC1 Polyclonal Antibody, HRP Conjugated |
A61181 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
STC1 antibody |
70R-6215 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal STC1 antibody raised against the N terminal of STC1 |
STC1 Antibody |
40121-100ul |
SAB |
100ul |
EUR 252 |
STC1 antibody |
70R-20582 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal STC1 antibody |
STC1 Antibody |
DF8393 |
Affbiotech |
200ul |
EUR 304 |
Description: STC1 Antibody detects endogenous levels of total STC1. |
STC1 Antibody |
1-CSB-PA631492 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
STC1 Antibody |
1-CSB-PA09889A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
STC1 Antibody |
1-CSB-PA022821ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
STC1 Antibody |
1-CSB-PA022821GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Stanniocalcin 1 (STC1) Polyclonal Antibody (Human) |
4-PAC874Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC1 (Ser28-Ala247)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1) |
STC1 Conjugated Antibody |
C40121 |
SAB |
100ul |
EUR 397 |
anti- STC1 antibody |
FNab08315 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:100
- Immunogen: stanniocalcin 1
- Uniprot ID: P52823
- Gene ID: 6781
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against STC1 |
Anti-STC1 antibody |
STJ28838 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conserved cysteine residues and is phosphorylated by protein kinase C exclusively on its serine residues. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Overexpression of human stanniocalcin 1 in mice produces high serum phosphate levels, dwarfism, and increased metabolic rate. This gene has altered expression in hepatocellular, ovarian, and breast cancers. |
Anti-STC1 antibody |
STJ192284 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to STC1 |
Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), APC |
4-PAC874Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC1 (Ser28-Ala247)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with APC. |
Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), Biotinylated |
4-PAC874Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC1 (Ser28-Ala247)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with Biotin. |
Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), Cy3 |
4-PAC874Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC1 (Ser28-Ala247)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with Cy3. |
Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), FITC |
4-PAC874Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC1 (Ser28-Ala247)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with FITC. |
Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), HRP |
4-PAC874Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC1 (Ser28-Ala247)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with HRP. |
Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), PE |
4-PAC874Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC1 (Ser28-Ala247)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with PE. |
STC1 siRNA |
20-abx905324 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STC1 protein |
30-1376 |
Fitzgerald |
500 ug |
EUR 392 |
Description: Recombinant STC1 protein |
STC1 siRNA |
20-abx935425 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STC1 siRNA |
20-abx935426 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody |
20-abx132353 |
Abbexa |
-
EUR 328.00
-
EUR 829.00
-
EUR 439.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Stanniocalcin 1 (STC1) Antibody |
20-abx101392 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Stanniocalcin 1 (STC1) Antibody |
20-abx006838 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody |
abx028371-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody |
abx028371-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody |
20-abx174633 |
Abbexa |
|
|
|
Stanniocalcin 1 (STC1) Antibody |
20-abx306443 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody |
20-abx320305 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody |
abx238315-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Stanniocalcin 1 (STC1) Antibody |
20-abx241299 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody |
20-abx178466 |
Abbexa |
|
|
|
Stanniocalcin 1 (STC1) Antibody |
20-abx178467 |
Abbexa |
|
|
|
Stanniocalcin 1 (STC1) Antibody |
20-abx178468 |
Abbexa |
|
|
|
STC1 Antibody, HRP conjugated |
1-CSB-PA09889B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
STC1 Antibody, FITC conjugated |
1-CSB-PA09889C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
STC1 Antibody, Biotin conjugated |
1-CSB-PA09889D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC874Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC1 (Ser28-Ala247)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with APC-Cy7. |
STC1 cloning plasmid |
CSB-CL022821HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 744
- Sequence: atgctccaaaactcagcagtgcttctggtgctggtgatcagtgcttctgcaacccatgaggcggagcagaatgactctgtgagccccaggaaatcccgagtggcggctcaaaactcagctgaagtggttcgttgcctcaacagtgctctacaggtcggctgcggggcttttgcatg
- Show more
|
Description: A cloning plasmid for the STC1 gene. |
STC1 Blocking Peptide |
33R-6205 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STC1 antibody, catalog no. 70R-6215 |
STC1 Blocking Peptide |
DF8393-BP |
Affbiotech |
1mg |
EUR 195 |
Stanniocalcin 1 (STC1) Antibody (HRP) |
20-abx306444 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody (FITC) |
20-abx306445 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody (Biotin) |
20-abx306446 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody (FITC) |
20-abx271148 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Stanniocalcin 1 (STC1) Antibody (Biotin) |
20-abx271414 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Anti-Stanniocalcin 1/STC1 Antibody |
PA1997 |
BosterBio |
100ug/vial |
EUR 294 |
Rat STC1 shRNA Plasmid |
20-abx986718 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human STC1 shRNA Plasmid |
20-abx954638 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse STC1 shRNA Plasmid |
20-abx972912 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human Stanniocalcin-1 (STC1) |
1-CSB-RP098854h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 50.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Stanniocalcin-1(STC1),partial expressed in E.coli |
Human Stanniocalcin-1 (STC1) |
1-CSB-RP098874HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 39.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Stanniocalcin-1(STC1),partial expressed in E.coli |
Recombinant Stanniocalcin 1 (STC1) |
4-RPC874Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P52823
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 56.8kDa
- Isoelectric Point: 7.3
|
Description: Recombinant Human Stanniocalcin 1 expressed in: E.coli |
Recombinant Stanniocalcin 1 (STC1) |
4-RPC874Mu01 |
Cloud-Clone |
-
EUR 510.37
-
EUR 239.00
-
EUR 1638.88
-
EUR 612.96
-
EUR 1125.92
-
EUR 404.00
-
EUR 3947.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 54.7kDa
- Isoelectric Point: 8.9
|
Description: Recombinant Mouse Stanniocalcin 1 expressed in: E.coli |
STC1 Recombinant Protein (Human) |
RP030376 |
ABM |
100 ug |
Ask for price |
STC1 Recombinant Protein (Rat) |
RP231398 |
ABM |
100 ug |
Ask for price |
STC1 Recombinant Protein (Mouse) |
RP175988 |
ABM |
100 ug |
Ask for price |
Monoclonal STC1 Antibody (monoclonal) (M01), Clone: 4H4 |
APR10289G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human STC1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4H4. This antibody is applicable in WB |
Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig) |
4-MAC874Hu22 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser28-Ala247
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1) |
Mouse Stanniocalcin 1 (STC1) Protein |
20-abx655127 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rat Stanniocalcin 1 (STC1) Protein |
20-abx655128 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Stanniocalcin 1 (STC1) Protein |
20-abx655129 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2207.00
-
EUR 843.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Stanniocalcin 1 (STC1) Protein |
20-abx069167 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Stc1 ORF Vector (Mouse) (pORF) |
ORF058664 |
ABM |
1.0 ug DNA |
EUR 506 |
STC1 ORF Vector (Human) (pORF) |
ORF010126 |
ABM |
1.0 ug DNA |
EUR 95 |
Stc1 ORF Vector (Rat) (pORF) |
ORF077134 |
ABM |
1.0 ug DNA |
EUR 506 |
STC1 ELISA Kit (Human) (OKCD00763) |
OKCD00763 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Stimulates renal phosphate reabsorption, and could therefore prevent hypercalcemia. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 11.6 pg/mL |
Stc1 ELISA Kit (Mouse) (OKCD01708) |
OKCD01708 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Stimulates renal phosphate reabsorption, and could therefore prevent hypercalcemia.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 2.63 pg/mL |
STC1 ELISA Kit (Rat) (OKDD00732) |
OKDD00732 |
Aviva Systems Biology |
96 Wells |
EUR 1040 |
Description: Description of target: Calcium/phosphate-regulating protein; involved in stimulating osteoblast differentiation [rgd, feb 2006];Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.055 ng/mL |
STC1 ELISA Kit (Human) (OKBB00964) |
OKBB00964 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Stanniocalcin-1 is a glycoprotein which is encoded by the STC1 gene. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. Human Stanniocalcin-1 is a putative molecular biomarker of leukemic microenvironment and the only molecular function known up to date is a SUMO E3 ligase activity in the SUMOylation cycle. STC1 interacts with lots of proteins in the cytoplasm, mitochondria, endoplasmatic reticulum and dot-like fashion in the nucleus. The N-terminal region of STC1 is the function region which is responsible to establish the interaction with its partners, including SUMO1. Low resolution studies shows that STC1 is an anti-parallel homodimer in solution and the cystein 202 is responsible for the dimerization of this protein. All the 5 dissulfide bonds of human STC1 are conserved and have the same profile of fish STC.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
STC1 ELISA Kit (Mouse) (OKCA02193) |
OKCA02193 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: Stimulates renal phosphate reabsorption, and could therefore prevent hypercalcemia.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL |
Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), APC |
4-MAC874Hu22-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser28-Ala247
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with APC. |
Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), Biotinylated |
4-MAC874Hu22-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser28-Ala247
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with Biotin. |
Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), Cy3 |
4-MAC874Hu22-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser28-Ala247
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with Cy3. |
Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), FITC |
4-MAC874Hu22-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser28-Ala247
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with FITC. |
Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), HRP |
4-MAC874Hu22-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser28-Ala247
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with HRP. |
Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), PE |
4-MAC874Hu22-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser28-Ala247
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with PE. |
Cow Stanniocalcin 1 (STC1) ELISA Kit |
abx555794-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 1-3 weeks.
|
Rat Stanniocalcin 1 (STC1) ELISA Kit |
abx571149-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Human Stanniocalcin 1 (STC1) ELISA Kit |
abx576396-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 1-3 weeks.
|
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
abx576405-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Human STC1/ Stanniocalcin-1 ELISA Kit |
E2412Hu |
Sunlong |
1 Kit |
EUR 605 |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
20-abx156121 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
20-abx154711 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Stanniocalcin 1 (STC1) ELISA Kit |
20-abx153168 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Stanniocalcin 1 (STC1) CLIA Kit |
20-abx493944 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Stanniocalcin 1 (STC1) CLIA Kit |
20-abx493945 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Stanniocalcin 1 (STC1) CLIA Kit |
20-abx493946 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
STC1 sgRNA CRISPR Lentivector set (Human) |
K2301401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Stc1 sgRNA CRISPR Lentivector set (Mouse) |
K4351401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Stanniocalcin-1(STC1) ELISA kit |
CSB-EL022821HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-1 (STC1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Stanniocalcin-1(STC1) ELISA kit |
1-CSB-EL022821HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-1(STC1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Stanniocalcin-1(STC1) ELISA kit |
CSB-EL022821MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Stanniocalcin-1 (STC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Stanniocalcin-1(STC1) ELISA kit |
1-CSB-EL022821MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Stanniocalcin-1(STC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Stc1 sgRNA CRISPR Lentivector set (Rat) |
K6967001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Stanniocalcin 1 (STC1) ELISA Kit |
4-SEC874Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
4-SEC874Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids. |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids. |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids. |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids. |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
4-SEC874Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Stanniocalcin 1 (STC1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Stanniocalcin 1 ELISA Kit (STC1) |
RK02343 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Stanniocalcin 1 ELISA Kit (STC1) |
RK03214 |
Abclonal |
96 Tests |
EUR 521 |
Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), APC-Cy7 |
4-MAC874Hu22-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser28-Ala247
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with APC-Cy7. |
Human Stanniocalcin 1/STC1 PicoKine ELISA Kit |
EK1404 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human STC1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
ELISA kit for Human STC1 (Stanniocalcin 1) |
ELK3332 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
- Show more
|
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse STC1 (Stanniocalcin 1) |
ELK6277 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
- Show more
|
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Rat STC1 (Stanniocalcin 1) |
ELK6427 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
- Show more
|
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
STC1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2301402 |
ABM |
1.0 ug DNA |
EUR 154 |
STC1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2301403 |
ABM |
1.0 ug DNA |
EUR 154 |
STC1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2301404 |
ABM |
1.0 ug DNA |
EUR 154 |
Stc1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4351402 |
ABM |
1.0 ug DNA |
EUR 154 |
Stc1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4351403 |
ABM |
1.0 ug DNA |
EUR 154 |
Stc1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4351404 |
ABM |
1.0 ug DNA |
EUR 154 |
Stc1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6967002 |
ABM |
1.0 ug DNA |
EUR 154 |
Stc1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6967003 |
ABM |
1.0 ug DNA |
EUR 154 |
Stc1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6967004 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Rat Stanniocalcin-1 (STC1) |
KTE100136-48T |
Abbkine |
48T |
EUR 332 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Stanniocalcin-1 (STC1) |
KTE100136-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Stanniocalcin-1 (STC1) |
KTE100136-96T |
Abbkine |
96T |
EUR 539 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Stanniocalcin-1 (STC1) |
KTE70268-48T |
Abbkine |
48T |
EUR 332 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Stanniocalcin-1 (STC1) |
KTE70268-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Stanniocalcin-1 (STC1) |
KTE70268-96T |
Abbkine |
96T |
EUR 539 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Stanniocalcin-1 (STC1) |
KTE60383-48T |
Abbkine |
48T |
EUR 332 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Stanniocalcin-1 (STC1) |
KTE60383-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Stanniocalcin-1 (STC1) |
KTE60383-96T |
Abbkine |
96T |
EUR 539 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
STC1 Protein Vector (Human) (pPB-C-His) |
PV040501 |
ABM |
500 ng |
EUR 329 |
STC1 Protein Vector (Human) (pPB-N-His) |
PV040502 |
ABM |
500 ng |
EUR 329 |
STC1 Protein Vector (Human) (pPM-C-HA) |
PV040503 |
ABM |
500 ng |
EUR 329 |
STC1 Protein Vector (Human) (pPM-C-His) |
PV040504 |
ABM |
500 ng |
EUR 329 |
STC1 Protein Vector (Rat) (pPB-C-His) |
PV308534 |
ABM |
500 ng |
EUR 603 |
STC1 Protein Vector (Rat) (pPB-N-His) |
PV308535 |
ABM |
500 ng |
EUR 603 |
STC1 Protein Vector (Rat) (pPM-C-HA) |
PV308536 |
ABM |
500 ng |
EUR 603 |
STC1 Protein Vector (Rat) (pPM-C-His) |
PV308537 |
ABM |
500 ng |
EUR 603 |
STC1 Protein Vector (Mouse) (pPB-C-His) |
PV234654 |
ABM |
500 ng |
EUR 603 |
STC1 Protein Vector (Mouse) (pPB-N-His) |
PV234655 |
ABM |
500 ng |
EUR 603 |
STC1 Protein Vector (Mouse) (pPM-C-HA) |
PV234656 |
ABM |
500 ng |
EUR 603 |
STC1 Protein Vector (Mouse) (pPM-C-His) |
PV234657 |
ABM |
500 ng |
EUR 603 |
Stc1 3'UTR GFP Stable Cell Line |
TU169825 |
ABM |
1.0 ml |
Ask for price |
Stc1 3'UTR Luciferase Stable Cell Line |
TU119825 |
ABM |
1.0 ml |
Ask for price |
STC1 3'UTR GFP Stable Cell Line |
TU074797 |
ABM |
1.0 ml |
EUR 1521 |
STC1 3'UTR Luciferase Stable Cell Line |
TU024797 |
ABM |
1.0 ml |
EUR 1521 |
Stc1 3'UTR Luciferase Stable Cell Line |
TU221289 |
ABM |
1.0 ml |
Ask for price |
Stc1 3'UTR GFP Stable Cell Line |
TU271289 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
STC1 Rabbit Polyclonal Antibody