CelltaGen
셀타젠 Genetic Genotyping

STC1 Rabbit Polyclonal Antibody

STC1 Polyclonal Antibody

ABP60537-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STC1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of STC1 from Human, Mouse, Rat. This STC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC1 protein

STC1 Polyclonal Antibody

ES11126-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against STC1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

STC1 Polyclonal Antibody

ES11126-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STC1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Stanniocalcin 1 (STC1) ELISA Kit

DLR-STC1-Hu-48T 48T
EUR 517
  • Should the Human Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit

DLR-STC1-Hu-96T 96T
EUR 673
  • Should the Human Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit

DLR-STC1-Mu-48T 48T
EUR 527
  • Should the Mouse Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit

DLR-STC1-Mu-96T 96T
EUR 688
  • Should the Mouse Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit

DLR-STC1-Ra-48T 48T
EUR 549
  • Should the Rat Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit

DLR-STC1-Ra-96T 96T
EUR 718
  • Should the Rat Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit

RD-STC1-Hu-48Tests 48 Tests
EUR 521

Human Stanniocalcin 1 (STC1) ELISA Kit

RD-STC1-Hu-96Tests 96 Tests
EUR 723

Mouse Stanniocalcin 1 (STC1) ELISA Kit

RD-STC1-Mu-48Tests 48 Tests
EUR 533

Mouse Stanniocalcin 1 (STC1) ELISA Kit

RD-STC1-Mu-96Tests 96 Tests
EUR 740

Rat Stanniocalcin 1 (STC1) ELISA Kit

RD-STC1-Ra-48Tests 48 Tests
EUR 557

Rat Stanniocalcin 1 (STC1) ELISA Kit

RD-STC1-Ra-96Tests 96 Tests
EUR 775

Human Stanniocalcin 1 (STC1) ELISA Kit

RDR-STC1-Hu-48Tests 48 Tests
EUR 544

Human Stanniocalcin 1 (STC1) ELISA Kit

RDR-STC1-Hu-96Tests 96 Tests
EUR 756

Mouse Stanniocalcin 1 (STC1) ELISA Kit

RDR-STC1-Mu-48Tests 48 Tests
EUR 557

Mouse Stanniocalcin 1 (STC1) ELISA Kit

RDR-STC1-Mu-96Tests 96 Tests
EUR 774

Rat Stanniocalcin 1 (STC1) ELISA Kit

RDR-STC1-Ra-48Tests 48 Tests
EUR 583

Rat Stanniocalcin 1 (STC1) ELISA Kit

RDR-STC1-Ra-96Tests 96 Tests
EUR 811

STC1 Rabbit pAb

A6755-100ul 100 ul
EUR 308

STC1 Rabbit pAb

A6755-200ul 200 ul
EUR 459

STC1 Rabbit pAb

A6755-20ul 20 ul
EUR 183

STC1 Rabbit pAb

A6755-50ul 50 ul
EUR 223

STC1 Rabbit pAb

A16976-100ul 100 ul
EUR 308

STC1 Rabbit pAb

A16976-200ul 200 ul
EUR 459

STC1 Rabbit pAb

A16976-20ul 20 ul
EUR 183

STC1 Rabbit pAb

A16976-50ul 50 ul
EUR 223

STC1 antibody

70R-20582 50 ul
EUR 435
Description: Rabbit polyclonal STC1 antibody

STC1 Antibody

40121-100ul 100ul
EUR 252

STC1 Antibody

1-CSB-PA09889A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STC1 Antibody

1-CSB-PA631492
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

STC1 Antibody

DF8393 200ul
EUR 304
Description: STC1 Antibody detects endogenous levels of total STC1.

STC1 antibody

70R-6215 50 ug
EUR 467
Description: Rabbit polyclonal STC1 antibody raised against the N terminal of STC1

STC1 Antibody

1-CSB-PA022821ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STC1 Antibody

1-CSB-PA022821GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

STC1 Antibody

ABD8393 100 ug
EUR 438

Polyclonal STC1 Antibody (C-term)

APR10288G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STC1 (C-term). This antibody is tested and proven to work in the following applications:

Stanniocalcin 1 Polyclonal (STC1) Antibody

20-abx116920
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

STC1 Polyclonal Antibody, Biotin Conjugated

A61179 100 µg
EUR 570.55
Description: Ask the seller for details

STC1 Polyclonal Antibody, FITC Conjugated

A61180 100 µg
EUR 570.55
Description: The best epigenetics products

STC1 Polyclonal Antibody, HRP Conjugated

A61181 100 µg
EUR 570.55
Description: kits suitable for this type of research

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human)

4-PAC874Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC1 (Ser28-Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1)

STC1 Conjugated Antibody

C40121 100ul
EUR 397

anti- STC1 antibody

FNab08315 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: stanniocalcin 1
  • Uniprot ID: P52823
  • Gene ID: 6781
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against STC1

Anti-STC1 antibody

PAab08315 100 ug
EUR 386

Anti-STC1 antibody

STJ28838 100 µl
EUR 277
Description: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conserved cysteine residues and is phosphorylated by protein kinase C exclusively on its serine residues. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Overexpression of human stanniocalcin 1 in mice produces high serum phosphate levels, dwarfism, and increased metabolic rate. This gene has altered expression in hepatocellular, ovarian, and breast cancers.

Anti-STC1 antibody

STJ119282 100 µl
EUR 277

Anti-STC1 antibody

STJ192284 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STC1

Stc1/ Rat Stc1 ELISA Kit

ELI-29283r 96 Tests
EUR 886

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), APC

4-PAC874Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC1 (Ser28-Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with APC.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), Biotinylated

4-PAC874Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC1 (Ser28-Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with Biotin.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), Cy3

4-PAC874Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC1 (Ser28-Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with Cy3.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), FITC

4-PAC874Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC1 (Ser28-Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with FITC.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), HRP

4-PAC874Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC1 (Ser28-Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with HRP.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), PE

4-PAC874Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC1 (Ser28-Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with PE.

STC1 protein

30-1376 500 ug
EUR 392
Description: Recombinant STC1 protein

STC1 siRNA

20-abx905324
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STC1 siRNA

20-abx935425
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STC1 siRNA

20-abx935426
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STC1 Antibody, HRP conjugated

1-CSB-PA09889B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

STC1 Antibody, FITC conjugated

1-CSB-PA09889C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

STC1 Antibody, Biotin conjugated

1-CSB-PA09889D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Stanniocalcin 1 (STC1) Antibody

20-abx006838
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody

20-abx178466
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Stanniocalcin 1 (STC1) Antibody

20-abx178467
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Stanniocalcin 1 (STC1) Antibody

20-abx178468
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Stanniocalcin 1 (STC1) Antibody

20-abx101392
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stanniocalcin 1 (STC1) Antibody

20-abx132353
  • EUR 328.00
  • EUR 829.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stanniocalcin 1 (STC1) Antibody

20-abx174633
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Stanniocalcin 1 (STC1) Antibody

abx028371-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody

abx028371-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody

abx238315-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Stanniocalcin 1 (STC1) Antibody

20-abx241299
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody

20-abx320305
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody

20-abx306443
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), APC-Cy7

4-PAC874Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC1 (Ser28-Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with APC-Cy7.

STC1 Blocking Peptide

33R-6205 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STC1 antibody, catalog no. 70R-6215

STC1 Blocking Peptide

DF8393-BP 1mg
EUR 195

STC1 cloning plasmid

CSB-CL022821HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 744
  • Sequence: atgctccaaaactcagcagtgcttctggtgctggtgatcagtgcttctgcaacccatgaggcggagcagaatgactctgtgagccccaggaaatcccgagtggcggctcaaaactcagctgaagtggttcgttgcctcaacagtgctctacaggtcggctgcggggcttttgcatg
  • Show more
Description: A cloning plasmid for the STC1 gene.

Stanniocalcin 1 (STC1) Antibody (FITC)

20-abx271148
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Stanniocalcin 1 (STC1) Antibody (Biotin)

20-abx271414
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Stanniocalcin 1 (STC1) Antibody (HRP)

20-abx306444
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody (FITC)

20-abx306445
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody (Biotin)

20-abx306446
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Stanniocalcin 1/STC1 Antibody

PA1997 100ug/vial
EUR 294

Human Stanniocalcin-1 (STC1)

1-CSB-RP098854h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Stanniocalcin-1(STC1),partial expressed in E.coli

Human Stanniocalcin-1 (STC1)

1-CSB-RP098874HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Stanniocalcin-1(STC1),partial expressed in E.coli

STC1 ELISA KIT|Human

EF003296 96 Tests
EUR 689

Mouse STC1 shRNA Plasmid

20-abx972912
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat STC1 shRNA Plasmid

20-abx986718
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human STC1 shRNA Plasmid

20-abx954638
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STC1 Recombinant Protein (Rat)

RP231398 100 ug Ask for price

Recombinant Stanniocalcin 1 (STC1)

4-RPC874Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P52823
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 56.8kDa
  • Isoelectric Point: 7.3
Description: Recombinant Human Stanniocalcin 1 expressed in: E.coli

Recombinant Stanniocalcin 1 (STC1)

4-RPC874Mu01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 54.7kDa
  • Isoelectric Point: 8.9
Description: Recombinant Mouse Stanniocalcin 1 expressed in: E.coli

pCMV-SPORT6-STC1 Plasmid

PVT16448 2 ug
EUR 325

STC1 Recombinant Protein (Human)

RP030376 100 ug Ask for price

STC1 Recombinant Protein (Mouse)

RP175988 100 ug Ask for price

Monoclonal STC1 Antibody (monoclonal) (M01), Clone: 4H4

APR10289G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human STC1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4H4. This antibody is applicable in WB

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig)

4-MAC874Hu22
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser28-Ala247
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1)

Human Stanniocalcin 1 (STC1) Protein

20-abx069167
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Stanniocalcin 1 (STC1) Protein

20-abx655127
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Stanniocalcin 1 (STC1) Protein

20-abx655128
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Stanniocalcin 1 (STC1) Protein

20-abx655129
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stc1 ORF Vector (Rat) (pORF)

ORF077134 1.0 ug DNA
EUR 506

STC1 ORF Vector (Human) (pORF)

ORF010126 1.0 ug DNA
EUR 95

Stc1 ORF Vector (Mouse) (pORF)

ORF058664 1.0 ug DNA
EUR 506

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), APC

4-MAC874Hu22-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser28-Ala247
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with APC.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), Biotinylated

4-MAC874Hu22-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser28-Ala247
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with Biotin.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), Cy3

4-MAC874Hu22-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser28-Ala247
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with Cy3.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), FITC

4-MAC874Hu22-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser28-Ala247
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with FITC.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), HRP

4-MAC874Hu22-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser28-Ala247
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with HRP.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), PE

4-MAC874Hu22-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser28-Ala247
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with PE.

Human Stanniocalcin-1(STC1) ELISA kit

CSB-EL022821HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-1 (STC1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Stanniocalcin-1(STC1) ELISA kit

1-CSB-EL022821HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-1(STC1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Stanniocalcin-1(STC1) ELISA kit

CSB-EL022821MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Stanniocalcin-1 (STC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Stanniocalcin-1(STC1) ELISA kit

1-CSB-EL022821MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Stanniocalcin-1(STC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Stanniocalcin 1 (STC1) ELISA Kit

20-abx156121
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Stanniocalcin 1 (STC1) ELISA Kit

20-abx154711
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Stanniocalcin 1 (STC1) ELISA Kit

20-abx153168
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human STC1/ Stanniocalcin-1 ELISA Kit

E2412Hu 1 Kit
EUR 605

Bovine Stanniocalcin- 1, STC1 ELISA KIT

ELI-13825b 96 Tests
EUR 928

Cow Stanniocalcin 1 (STC1) ELISA Kit

abx555794-96tests 96 tests
EUR 911
  • Shipped within 1-3 weeks.

Rat Stanniocalcin 1 (STC1) ELISA Kit

abx571149-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Human Stanniocalcin 1 (STC1) ELISA Kit

abx576396-96tests 96 tests
EUR 739
  • Shipped within 1-3 weeks.

Mouse Stanniocalcin 1 (STC1) ELISA Kit

abx576405-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Human Stanniocalcin 1 (STC1) CLIA Kit

20-abx493944
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Stanniocalcin 1 (STC1) CLIA Kit

20-abx493945
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Stanniocalcin 1 (STC1) CLIA Kit

20-abx493946
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Stanniocalcin- 1, Stc1 ELISA KIT

ELI-39536m 96 Tests
EUR 865

Human Stanniocalcin- 1, STC1 ELISA KIT

ELI-41328h 96 Tests
EUR 824

Stc1 sgRNA CRISPR Lentivector set (Rat)

K6967001 3 x 1.0 ug
EUR 339

Stc1 sgRNA CRISPR Lentivector set (Mouse)

K4351401 3 x 1.0 ug
EUR 339

STC1 sgRNA CRISPR Lentivector set (Human)

K2301401 3 x 1.0 ug
EUR 339

Human Stanniocalcin 1 ELISA Kit (STC1)

RK02343 96 Tests
EUR 521

Human Stanniocalcin 1 (STC1) ELISA Kit

SEC874Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit

SEC874Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit

SEC874Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit

SEC874Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit

4-SEC874Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Stanniocalcin 1 (STC1) ELISA Kit

SEC874Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit

SEC874Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit

SEC874Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit

SEC874Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit

4-SEC874Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Stanniocalcin 1 (STC1) ELISA Kit

SEC874Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit

SEC874Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit

SEC874Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit

SEC874Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit

4-SEC874Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Stanniocalcin 1 (STC1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Stanniocalcin 1 ELISA Kit (STC1)

RK03214 96 Tests
EUR 521

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), APC-Cy7

4-MAC874Hu22-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser28-Ala247
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with APC-Cy7.

Human Stanniocalcin 1/STC1 PicoKine ELISA Kit

EK1404 96 wells
EUR 425
Description: For quantitative detection of human STC1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

ELISA kit for Human STC1 (Stanniocalcin 1)

ELK3332 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
  • Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse STC1 (Stanniocalcin 1)

ELK6277 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
  • Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat STC1 (Stanniocalcin 1)

ELK6427 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
  • Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Stanniocalcin-1 (STC1)

KTE100136-48T 48T
EUR 332
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Stanniocalcin-1 (STC1)

KTE100136-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Stanniocalcin-1 (STC1)

KTE100136-96T 96T
EUR 539
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Stc1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6967002 1.0 ug DNA
EUR 154

Stc1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6967003 1.0 ug DNA
EUR 154

Stc1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6967004 1.0 ug DNA
EUR 154

Stc1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4351402 1.0 ug DNA
EUR 154

Stc1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4351403 1.0 ug DNA
EUR 154

Stc1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4351404 1.0 ug DNA
EUR 154

STC1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2301402 1.0 ug DNA
EUR 154

STC1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2301403 1.0 ug DNA
EUR 154

STC1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2301404 1.0 ug DNA
EUR 154

ELISA kit for Human Stanniocalcin-1 (STC1)

KTE60383-48T 48T
EUR 332
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-1 (STC1)

KTE60383-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-1 (STC1)

KTE60383-96T 96T
EUR 539
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Stanniocalcin-1 (STC1)

KTE70268-48T 48T
EUR 332
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Stanniocalcin-1 (STC1)

KTE70268-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Stanniocalcin-1 (STC1)

KTE70268-96T 96T
EUR 539
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

STC1 Protein Vector (Rat) (pPB-C-His)

PV308534 500 ng
EUR 603

STC1 Protein Vector (Rat) (pPB-N-His)

PV308535 500 ng
EUR 603

STC1 Protein Vector (Rat) (pPM-C-HA)

PV308536 500 ng
EUR 603

STC1 Protein Vector (Rat) (pPM-C-His)

PV308537 500 ng
EUR 603

STC1 Protein Vector (Human) (pPB-C-His)

PV040501 500 ng
EUR 329

STC1 Protein Vector (Human) (pPB-N-His)

PV040502 500 ng
EUR 329

STC1 Protein Vector (Human) (pPM-C-HA)

PV040503 500 ng
EUR 329

STC1 Protein Vector (Human) (pPM-C-His)

PV040504 500 ng
EUR 329

STC1 Protein Vector (Mouse) (pPB-C-His)

PV234654 500 ng
EUR 603

STC1 Protein Vector (Mouse) (pPB-N-His)

PV234655 500 ng
EUR 603

STC1 Protein Vector (Mouse) (pPM-C-HA)

PV234656 500 ng
EUR 603

STC1 Protein Vector (Mouse) (pPM-C-His)

PV234657 500 ng
EUR 603

Stc1 3'UTR Luciferase Stable Cell Line

TU119825 1.0 ml Ask for price

Stc1 3'UTR GFP Stable Cell Line

TU169825 1.0 ml Ask for price

Stc1 3'UTR Luciferase Stable Cell Line

TU221289 1.0 ml Ask for price

STC1 3'UTR GFP Stable Cell Line

TU074797 1.0 ml
EUR 1521

Stc1 3'UTR GFP Stable Cell Line

TU271289 1.0 ml Ask for price

STC1 3'UTR Luciferase Stable Cell Line

TU024797 1.0 ml
EUR 1521

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

STC1 Rabbit Polyclonal Antibody