STC2 Rabbit Polyclonal Antibody
STC2 Polyclonal Antibody |
ES11240-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against STC2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
STC2 Polyclonal Antibody |
ES11240-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against STC2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Stanniocalcin 2 (STC2) ELISA Kit |
DLR-STC2-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Stanniocalcin 2 (STC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Stanniocalcin 2 (STC2) ELISA Kit |
DLR-STC2-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Stanniocalcin 2 (STC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Stanniocalcin 2 (STC2) ELISA Kit |
RD-STC2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Stanniocalcin 2 (STC2) ELISA Kit |
RD-STC2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Stanniocalcin 2 (STC2) ELISA Kit |
RDR-STC2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Stanniocalcin 2 (STC2) ELISA Kit |
RDR-STC2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
STC2 Rabbit pAb |
A10397-100ul |
Abclonal |
100 ul |
EUR 308 |
STC2 Rabbit pAb |
A10397-200ul |
Abclonal |
200 ul |
EUR 459 |
STC2 Rabbit pAb |
A10397-20ul |
Abclonal |
20 ul |
EUR 183 |
STC2 Rabbit pAb |
A10397-50ul |
Abclonal |
50 ul |
EUR 223 |
STC2 Rabbit pAb |
A8626-100ul |
Abclonal |
100 ul |
EUR 308 |
STC2 Rabbit pAb |
A8626-200ul |
Abclonal |
200 ul |
EUR 459 |
STC2 Rabbit pAb |
A8626-20ul |
Abclonal |
20 ul |
Ask for price |
STC2 Rabbit pAb |
A8626-50ul |
Abclonal |
50 ul |
Ask for price |
STC2 antibody |
70R-20583 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal STC2 antibody |
STC2 Antibody |
40339-100ul |
SAB |
100ul |
EUR 252 |
STC2 Antibody |
1-CSB-PA212583 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against STC2. Recognizes STC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
STC2 Antibody |
1-CSB-PA022822ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against STC2. Recognizes STC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
STC2 Antibody |
1-CSB-PA022822GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against STC2. Recognizes STC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Polyclonal STC2 Antibody (C-term) |
AMM08001G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STC2 (C-term). This antibody is tested and proven to work in the following applications: |
Stanniocalcin 2 Polyclonal (STC2) Antibody |
20-abx116921 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Polyclonal STC2 antibody - C-terminal region |
AMM08002G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STC2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
Polyclonal STC2 antibody - C-terminal region |
AMM08003G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STC2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
STC2 Conjugated Antibody |
C40339 |
SAB |
100ul |
EUR 397 |
Anti-STC2 antibody |
STJ111349 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers. |
Anti-STC2 antibody |
STJ112433 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers. |
Anti-STC2 antibody |
STJ192398 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to STC2 |
Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse) |
4-PAF913Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC2 (Ile53~Gln294)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2) |
STC2 siRNA |
20-abx905325 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STC2 siRNA |
20-abx935427 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STC2 siRNA |
20-abx935428 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Stanniocalcin-2 (STC2) Antibody |
abx025328-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Stanniocalcin-2 (STC2) Antibody |
abx025328-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Stanniocalcin-2 (STC2) Antibody |
abx027961-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Stanniocalcin-2 (STC2) Antibody |
abx027961-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Stanniocalcin 2 (STC2) Antibody |
20-abx101393 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Stanniocalcin-2 (STC2) Antibody |
20-abx123644 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Stanniocalcin-2 (STC2) Antibody |
20-abx126665 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Stanniocalcin-2 (STC2) Antibody |
abx145695-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Stanniocalcin 2 (STC2) Antibody |
20-abx174634 |
Abbexa |
|
|
|
Stanniocalcin 2 (STC2) Antibody |
abx238286-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Stanniocalcin 2 (STC2) Antibody |
abx238287-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Stanniocalcin 2 (STC2) Antibody |
20-abx241300 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Stanniocalcin-2 (STC2) Antibody |
20-abx321349 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), APC |
4-PAF913Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC2 (Ile53~Gln294)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with APC. |
Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAF913Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC2 (Ile53~Gln294)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with Biotin. |
Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAF913Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC2 (Ile53~Gln294)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with Cy3. |
Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), FITC |
4-PAF913Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC2 (Ile53~Gln294)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with FITC. |
Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), HRP |
4-PAF913Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC2 (Ile53~Gln294)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with HRP. |
Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), PE |
4-PAF913Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC2 (Ile53~Gln294)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with PE. |
STC2 cloning plasmid |
CSB-CL022822HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 909
- Sequence: atgtgtgccgagcggctgggccagttcatgaccctggctttggtgttggccacctttgacccggcgcgggggaccgacgccaccaacccacccgagggtccccaagacaggagctcccagcagaaaggccgcctgtccctgcagaatacagcggagatccagcactgtttggtcaa
- Show more
|
Description: A cloning plasmid for the STC2 gene. |
Monoclonal STC2 Antibody, Clone: 339CT13.2.6 |
AMM08000G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human STC2 . The antibodies are raised in Mouse and are from clone 339CT13.2.6. This antibody is applicable in WB, E |
Stanniocalcin 2 (STC2) Antibody Pair |
20-abx370393 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Anti-Stanniocalcin 2/STC2 Antibody |
PA1998 |
BosterBio |
100ug/vial |
EUR 294 |
Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAF913Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC2 (Ile53~Gln294)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with APC-Cy7. |
STC2 protein (His tag) |
80R-2847 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified recombinant STC2 protein (His tag) |
Mouse STC2 shRNA Plasmid |
20-abx972913 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat STC2 shRNA Plasmid |
20-abx986108 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human STC2 shRNA Plasmid |
20-abx955660 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
STC2 Recombinant Protein (Rat) |
RP231401 |
ABM |
100 ug |
Ask for price |
Recombinant Stanniocalcin 2 (STC2) |
4-RPF913Hu01 |
Cloud-Clone |
-
EUR 521.12
-
EUR 242.00
-
EUR 1679.20
-
EUR 626.40
-
EUR 1152.80
-
EUR 412.00
-
EUR 4048.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O76061
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 28.2kDa
- Isoelectric Point: 7.1
|
Description: Recombinant Human Stanniocalcin 2 expressed in: E.coli |
STC2 Recombinant Protein (Human) |
RP030379 |
ABM |
100 ug |
Ask for price |
STC2 Recombinant Protein (Mouse) |
RP175991 |
ABM |
100 ug |
Ask for price |
Human Stanniocalcin 2 (STC2) Protein |
20-abx069168 |
Abbexa |
-
EUR 732.00
-
EUR 286.00
-
EUR 2263.00
-
EUR 871.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human STC2 PicoKine ELISA Kit |
EK1988 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human STC2 in cell culture supernates, serum. |
Mouse STC2 PicoKine ELISA Kit |
EK1989 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse STC2 in cell culture supernates, serum and plasma (heparin). |
Rat STC2 PicoKine ELISA Kit |
EK1995 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of rat STC2 in cell culture supernates, serum and plasma (heparin). |
Stc2 ORF Vector (Rat) (pORF) |
ORF077135 |
ABM |
1.0 ug DNA |
EUR 506 |
STC2 ORF Vector (Human) (pORF) |
ORF010127 |
ABM |
1.0 ug DNA |
EUR 95 |
Stc2 ORF Vector (Mouse) (pORF) |
ORF058665 |
ABM |
1.0 ug DNA |
EUR 506 |
STC2 ELISA Kit (Human) (OKBB01358) |
OKBB01358 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Stanniocalcin-2 is a protein that in humans is encoded by the STC2 gene. It is mapped to 5q35.2. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <5pg/ml |
Stc2 ELISA Kit (Mouse) (OKBB01359) |
OKBB01359 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Stanniocalcin-2 is a protein that in humans is encoded by the STC2 gene. It is mapped to 11; 11 A4. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml |
Stc2 ELISA Kit (Rat) (OKBB01365) |
OKBB01365 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Stanniocalcin-2 is a protein that in humans is encoded by the STC2 gene. It is mapped to 10q12. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers. STC2 has opposite effects on calcium and phosphate homeostasis as compared to Stc1.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml |
STC2 ELISA Kit (Human) (OKCD08862) |
OKCD08862 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: Recombinant Human Stanniocalcin-2;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 13.6pg/mL |
STC2 ELISA Kit (Mouse) (OKEH05607) |
OKEH05607 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Has an anti-hypocalcemic action on calcium and phosphate homeostasis. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39 pg/mL |
STC2 ELISA Kit (Human) (OKEH02212) |
OKEH02212 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12 pg/mL |
Human Stanniocalcin-2(STC2) ELISA kit |
CSB-EL022822HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Stanniocalcin-2(STC2) ELISA kit |
1-CSB-EL022822HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-2(STC2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Stanniocalcin 2 (STC2) ELISA Kit |
20-abx153169 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Stanniocalcin 2 (STC2) ELISA Kit |
abx250668-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Rat Stc2/ Stanniocalcin-2 ELISA Kit |
E0948Ra |
Sunlong |
1 Kit |
EUR 646 |
Mouse Stc2/ Stanniocalcin-2 ELISA Kit |
E1422Mo |
Sunlong |
1 Kit |
EUR 632 |
Human STC2/ Stanniocalcin-2 ELISA Kit |
E2413Hu |
Sunlong |
1 Kit |
EUR 605 |
Human STC2(Stanniocalcin-2) ELISA Kit |
EH1394 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 31.2-2000 pg/ml
- Uniprot ID: O76061
- Alias: STC2/Stanniocalcin-2/STC-2/Stanniocalcin-related protein/STC-related protein/STCRP
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Human Stanniocalcin-2 (STC2) ELISA Kit |
abx575647-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Stanniocalcin-2 (STC2) ELISA Kit |
abx515852-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Rat Stanniocalcin-2 (STC2) ELISA Kit |
abx515853-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human Stanniocalcin 2 (STC2) CLIA Kit |
20-abx495054 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Stc2 sgRNA CRISPR Lentivector set (Rat) |
K6918301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Stc2 sgRNA CRISPR Lentivector set (Mouse) |
K3773801 |
ABM |
3 x 1.0 ug |
EUR 339 |
STC2 sgRNA CRISPR Lentivector set (Human) |
K2301501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Stanniocalcin 2 (STC2) ELISA Kit |
SEF913Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Stanniocalcin 2 (STC2) ELISA Kit |
SEF913Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Stanniocalcin 2 (STC2) ELISA Kit |
SEF913Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Stanniocalcin 2 (STC2) ELISA Kit |
SEF913Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Stanniocalcin 2 (STC2) ELISA Kit |
4-SEF913Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Stanniocalcin 2 elisa. Alternative names of the recognized antigen: STCRP
- Stanniocalcin-related protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human STC2 (Stanniocalcin 2) |
E-EL-H2192 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's STC2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human STC2. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human STC2 (Stanniocalcin 2) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human STC2 (Stanniocalcin 2) |
ELK3575 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 2 (STC2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
- Show more
|
Description: A sandwich ELISA kit for detection of Stanniocalcin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
STC2 Rabbit Polyclonal Antibody