TBX6 Rabbit Polyclonal Antibody

TBX6 Rabbit Polyclonal Antibody

TBX6 Rabbit pAb
A16979-100ul	Abclonal	100 ul	EUR 308

TBX6 Rabbit pAb
A16979-200ul	Abclonal	200 ul	EUR 459

TBX6 Rabbit pAb
A16979-20ul	Abclonal	20 ul	EUR 183

TBX6 Rabbit pAb
A16979-50ul	Abclonal	50 ul	EUR 223

TBX6 antibody
70R-20729	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TBX6 antibody

TBX6 Antibody
43507-100ul	SAB	100ul	EUR 252

TBX6 Antibody
1-CSB-PA023258GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TBX6 Antibody
1-CSB-PA023258LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal TBX6 Antibody (Center W158)
APR03597G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBX6 (Center W158). This antibody is tested and proven to work in the following applications:

Polyclonal TBX6 antibody - N-terminal region
APR00629G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBX6 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal TBX6 antibody - N-terminal region
APR00630G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBX6 - N-terminal region. This antibody is tested and proven to work in the following applications:

T-box 6 (TBX6) polyclonal antibody
ABP-PAB-11162	Allele Biotech	100 ug	Ask for price
Product line: Transcription Factors Brand:

TBX6 Conjugated Antibody
C43507	SAB	100ul	EUR 397

anti- TBX6 antibody
FNab08542	FN Test	100µg	EUR 548.75
Immunogen: T-box 6 Uniprot ID: O95947 Gene ID: 6911 Research Area: Stem Cells, Metabolism, Developmental biology
Description: Antibody raised against TBX6

Anti-TBX6 antibody
PAab08542	Lifescience Market	100 ug	EUR 386

Anti-TBX6 antibody
STJ119283	St John's Laboratory	100 µl	EUR 277

Anti-TBX6 antibody
STJ192376	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to TBX6

TBX6 siRNA
20-abx905487	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TBX6 siRNA
20-abx936276	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TBX6 siRNA
20-abx936277	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TBX6 Antibody, HRP conjugated
1-CSB-PA023258LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TBX6 Antibody, FITC conjugated
1-CSB-PA023258LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TBX6 Antibody, Biotin conjugated
1-CSB-PA023258LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TBX6 cloning plasmid
CSB-CL023258HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1311 Sequence: atgtaccatccacgagaattgtacccgtccctgggggccggctaccgcctggggcccgcccaacctggggccgactccagcttcccacccgccctagcggagggctaccgctaccccgaactggacacccctaaactggattgcttcctctccgggatggaggctgctccccgca Show more
Description: A cloning plasmid for the TBX6 gene.

Anti-TBX6 (2D11)
YF-MA15744	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TBX6

Anti-TBX6 (3D6)
YF-MA15745	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TBX6

Anti-TBX6 (3F6)
YF-MA15746	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TBX6

Anti-TBX6 (1D11)
YF-MA15747	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TBX6

Anti-TBX6 (3G9)
YF-MA15748	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TBX6

Anti-TBX6 (3F8)
YF-MA15749	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TBX6

Anti-TBX6 (3F11)
YF-MA15750	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TBX6

T-Box 6 (TBX6) Antibody
20-abx116009	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Mouse T- box transcription factor TBX6, Tbx6 ELISA KIT
ELI-53153m	Lifescience Market	96 Tests	EUR 865

Human T- box transcription factor TBX6, TBX6 ELISA KIT
ELI-46478h	Lifescience Market	96 Tests	EUR 824

TBX6 ELISA KIT|Human
EF003487	Lifescience Market	96 Tests	EUR 689

Human TBX6 shRNA Plasmid
20-abx954737	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse TBX6 shRNA Plasmid
20-abx973010	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat TBX6 shRNA Plasmid
20-abx990618	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TBX6 Recombinant Protein (Human)
RP031096	ABM	100 ug	Ask for price

TBX6 Recombinant Protein (Rat)
RP232541	ABM	100 ug	Ask for price

TBX6 Recombinant Protein (Mouse)
RP177695	ABM	100 ug	Ask for price

T-Box Protein 6 (TBX6) Antibody
abx122846-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

T-Box Protein 6 (TBX6) Antibody
20-abx003056	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

T-Box Protein 6 (TBX6) Antibody
abx026378-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

T-Box Protein 6 (TBX6) Antibody
abx026378-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

T-Box Protein 6 (TBX6) Antibody
abx026525-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

T-Box Protein 6 (TBX6) Antibody
abx026525-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

T-Box Protein 6 (TBX6) Antibody
abx238542-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

T-Box Protein 6 (TBX6) Antibody
20-abx301812	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Monoclonal TBX6 Antibody (monoclonal) (M06), Clone: 1D11
AMM04176G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human TBX6 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 1D11. This antibody is applicable in WB and IF

Monoclonal TBX6 Antibody (monoclonal) (M08), Clone: 3G9
AMM04177G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human TBX6 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 3G9. This antibody is applicable in E

T-Box Protein 6 (TBX6) Antibody (HRP)
20-abx315341	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

T-Box Protein 6 (TBX6) Antibody (FITC)
20-abx315342	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

T-Box Protein 6 (TBX6) Antibody (Biotin)
20-abx315343	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tbx6 ORF Vector (Mouse) (pORF)
ORF059233	ABM	1.0 ug DNA	EUR 506

TBX6 ORF Vector (Human) (pORF)
ORF010366	ABM	1.0 ug DNA	EUR 95

Tbx6 ORF Vector (Rat) (pORF)
ORF077515	ABM	1.0 ug DNA	EUR 506

TBX6 sgRNA CRISPR Lentivector set (Human)
K2344601	ABM	3 x 1.0 ug	EUR 339

Tbx6 sgRNA CRISPR Lentivector set (Rat)
K6168801	ABM	3 x 1.0 ug	EUR 339

Tbx6 sgRNA CRISPR Lentivector set (Mouse)
K3972501	ABM	3 x 1.0 ug	EUR 339

TBX6 sgRNA CRISPR Lentivector (Human) (Target 1)
K2344602	ABM	1.0 ug DNA	EUR 154

TBX6 sgRNA CRISPR Lentivector (Human) (Target 2)
K2344603	ABM	1.0 ug DNA	EUR 154

TBX6 sgRNA CRISPR Lentivector (Human) (Target 3)
K2344604	ABM	1.0 ug DNA	EUR 154

Tbx6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6168802	ABM	1.0 ug DNA	EUR 154

Tbx6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6168803	ABM	1.0 ug DNA	EUR 154

Tbx6 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6168804	ABM	1.0 ug DNA	EUR 154

Tbx6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3972502	ABM	1.0 ug DNA	EUR 154

Tbx6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3972503	ABM	1.0 ug DNA	EUR 154

Tbx6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3972504	ABM	1.0 ug DNA	EUR 154

TBX6 Protein Vector (Human) (pPB-C-His)
PV041461	ABM	500 ng	EUR 329

TBX6 Protein Vector (Human) (pPB-N-His)
PV041462	ABM	500 ng	EUR 329

TBX6 Protein Vector (Human) (pPM-C-HA)
PV041463	ABM	500 ng	EUR 329

TBX6 Protein Vector (Human) (pPM-C-His)
PV041464	ABM	500 ng	EUR 329

TBX6 Protein Vector (Rat) (pPB-C-His)
PV310058	ABM	500 ng	EUR 603

TBX6 Protein Vector (Rat) (pPB-N-His)
PV310059	ABM	500 ng	EUR 603

TBX6 Protein Vector (Rat) (pPM-C-HA)
PV310060	ABM	500 ng	EUR 603

TBX6 Protein Vector (Rat) (pPM-C-His)
PV310061	ABM	500 ng	EUR 603

TBX6 Protein Vector (Mouse) (pPB-C-His)
PV236930	ABM	500 ng	EUR 603

TBX6 Protein Vector (Mouse) (pPB-N-His)
PV236931	ABM	500 ng	EUR 603

TBX6 Protein Vector (Mouse) (pPM-C-HA)
PV236932	ABM	500 ng	EUR 603

TBX6 Protein Vector (Mouse) (pPM-C-His)
PV236933	ABM	500 ng	EUR 603

Tbx6 3'UTR GFP Stable Cell Line
TU170247	ABM	1.0 ml	Ask for price

Tbx6 3'UTR Luciferase Stable Cell Line
TU120247	ABM	1.0 ml	Ask for price

TBX6 3'UTR GFP Stable Cell Line
TU075252	ABM	1.0 ml	EUR 1394

TBX6 Rabbit Polyclonal Antibody