CelltaGen
셀타젠 Genetic Genotyping

STC2 Rabbit Polyclonal Antibody

STC2 Polyclonal Antibody

ES11240-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against STC2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

STC2 Polyclonal Antibody

ES11240-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STC2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Stanniocalcin 2 (STC2) ELISA Kit

DLR-STC2-Hu-48T 48T
EUR 517
  • Should the Human Stanniocalcin 2 (STC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit

DLR-STC2-Hu-96T 96T
EUR 673
  • Should the Human Stanniocalcin 2 (STC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit

RD-STC2-Hu-48Tests 48 Tests
EUR 521

Human Stanniocalcin 2 (STC2) ELISA Kit

RD-STC2-Hu-96Tests 96 Tests
EUR 723

Human Stanniocalcin 2 (STC2) ELISA Kit

RDR-STC2-Hu-48Tests 48 Tests
EUR 544

Human Stanniocalcin 2 (STC2) ELISA Kit

RDR-STC2-Hu-96Tests 96 Tests
EUR 756

STC2 Rabbit pAb

A10397-100ul 100 ul
EUR 308

STC2 Rabbit pAb

A10397-200ul 200 ul
EUR 459

STC2 Rabbit pAb

A10397-20ul 20 ul
EUR 183

STC2 Rabbit pAb

A10397-50ul 50 ul
EUR 223

STC2 Rabbit pAb

A8626-100ul 100 ul
EUR 308

STC2 Rabbit pAb

A8626-200ul 200 ul
EUR 459

STC2 Rabbit pAb

A8626-20ul 20 ul Ask for price

STC2 Rabbit pAb

A8626-50ul 50 ul Ask for price

STC2 antibody

70R-20583 50 ul
EUR 435
Description: Rabbit polyclonal STC2 antibody

STC2 Antibody

40339-100ul 100ul
EUR 252

STC2 Antibody

1-CSB-PA212583
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STC2. Recognizes STC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

STC2 Antibody

1-CSB-PA022822ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STC2. Recognizes STC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STC2 Antibody

1-CSB-PA022822GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STC2. Recognizes STC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal STC2 Antibody (C-term)

AMM08001G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STC2 (C-term). This antibody is tested and proven to work in the following applications:

Stanniocalcin 2 Polyclonal (STC2) Antibody

20-abx116921
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polyclonal STC2 antibody - C-terminal region

AMM08002G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STC2 - C-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal STC2 antibody - C-terminal region

AMM08003G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STC2 - C-terminal region. This antibody is tested and proven to work in the following applications:

STC2 Conjugated Antibody

C40339 100ul
EUR 397

Anti-STC2 antibody

STJ111349 100 µl
EUR 277
Description: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.

Anti-STC2 antibody

STJ112433 100 µl
EUR 277
Description: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers.

Anti-STC2 antibody

STJ192398 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STC2

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse)

4-PAF913Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2)

STC2 siRNA

20-abx905325
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STC2 siRNA

20-abx935427
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STC2 siRNA

20-abx935428
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-STC2

PVT18772 2 ug
EUR 231

Stanniocalcin-2 (STC2) Antibody

abx025328-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Stanniocalcin-2 (STC2) Antibody

abx025328-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Stanniocalcin-2 (STC2) Antibody

abx027961-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Stanniocalcin-2 (STC2) Antibody

abx027961-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Stanniocalcin 2 (STC2) Antibody

20-abx101393
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stanniocalcin-2 (STC2) Antibody

20-abx123644
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Stanniocalcin-2 (STC2) Antibody

20-abx126665
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stanniocalcin-2 (STC2) Antibody

abx145695-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Stanniocalcin 2 (STC2) Antibody

20-abx174634
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Stanniocalcin 2 (STC2) Antibody

abx238286-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Stanniocalcin 2 (STC2) Antibody

abx238287-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Stanniocalcin 2 (STC2) Antibody

20-abx241300
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stanniocalcin-2 (STC2) Antibody

20-abx321349
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), APC

4-PAF913Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with APC.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAF913Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with Biotin.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), Cy3

4-PAF913Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with Cy3.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), FITC

4-PAF913Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with FITC.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), HRP

4-PAF913Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with HRP.

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), PE

4-PAF913Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with PE.

STC2 cloning plasmid

CSB-CL022822HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 909
  • Sequence: atgtgtgccgagcggctgggccagttcatgaccctggctttggtgttggccacctttgacccggcgcgggggaccgacgccaccaacccacccgagggtccccaagacaggagctcccagcagaaaggccgcctgtccctgcagaatacagcggagatccagcactgtttggtcaa
  • Show more
Description: A cloning plasmid for the STC2 gene.

Monoclonal STC2 Antibody, Clone: 339CT13.2.6

AMM08000G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human STC2 . The antibodies are raised in Mouse and are from clone 339CT13.2.6. This antibody is applicable in WB, E

Stanniocalcin 2 (STC2) Antibody Pair

20-abx370393
  • EUR 1748.00
  • EUR 1121.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Anti-Stanniocalcin 2/STC2 Antibody

PA1998 100ug/vial
EUR 294

Stanniocalcin 2 (STC2) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAF913Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC2 (Ile53~Gln294)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Stanniocalcin 2 (STC2). This antibody is labeled with APC-Cy7.

STC2 protein (His tag)

80R-2847 100 ug
EUR 327
Description: Purified recombinant STC2 protein (His tag)

Human STC2 ELISA Kit

ELA-E12206h 96 Tests
EUR 824

STC2 ELISA KIT|Human

EF000312 96 Tests
EUR 689

Mouse STC2 shRNA Plasmid

20-abx972913
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat STC2 shRNA Plasmid

20-abx986108
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human STC2 shRNA Plasmid

20-abx955660
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STC2 Recombinant Protein (Rat)

RP231401 100 ug Ask for price

Recombinant Stanniocalcin 2 (STC2)

4-RPF913Hu01
  • EUR 521.12
  • EUR 242.00
  • EUR 1679.20
  • EUR 626.40
  • EUR 1152.80
  • EUR 412.00
  • EUR 4048.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O76061
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.2kDa
  • Isoelectric Point: 7.1
Description: Recombinant Human Stanniocalcin 2 expressed in: E.coli

STC2 Recombinant Protein (Human)

RP030379 100 ug Ask for price

STC2 Recombinant Protein (Mouse)

RP175991 100 ug Ask for price

Human Stanniocalcin 2 (STC2) Protein

20-abx069168
  • EUR 732.00
  • EUR 286.00
  • EUR 2263.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human STC2 PicoKine ELISA Kit

EK1988 96 wells
EUR 425
Description: For quantitative detection of human STC2 in cell culture supernates, serum.

Mouse STC2 PicoKine ELISA Kit

EK1989 96 wells
EUR 425
Description: For quantitative detection of mouse STC2 in cell culture supernates, serum and plasma (heparin).

Rat STC2 PicoKine ELISA Kit

EK1995 96 wells
EUR 425
Description: For quantitative detection of rat STC2 in cell culture supernates, serum and plasma (heparin).

Stc2 ORF Vector (Rat) (pORF)

ORF077135 1.0 ug DNA
EUR 506

STC2 ORF Vector (Human) (pORF)

ORF010127 1.0 ug DNA
EUR 95

Stc2 ORF Vector (Mouse) (pORF)

ORF058665 1.0 ug DNA
EUR 506

Human Stanniocalcin-2(STC2) ELISA kit

CSB-EL022822HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Stanniocalcin-2(STC2) ELISA kit

1-CSB-EL022822HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-2(STC2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Stanniocalcin 2 (STC2) ELISA Kit

20-abx153169
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Stanniocalcin 2 (STC2) ELISA Kit

abx250668-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Rat Stc2/ Stanniocalcin-2 ELISA Kit

E0948Ra 1 Kit
EUR 646

Mouse Stc2/ Stanniocalcin-2 ELISA Kit

E1422Mo 1 Kit
EUR 632

Human STC2/ Stanniocalcin-2 ELISA Kit

E2413Hu 1 Kit
EUR 605

Human STC2(Stanniocalcin-2) ELISA Kit

EH1394 96T
EUR 567.6
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: O76061
  • Alias: STC2/Stanniocalcin-2/STC-2/Stanniocalcin-related protein/STC-related protein/STCRP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Stanniocalcin- 2, STC2 ELISA KIT

ELI-23671h 96 Tests
EUR 824

Rat Stanniocalcin- 2, Stc2 ELISA KIT

ELI-29857r 96 Tests
EUR 886

Mouse Stanniocalcin- 2, Stc2 ELISA KIT

ELI-52696m 96 Tests
EUR 865

Human Stanniocalcin-2 (STC2) ELISA Kit

abx575647-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Stanniocalcin-2 (STC2) ELISA Kit

abx515852-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Stanniocalcin-2 (STC2) ELISA Kit

abx515853-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Stanniocalcin 2 (STC2) CLIA Kit

20-abx495054
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Stc2 sgRNA CRISPR Lentivector set (Rat)

K6918301 3 x 1.0 ug
EUR 339

Stc2 sgRNA CRISPR Lentivector set (Mouse)

K3773801 3 x 1.0 ug
EUR 339

STC2 sgRNA CRISPR Lentivector set (Human)

K2301501 3 x 1.0 ug
EUR 339

Human Stanniocalcin 2 (STC2) ELISA Kit

SEF913Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit

SEF913Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit

SEF913Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit

SEF913Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit

4-SEF913Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Stanniocalcin 2 elisa. Alternative names of the recognized antigen: STCRP
  • Stanniocalcin-related protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human STC2 (Stanniocalcin 2)

E-EL-H2192 1 plate of 96 wells
EUR 534
  • Gentaur's STC2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human STC2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human STC2 (Stanniocalcin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human STC2 (Stanniocalcin 2)

ELK3575 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 2 (STC2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
  • Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Stc2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6918302 1.0 ug DNA
EUR 154

Stc2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6918303 1.0 ug DNA
EUR 154

Stc2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6918304 1.0 ug DNA
EUR 154

Stc2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3773802 1.0 ug DNA
EUR 154

Stc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3773803 1.0 ug DNA
EUR 154

Stc2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3773804 1.0 ug DNA
EUR 154

STC2 Rabbit Polyclonal Antibody